CN106434630B

CN106434630B - Bovine parainfluenza virus type 3 HN protein aptamer and screening method thereof

Info

Publication number: CN106434630B
Application number: CN201610852658.4A
Authority: CN
Inventors: 王真; 成杰; 鲁琳; 王家伟
Original assignee: Beijing University of Agriculture
Current assignee: Beijing University of Agriculture
Priority date: 2016-09-26
Filing date: 2016-09-26
Publication date: 2020-07-07
Anticipated expiration: 2036-09-26
Also published as: CN106434630A

Abstract

The invention relates to a bovine parainfluenza virus type-3 HN protein aptamer and a screening method thereof, belonging to the field of bioengineering. The invention obtains a plurality of aptamer candidates of HN protein by screening in different rounds of a microplate method, selects aptamers with higher frequency of occurrence in a sequencing result, determines the binding force with the HN protein by using an I-ELAA method, wherein KD values of three aptamers W-32, W-33 and W-34 are respectively 56.57 +/-2.7 nM, 24.64 +/-2.84 nM and 31.3 +/-3.32 nM, and secondary structure prediction shows that the aptamers all have stable neck ring-shaped or hairpin-shaped structures, which shows that the screened three aptamers can be specifically and stably bound with the HN protein and can be used for establishing an enzyme-linked aptamer method for detecting BPIV3 antigen or antibody subsequently.

Description

Bovine parainfluenza virus type 3 HN protein aptamer and screening method thereof

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to a bovine parainfluenza virus type-3 HN protein aptamer and a screening method thereof.

Background

The exponential enrichment of ligand phylogenetic evolution (SELEX) is a screening technique that can obtain oligonucleotides that specifically bind to a target substance, and the single-stranded DNA or RNA molecules obtained by screening are called aptamers. The nucleotide not only has the function of storing and transmitting genetic information, but also can interact with other molecules through the specific spatial structure of the nucleotide. Under appropriate conditions, single-stranded DNA or RNA molecules can be folded adaptively to form structures such as hairpins, bulge loops, tetrads and the like, so that the single-stranded DNA or RNA molecules are tightly combined with target substances. Therefore, in recent years, aptamers having characteristics such as high specificity, high affinity, high stability, low immunogenicity, low molecular weight, and easy synthesis have been widely used. The methods for screening aptamers are also diversified, such as a capillary method, affinity chromatography, magnetic bead separation, a microplate method and the like. The capillary method is a technique using capillary electrophoresis as a separation method, in which a nucleotide sequence bound to a target substance and a sequence not bound to the target substance have different mobilities in a capillary, thereby separating a bound sequence from an unbound sequence; the method has the characteristics of rapidness, trace quantity and the like, but needs a special instrument (a capillary electrophoresis instrument) and is more suitable for screening molecules with large molecular weight. The affinity chromatography separation is that the target molecule is coupled to a glass strain or resin through a covalent bond or a non-covalent bond, after the target molecule reacts with the library, the binding sequence is remained on the resin, but the binding sequence flows away through a chromatographic column, thereby achieving the purpose of separation; this method requires that the target molecule must have an affinity tag or functional group that can be coupled to the glass bead or resin. The microplate method comprises binding target molecules to a microplate by physical adsorption, adding aptamer library, incubating, discarding unbound aptamers, and eluting aptamers bound to the target molecules; the method is suitable for wide range of target molecules, has no strict requirement on the properties of the target molecules, and can screen all substances which can be specifically adsorbed to the microporous plate. However, an appropriate screening method should be used for different target substances in order to rapidly and accurately screen aptamers with high affinity and strong specificity. In order to obtain the aptamer with high binding force and specificity of bovine parainfluenza virus type 3 HN protein, a more traditional microplate method is adopted, and improvement and optimization are carried out.

Disclosure of Invention

The invention aims to solve the defects of the prior art, and provides a bovine parainfluenza virus type 3 HN protein aptamer and a screening method thereof, which improves and optimizes the screening method of the bovine parainfluenza virus type 3 aptamer and has the advantages of wide application target molecules, low requirement on the target molecules, simple and convenient operation, cost saving and the like. Meanwhile, the HN protein aptamer obtained by screening by the method lays a foundation for the establishment of an enzyme-linked aptamer method for detecting BPIV3 antigen or antibody subsequently.

