CN107988431A - A kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus and its application - Google Patents
A kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus and its application Download PDFInfo
- Publication number
- CN107988431A CN107988431A CN201711323273.XA CN201711323273A CN107988431A CN 107988431 A CN107988431 A CN 107988431A CN 201711323273 A CN201711323273 A CN 201711323273A CN 107988431 A CN107988431 A CN 107988431A
- Authority
- CN
- China
- Prior art keywords
- type
- parainfluenza virus
- pcr
- bovine parainfluenza
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
RT PCR amplifications primer and its application the invention discloses a kind of quick detection 3 type of bovine parainfluenza virus, belong to animal bacteria and biology field.The RT PCR amplifications primer is by with SEQ ID NO:The sense primer of nucleotide sequence shown in 1 and there is SEQ ID NO:The anti-sense primer composition of nucleotide sequence shown in 2；Above-mentioned primer is used to prepare the RT PCR amplification kits of detection 3 type of bovine parainfluenza virus.The RT PCR detection methods that the kit provides have the specificity and sensitiveness of height, it is reproducible, it is with a high credibility, specific detection goes out 3 type of bovine parainfluenza virus, fast and accurately obtain testing result, it is cheap, easy to operate at the same time, it is adapted to basic unit to use, can be as a kind of quick, accurate, simplicity detection instrument of the quick discriminating in 3 type laboratory of bovine parainfluenza virus and extensive epidemiology survey.
Description
Technical field
The present invention relates to animal virology and technical field of molecular biology, particularly relates to a kind of quick, easy, low
The RT-PCR amplimers of cost detection 3 type of bovine parainfluenza virus and its application.
Background technology
3 type of bovine parainfluenza virus（Bovine parainfluenza virus 3, BPIV-3）Ox can be caused anti-with other
One of main pathogen of hay animal acute respiratory disease.Infected animal clinical signs are loss of appetite, spirit is depressed, hair
Heat, expiratory dyspnea, stream nose liquid, cough etc..The secondary Mannheimia haemolytica, pasteurella multocida, hidden with the exacerbation of the state of an illness
Secret bacillus, Mycoplasma bovis, infectious bovine rhinotrachetis infection, so as to cause serious pneumonia, cause prdc,
The death rate of animal is considerably increased, carrys out huge economic loss to cultivation industrial zone.The virus is RNA virus and has capsule
Film, belongs to the member of paramyxovirus category.
Since finding 3 type of bovine parainfluenza virus from the U.S., there is France etc. is multinational to find the virus in succession.Diagnosis should in the world
The method of virus has cell culture, histogenic immunity fluoroscopic examination, neutralization test, ELISA, agglutination test etc., these experiments are all deposited
It is exactly that the reaction time is long, material is more, detection time has obvious hysteresis quality in shortcoming.Moreover, serological diagnostic method exists
Cross reaction, the nonspecific reaction of inter-species, the application of serological method is greatly hindered, influences detection result.
However, this advanced molecular Biological Detection means of RT-PCR, not only can fast and accurately detect cause of disease, and
And its detection method high specificity, sensitiveness are high.In addition, the tissue sample source of detection than wide, includes nose swab, breathing
Road secretion etc..
The content of the invention
The actual needs to develop in a healthy way for cattle-raising, is asked the purpose of the present invention is to solve existing in the prior art
Topic, there is provided a kind of low cost, RT-PCR amplimers and its application for quickly and accurately detecting 3 type of bovine parainfluenza virus.For reality
Now technical solution used in the object of the invention is：Its step includes sample collection, the extraction of pathogenic genes group DNA, specificity
The design and optimization of primer, RT-PCR amplifications, agarose gel electrophoresis detection RT-PCR amplified productions and result judgement.
A kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus, the RT-PCR amplimers be according to
It is designed according to the hemagglutinin-neuraminidase (hemagglutinin-neuraminidase, HN) of 3 type of bovine parainfluenza virus,
The purpose fragment size of amplification is 260 bp, and the sequence of primer is respectively：
Forward primer：5’- TCCCMAGAGTCACACATAC -3’ SEQ ID NO:1
Reverse primer：5’- GATTCCTGGTCCTACTGATGG -3’ SEQ ID NO:2
Primer concentration is diluted to 25 pmol using preceding.
Preferably, above-described RT-PCR amplimers are being prepared into answering for detection 3 type kit of bovine parainfluenza virus
With.
The present invention also provides a kind of RT-PCR amplification kits of quick detection 3 type of bovine parainfluenza virus, including with SEQ
ID NO:The sense primer of nucleotide sequence shown in 1 and there is SEQ ID NO:The anti-sense primer of nucleotide sequence shown in 2.