The invention adopts the following technical scheme:

the method for screening the aptamer of the bovine parainfluenza virus type 3 HN protein comprises the following steps:

the method comprises the following steps: designing and synthesizing an initial oligonucleotide library and an upstream primer and a downstream primer for PCR amplification;

step two, coating: absorbing HN protein solution to coat in a micropore plate;

step three, washing the plate: throwing off the coating liquid, washing the microporous plate, and spin-drying;

step four, sealing: adding HEPES solution containing BSA into the micropores, and incubating;

step five, adding a nucleic acid aptamer library: throwing off the blocking solution, washing with HEPES, spin-drying, adding the dissolved initial oligonucleotide library (dissolved in 400 μ L HEPES buffer solution when in use, incubating at 95 ℃ for 10min, rapidly performing ice bath for 10min for later use) into the sealed micropores, and incubating;

step six, washing the plate: throwing off the oligonucleotide library, washing the microporous plate, and beating the residual washing liquid in the pores;

step seven, elution: adding nucleic acid eluent into the micropores, and incubating;

step eight, extraction: sucking the eluent out, and extracting the aptamer in the eluent;

step nine, PCR: respectively carrying out a round of symmetrical PCR and a round of asymmetrical PCR on the aptamer extracted in the step eight;

step ten, glue recovery: recovering the PCR product;

step eleven, reverse screening: and (3) carrying out reverse screening from the 5 th round, sealing, adding the aptamer recovered by the asymmetric PCR into a reverse screening hole, sucking out the supernatant after incubation, and adding the supernatant into the HN protein-coated micropore for incubation.

Furthermore, the method for screening the aptamer of the HN protein of bovine parainfluenza virus type 3 comprises the steps of selecting an initial oligonucleotide library having a sequence shown in SEQ ID NO.1, an upstream primer having a sequence shown in SEQ ID NO.2, and a downstream primer having a sequence shown in SEQ ID NO. 3.

Furthermore, the method for screening the aptamer of bovine parainfluenza virus type 3 HN protein comprises the following steps: absorbing 100 mu L of HN protein solution to coat in a 96-hole ELISA microplate, and staying overnight at 4 ℃; the plate washing in the third step is specifically as follows: spin-off coating solution, wash the plate three times with 300 μ L HEPEST, which is HEPES containing 0.05% Tween 20, spin-dry.

Furthermore, the method for screening the aptamer of bovine parainfluenza virus type 3 HN protein, wherein the blocking in the fourth step is specifically: mu.L of HEPES solution containing 3% BSA was added to the microwells and incubated at 37 ℃ for 2 hours.

Furthermore, the method for screening aptamers of bovine parainfluenza virus type 3 HN protein, wherein the aptamer library in the fifth step specifically comprises: the blocking solution was spun off, washed three times with HEPEST, spun dry, and 100uL of the solubilized initial oligonucleotide library was added to the blocked wells and incubated for 1h at 37 ℃.

Furthermore, the method for screening aptamer of bovine parainfluenza virus type 3 HN protein comprises the following steps: spin off the oligonucleotide library, wash the microplate four times with 300 μ L HEPEST, pat dry the residual wash solution in the wells; the elution in the seventh step is specifically as follows: mu.L of nucleic acid eluent was added to the microwells and incubated at 80 ℃ for 10 min.

Furthermore, the method for screening the aptamer of bovine parainfluenza virus type 3 HN protein comprises the following steps: the eluate was aspirated off, phenol extraction was performed using 25:24:1 phenol: chloroform: extracting the aptamer in the eluent by using isoamyl alcohol.

Furthermore, the method for screening the aptamer of the HN protein of bovine parainfluenza virus type 3 comprises a ninth step, wherein the symmetric PCR specifically comprises 25 μ L of 2 × Mix, 25 μ L of WZ-031 μ L of WZ-041 μ L of aptamer, 20 μ L of deionized water, the reaction conditions are 95 ℃, 10min, 95 ℃, 20s, 65 ℃, 20s, 72 ℃, 30s, 15 cycles, and 72 ℃ for 5min, and the asymmetric PCR specifically comprises 25 μ L of 2 × Mix, 30 μ L of WZ-031 μ L of WZ-040.02 μ L of aptamer, 5 μ L of deionized water, 19 μ L of deionized water, the reaction conditions are 95 ℃, 10min, 95 ℃, 20s, 65 ℃, 20s, 72 ℃, 30s, 28 cycles, and 72 ℃ for 5 min.

Furthermore, the method for screening an aptamer of bovine parainfluenza virus type 3 HN protein, wherein the gel recovery in step ten comprises: PCR products were recovered using a Bioteke short fragment DNA gel recovery kit as per the instructions.

Furthermore, the method for screening the aptamer of bovine parainfluenza virus type 3 HN protein comprises the following steps: carrying out reverse screening from the 5 th round, namely coating the HN protein in a microporous plate and simultaneously coating a coating solution without the HN protein in a reverse screening hole, sealing under the same condition, adding the aptamer recovered by asymmetric PCR into the reverse screening hole, incubating at 37 ℃ for 30min, sucking out the supernatant, adding the supernatant into the micropore coated with the HN protein, and incubating for 1h

Compared with the prior art, the invention has the beneficial effects that:

the invention improves and optimizes the traditional microplate method, and obtains the aptamer which has high binding force and specificity with the bovine parainfluenza virus type 3 HN protein. The micropore plate separation utilizes the function that the ELISA plate can adsorb target molecules, thereby achieving the purpose of separation. Binding target molecules on a micropore plate through physical adsorption, incubating with an aptamer library, removing unbound aptamers, and adding a denaturing solution to elute the aptamer bound with the target molecules from the micropore plate. The method is suitable for wide range of target molecules, has no strict requirement on the properties of the target molecules, and can screen all substances which can be specifically adsorbed to the microporous plate. In addition, the method does not need to use special instruments, equipment and materials, is simple and convenient to operate and saves cost.

Drawings

FIG. 1 shows the results of the symmetric PCR and asymmetric PCR agarose electrophoresis of round 1 screening, in which 1: symmetric PCR samples; 2: asymmetric PCR samples; m: low molecular weight marker (50-400bp) N: negative control;

FIG. 2 shows the results of symmetric PCR and asymmetric PCR agarose electrophoresis in round 2 screening, in which 1: symmetric PCR samples; 2: asymmetric PCR samples; m: low molecular weight marker (50-400bp) N: negative control;

FIG. 3 shows the results of symmetric PCR and asymmetric PCR agarose electrophoresis in 9 th round of selection, in which 1: symmetric PCR samples; 2: asymmetric PCR samples; m: low molecular weight marker (50-400bp) N: negative control;

FIG. 4 shows the results of symmetric PCR and asymmetric PCR agarose electrophoresis in round 10 screening, in which the ratio of 1: symmetric PCR samples; 2: asymmetric PCR samples; m: low molecular weight marker (50-400bp) N: negative control;

FIG. 5 shows the results of the symmetric PCR agarose electrophoresis of round 11 screening, in which 1: symmetric PCR samples; m: low molecular weight marker (50-400bp) N: negative control;

FIG. 6 shows the results of the binding rate measurements for different rounds of aptamer libraries;

FIG. 7 shows the result of PCR identification of transformant bacterial liquid, wherein M: low molecular weight marker; n: negative control; the other holes are samples;

FIG. 8 is a Sigma Plot10.0 plot of the fit curves for different concentrations of aptamers;

FIG. 9 shows the prediction results of aptamer W-32 secondary structure;

FIG. 10 shows the prediction results of aptamer W-33 secondary structure;

FIG. 11 shows the prediction results of aptamer W-34 secondary structure;

Detailed Description

The present invention will be described in further detail with reference to examples.

It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention.

Example 1 screening

HN protein solution, which is expressed and stored by the laboratory pronucleus;

initial oligonucleotide library sequences: 5' -TAG GGA ATT CGT CGA CGG ATC C- (N)₄₀C TGC AGGTCG ACG CAT GCG CCG, synthesized by Shanghai Bioengineering Co., Ltd. The synthesis method comprises the following steps: 20OD is synthesized by a single tube, and the molar weight is 24 nmol. The preparation is applied by dissolving in 400 μ L HEPES buffer, and incubating at 95 deg.C for 10 min. Quickly cooling in ice bath for 10 min.