Preferably, RT-PCR amplification sides are established using the RT-PCR amplification kits of quick detection 3 type of bovine parainfluenza virus
Method, its reaction system are established in terms of 25 μ L,
10×RT-PCR Buffer 5 μL
dNTPs（10mM each ） 2 μL
ES-Taq archaeal dna polymerases（5U/μL） 1 μL
Forward primer（25 pmol/L） 1 μL
Reverse primer（25 pmol/L） 1 μL
3 μ L of cDNA templates
RNase-Free water supply 25 μ L.
Preferably, 10 × RT-PCR Buffer include KCL 20-30 mM, MgSO4 3-10 mM、10-20 mM
Tris-HCL。
Preferably, the cDNA templates of RT-PCR amplification kits are to use DNA/RNA extracts kits（CW0590S, Beijing
Health is century bio tech ltd）The pathogenic genes group DNA/RNA of cell culture or tissue sample is extracted, is reused anti-
Transcript reagent box HiFiScript cDNA Synthesis Kit（CW2569M, Beijing CoWin Bioscience Co., Ltd.）
It is cDNA by RNA reverse transcriptions, is carried out by kit specification.
Preferably, in the RT-PCR amplification kits, RT response procedures are 45 DEG C of 30 min, 85 DEG C of 5 min；
PCR response procedures are 95 DEG C of 5 min；Then carry out 30 95 DEG C of 35 s, 58 DEG C of 40 s, the circulation of 72 DEG C of 50 s；
10 min of last 72 DEG C of extensions.
A kind of RT-PCR amplification kits of above-described quick detection 3 type of bovine parainfluenza virus, the result are sentenced
Surely it is the method using agarose gel electrophoresis detection：RT-PCR amplified productions are carried out to electricity on 1.5% Ago-Gel
Swimming, sees whether purposeful band.Positive control and negative control are set up first, if having amplified 260 bp's from sample
Specific band, then illustrating the sample, there are 3 type of bovine parainfluenza virus；If sample does not amplify the specific bar of 260 bp
Band, then illustrate that the sample does not contain 3 type of bovine parainfluenza virus.
The present invention substantive distinguishing features and significant progress be：
1）High specificity
The RT-PCR detection method specific detection of 3 type of bovine parainfluenza virus of the present invention goes out 3 type of bovine parainfluenza virus, is detected
Negative control cause of disease such as Pyrogenes, klepsiella pneumoniae, Mycoplasma bovis, infectious bovine rhinotrachetis virus, haemolysis
Property Mannheimia and water compare no positive result.
2）High sensitivity
The RT-PCR detection method high sensitivity of 3 type of bovine parainfluenza virus of the present invention, minimum detection are limited to 2.04x10-4 ng/μ
L。
3）Take less, is of low cost
Compared with being detected by Antigen isolation and identification, the RT-PCR detection method of 3 type of bovine parainfluenza virus of the invention, when
Between cost, workload etc. there is obvious advantage, interpretation of result judgement is carried out from nucleic acid extraction to agarose gel electrophoresis,
Can the interior completion when 5 is small.
4）Accuracy is high, stability is good
With 2.04 × 101 ng/μL、2.04×100 ng/μL、2.04×10-1 ng/μL、2.04×10-2 ng/μL、2.04×
10-3、2.04×10-4 Ng/ μ L and 2.04 × 10-5 The recombinant plasmid standard sample of ng/ μ L is carried out at the same time RT-PCR, repeats respectively
3 detections.The result of 3 amplifications of the results show is consistent, shows that the reaction system of the RT-PCR detection method of foundation is reproducible.
Brief description of the drawings
Fig. 1 is annealing temperature screening test as a result, wherein M：DNA marker 100 bp ladder 、1：50℃、2：52
℃、
3：54℃、4：56℃、5：58℃、6：60℃、7：62℃、8：Water compares.
Fig. 2 specific detections are as a result, wherein M：DNA marker 100bp ladder、1：3 type of bovine parainfluenza virus, 2：
Pyrogenes, 3：Klepsiella pneumoniae, 4：Mycoplasma bovis, 5：Infectious bovine rhinotrachetis virus, 6：Hemolytic Mans bar
Bacterium, 7：Water compares.
Fig. 3 is sensitivity Detection as a result, wherein M：DNA marker 100bp ladder、1：2.04×101 ng/μL、
2：2.04×100 ng/μL、3：2.04×10-1 ng/μL、4：2.04×10-2 ng/μL、5：2.04×10-3 ng/μL、6：2.04
×10-4 ng/μL、7：2.04×10-5 ng/μL、8：Water compares.
Fig. 4 is that clinical sample detects electrophoretogram, wherein M：DNA marker 100bp ladder, swimming lane P：Positive control,
N：Negative control lanes；Swimming lane 2,3,5,8,10,13,15 is positive findings；Swimming lane 4,6,7,9,11,12,14,16,17,18,
19 be negative findings.