PCR primer sequences: upstream primer WZ03: 5' -BIO-TAGGGAATTCGTCGACGGATCC; downstream primer WZ 04: CGGCGCATGCGTCGACCTGCAG are provided.

The specific screening method is as follows:

step one, coating: pipette 100. mu.L of HN protein solution into 96-well ELISA plates overnight at 4 ℃.

Step two, washing the plate: the coating solution was spun off, and the plate was washed three times with 300. mu.L of HEPES (0.05% Tween 20 in HEPES) and spun-dried.

Step three, sealing: mu.L of HEPES solution containing 3% BSA was added to the microwells and incubated at 37 ℃ for 2 hours.

Step four, adding an aptamer library: spin off the blocking solution, wash three times with HEPES, spin dry. 100uL of the dissolved initial oligonucleotide library was added to the closed microwells and incubated at 37 ℃ for 1 h.

Step five, washing the plate: spin off the oligonucleotide library, wash the plate four times with 300 μ L HEPES, and blot the residual wash in the wells.

Step six, elution: mu.L of nucleic acid eluent was added to the microwells and incubated at 80 ℃ for 10 min.

Step seven, extraction: the eluate was aspirated off, phenol extraction was performed using 25:24:1 phenol: chloroform: extracting the aptamer in the eluent by using isoamyl alcohol.

Step eight, PCR: respectively carrying out a round of symmetrical PCR and a round of asymmetrical PCR on the aptamer extracted in the step;

the symmetric PCR is specifically 2 × Mix 25 muL, WZ-031 muL, WZ-041 muL, aptamer 3 muL, deionized water 20 muL, the reaction conditions are 95 ℃, 10min, 95 ℃, 20s, 65 ℃, 20s, 72 ℃, 30s, 15 cycles, 72 ℃, 5 min;

the asymmetric PCR is specifically 2 × Mix 25 muL, WZ-031 muL, WZ-040.02 muL, aptamer 5 muL, and deionized water 19 muL under the reaction conditions of 95 ℃, 10min, 95 ℃, 20s, 65 ℃, 20s, 72 ℃, 30s, 28 cycles, 72 ℃ and 5 min.

Step nine, glue recovery: PCR products were recovered using a Bioteke short fragment DNA gel recovery kit as per the instructions.

Step ten, reverse screening: and (3) carrying out reverse screening from the 5 th round, namely coating the HN protein in a microporous plate and simultaneously coating a coating solution without the HN protein in a reverse screen hole, sealing under the same condition, adding the aptamer recovered by the asymmetric PCR into the reverse screen hole, incubating at 37 ℃ for 30min, sucking out the supernatant, and adding the supernatant into the microporous plate coated with the HN protein for incubation for 1 h. The anti-mesh is to avoid screening for aptamers that bind non-specifically to the microplate and BSA.

In each screening cycle, the aptamer solution obtained from the microplate eluent was purified using a volume ratio of 25:24:1 phenol: chloroform: isoamyl alcohol extraction, using a Bioteke short fragment DNA recovery kit to recover aptamer candidates, then using the recovered products as templates to carry out conventional PCR amplification, and then carrying out one round of asymmetric PCR amplification to obtain single-stranded nucleotide molecules with target band size of about 84bp for the next round of screening. Screening was performed to round 11, and the symmetric PCR products were ligated to the T-vector for transformation, cloning and sequencing. The results of the electrophoresis in the 1 st round of screening are shown in FIG. 1, the results of the electrophoresis in the 2 nd round of screening are shown in FIG. 2, the results of the electrophoresis in the 9 th round of screening are shown in FIG. 3, the results of the electrophoresis in the 10 th round of screening are shown in FIG. 4, and the results of the electrophoresis in the 11 th round of screening are shown in FIG. 5.

Example 2 monitoring of aptamer library binding Rate

After 11 rounds of selection, asymmetric PCR amplification was performed on the 5 th, 9 th, 10 th and 11 th aptamer libraries using the biotin-labeled WZ03 primer, and the asymmetric PCR products were recovered with gel to obtain biotin-labeled aptamers (Bio-aptamers), and the Bio-aptamer concentration was adjusted to 200nM for each round using HEPES solution. The binding rate of HN protein was determined by indirect enzyme-linked aptamer assay (i-ELAA).

The indirect enzyme-linked aptamer method comprises the following specific steps:

Step four, adding an aptamer: spin off the blocking solution, wash three times with HEPES, spin dry. 100uL of Bio-aptamer was added to each round of closed wells and incubated for 1h at 37 ℃.

Step five, adding a secondary antibody: the Bio-aptamer was spun off, the plate washed four times with 300. mu.L HEPES, the residual wash in the wells was blotted dry, 100. mu.L of HRP-SA diluted 1:8000 was added to the wells and incubated at 37 ℃ for 1 h.

Step six, developing color: and (3) throwing off the secondary antibody, washing the microporous plate for four times by using 300 mu L of HEPES, beating dry the residual washing solution in the pores, mixing the color development solution A and the color development solution B in equal volume, sucking 100 mu L of color development solution, adding the mixture into the pores, and developing for 10min at 37 ℃.

Step seven, terminating: stop solution 2M H was added to each well₂SO₄The color development was stopped at 50. mu.L.

Step eight, reading: the bioabsorption value (OD) at 450nm wavelength was read for each well using an automated microplate reader.

After 11 rounds of screening, the binding force between aptamers obtained in the initial aptamer library, 5 th, 9 th, 10 th and 11 th rounds and HN protein was evaluated. The absorbance value was determined by the indirect ELAA method, i.e. after incubation of the same concentration of biotin-labeled aptamer library with the same concentration of protein. OD₄₅₀The higher the value, the higher the binding rate of the aptamer to HN protein, the stronger the binding force, and the results are shown in FIG. 6. As can be seen from FIG. 6, as the number of screening increases, the amount of binding of aptamer to HN protein increases, and the OD₄₅₀The values are higher and higher. OD starting from round 11₄₅₀The value did not increase any more, indicating that the aptamer binding specifically to HN protein was single to reach a steady state.

Example 3 sequencing

Connecting the PCR product amplified in the last round with a T vector, converting the T vector into competent cells, selecting a single colony for PCR identification, and sending a positive sample to Beijing Optimalaceae New industry organism Limited for sequence determination.

1. Ligation transformation

The aptamer recovered in round 11 was subjected to one round of symmetric PCR to obtain dsDNA, which was ligated with pEASY-T1 vector. Transformation was performed exactly as described in pEASY-T1 Simple Cloning Kit. The transformation products were spread evenly on LB solid medium containing kanamycin and incubated overnight at 37 ℃ in an incubator. White and blue colonies can be seen, and the white colonies are competent cells which are successfully transformed.

2. Enrichment culture, identification and sequencing of transformant

And (3) proliferation: white colonies were aseptically picked up in 1mL LB liquid medium containing kanamycin and shake-cultured at 37 ℃ for 18 h.

PCR identification and plasmid extraction: the PCR identification of the proliferated colonies was performed using the pEASY-T1 vector universal primer. Plasmids were extracted using the plasmid miniprep kit from edley.

Sequencing: the extracted positive plasmid is sent to Beijing Optimus department New industry biology Co Ltd for sequencing.

After connecting the PCR amplification product using the microplate eluent from the 11 th round of screening as a template with a T vector, transforming competent cells, plating to select transformants, selecting 106 transformants in total, and after proliferation, identifying 104 positive transformants by PCR, wherein partial PCR results are shown in FIG. 7. The band of interest was recovered and sequenced, and co-sequencing succeeded for 104 aptamers, where W-32, W-33 and W-34 repeated 7, 11 and 9 times, respectively (see Table 1), suggesting that W-32, W-33 and W-34 are maximally enriched and thus most likely to specifically bind to HN protein.

TABLE 1 aptamer sequencing results

Example 4 measurement of KD value of aptamer by Indirect enzyme-Linked aptamer method

Three aptamers W-32, W-33 and W-34 with more repeated screening times are selected, a single aptamer marked by 5' end biotin is chemically synthesized, and the KD value of each aptamer is determined by adopting an indirect enzyme-linked aptamer method. The procedure for the determination was as follows:

Step four, adding an aptamer: spin off the blocking solution, wash three times with HEPES, spin dry. 100uL of aptamers W-32, W-33 and W-34 were pipetted into the closed wells, and incubated at 37 ℃ for 1 h.

Step five, adding a secondary antibody: spin off the aptamer, wash the plate four times with 300. mu.L HEPES, blot the residual wash in the wells, add 100. mu.L of HRP-SA diluted 1:8000 to the wells, and incubate at 37 ℃ for 1 h.

Step seven, terminating: add 50. mu.L of stop solution (2M H) to each well₂SO₄) The color development was terminated.

Step eight, reading: the absorbance (OD) at a wavelength of 450nm was read for each well using an automatic microplate reader.

Step nine, calculating: according to the formula Y ═ B_maxX/(K_d+ X) to calculate the KD value for each aptamer. Wherein Y represents OD₄₅₀Mean value, Bmax represents maximum OD₄₅₀The value, X, represents the aptamer concentration.

The aptamers W-32, W-33 and W-34 with high repeated frequency in the sequencing results were selected, biotin-labeled single-stranded nucleotides were synthesized according to their sequences, and the binding force between 3 aptamers and HN protein was determined by I-ELAA method. The results are shown in tables 2, 3 and 4, respectively, and show that 3 aptamers were able to specifically bind to HN protein.

TABLE 2I-ELAA method for determining aptamer W-32 binding OD₄₅₀Value of

TABLE 3I-ELAA method for determining aptamer W-33 binding OD₄₅₀Value of

TABLE 4I-ELAA method for determining aptamer W-34 binding OD₄₅₀Value of

Analysis of the above data using the software Sigma Plot10.0 as shown in fig. 8, Kd values for aptamers W-32, W-33 and W-34 were calculated according to the formula Y ═ BmaxX/(Kd + X) as 56.57 ± 2.7nM, 24.64 ± 2.84nM and 31.3 ± 3.32nM, respectively, and the results showed that all Kd values for 3 aptamers reached nanomolar levels, with aptamer W-33 binding slightly higher than the other two aptamers.

Example 5 aptamer Secondary Structure prediction

The secondary structures of the three aptamers screened by adopting online nucleic acid structure prediction software MFOLD analysis are as follows: http:// mfold. rit. albany. edu.

The results of predicting the secondary structures of aptamers W-32, W-33 and W-34 via the online website are shown in FIG. 9, FIG. 10 and FIG. 11, respectively. As can be seen from FIGS. 9 to 11, all of the 3 aptamers have a stable neck loop or hairpin structure and can form stable binding with the target molecule HN protein under certain conditions.

Therefore, the present invention obtains a plurality of aptamer candidates for the HN protein by different rounds of microplate screening. An aptamer with a high frequency of occurrence in a sequencing result is selected, the binding force of the aptamer and HN protein is determined by an I-ELAA method, the KD values of three aptamers W-32, W-33 and W-34 are 56.57 +/-2.7 nM, 24.64 +/-2.84 nM and 31.3 +/-3.32 nM respectively, and secondary structure prediction shows that the aptamers all have stable neck ring-shaped or hairpin-shaped structures, so that the three aptamers screened at this time can be specifically and stably bound with the HN protein, and the method can be used for establishing an enzyme-linked aptamer method for detecting BPIV3 antigen or antibody subsequently.

The sequences involved in the present invention are shown in table 5 below:

TABLE 5 sequence listing

It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims

1. Bovine parainfluenza virus type 3 HN protein aptamer having the sequence of TAGGGAATTCGTCGACGGATCC TGGATAACAGGGTGAACGAGCCGCTTCAAAGGTCTAGTTGCTGCAGGTCGACGCATGCGCCG, TAGGGAATTCGTCGACGGATC CCTAGTTAAAGGATAAGCAAGTCGCCGAGGCAACCAATGTGCTGCAGGTCGACGCATGCGCCG or TAGGGAATTCGTCGACGGATCTCACCTGGGGGACAATGAGTCTAGAGCCCCATCGCAACTCCTGCAGGTCGACGCATGCGCCG.