Embodiment
The present invention program is described in further detail with reference to embodiment, the description below is merely to explain this hair
It is bright, its content is not defined.Experimental method used in following embodiments is conventional side unless otherwise specified
Method, material, reagent used in following embodiments etc., is commercially available unless otherwise specified.
Embodiment 1 establishes the RT-PCR method of quick detection 3 type of bovine parainfluenza virus
1st, the preparation of material
3 type of bovine parainfluenza virus, Pyrogenes, klepsiella pneumoniae, Mycoplasma bovis, infectious bovine rhinotrachetis virus,
Mannheimia haemolytica preserves for the separation identification of Guangxi veterinary institute, and tissue sample comes from veterinary clinic.10×RT-PCR
Buffer, dNTPs, ES-Taq archaeal dna polymerase, virus genom DNA/RNA extracts kits, bacterial genomes DNA extraction examinations
Agent box, reverse transcription reagent box HiFiScript cDNA Synthesis Kit are century bio tech ltd purchased from health.
2nd, the design and synthesis of RT-PCR primer
3 type HN gene orders of bovine parainfluenza virus in GenBank carry out tetraploid rice analysis, select conserved sequence
Area goes out specificity amplification primer as amplification region using 7.0 primer-design softwares of Oligo and BLAST software program designs,
The sequence of wherein primer is respectively：
Forward primer：5’- TCCCMAGAGTCACACATAC -3’ SEQ ID NO:1
Reverse primer：5’- GATTCCTGGTCCTACTGATGG -3’ SEQ ID NO:2
The target gene fragment size of amplification is 260bp,
Upstream and downstream primer is using being preceding diluted to 25 pmol/L.
3rd, the extraction of template DNA
Sample treatment：
（1）Cell culture：Appropriate culture is taken as in sterile centrifugation tube；
（2）Tissue sample：It is ground first, multigelation, supernatant is taken after centrifugation.
Reuse virus genom DNA/RNA extracts kits or the extraction of bacterial genomes DNA extraction kit.
4th, RT-PCR reaction systems are established
The RT-PCR method of quick detection 3 type of bovine parainfluenza virus, its reaction system are established in terms of 25 μ L
10×RT-PCR Buffer 5 μL
dNTPs（10mM each ） 2 μL
ES-Taq archaeal dna polymerases（5U/μL） 1 μL
Forward primer（25 pmol/L） 1 μL
Reverse primer（25 pmol/L） 1 μL
3 μ L of cDNA templates
RNase-Free water supply 25 μ L.
5th, RT-PCR response procedures
The response procedures of the RT-PCR method of quick detection 3 type of bovine parainfluenza virus, first choice carry out optimum annealing temperature
Determine experiment, after determining annealing temperature, used RT response procedures are 45 DEG C of 30 min, 85 DEG C of 5 min；PCR reaction intervals
Sequence is 95 DEG C of 5 min；Then carry out 30 95 DEG C of 35 s, 58 DEG C of 40 s, the circulation of 72 DEG C of 50 s；Last 72 DEG C
Extend 10 min.
6th, result judgement
The result judgement is the method using agarose gel electrophoresis detection：By fine jade of the RT-PCR amplified productions 1.5%
Electrophoresis is carried out on sepharose, sees whether purposeful band.Positive control and negative control are set up first, if from sample
The specific band of 260 bp is amplified, then illustrating the sample, there are 3 type of bovine parainfluenza virus；If sample does not amplify
The specific band of 260 bp, then illustrate that the sample does not contain 3 type of bovine parainfluenza virus.
7th, specific detection
With genomic DNA/RNA of the experiment strain of extraction and control strain（It is cDNA that RNA virus, which first carries out reverse transcription,）Carry out RT-
PCR amplification, the specificity of checking R T-PCR methods.
8th, sensitivity Detection
The RT-PCR of 3 type of the bovine parainfluenza virus purpose fragments expanded are connected with PMD-18T carriers, convert Escherichia coli
DH5α, plasmid is extracted with small amount plasmid extraction agent box, is identified through PCR, recombinant plasmid serves Hai Ying fine horses Bioisystech Co., Ltd
Sequencing is carried out to determine.Positive recombinant plasmid is purified, it is dilute with the continuous 10 times of multiple proportions of RNA-Free Water after measuring initial concentration
Release, PCR amplification is carried out using the reaction condition of optimization, carries out sensitivity Detection.
9th, repeatability detection
With 2.04 × 101 ng/μL、2.04×100 ng/μL、2.04×10-1 ng/μL、2.04×10-2 ng/μL、2.04×
10-3、2.04×10-4 Ng/ μ L and 2.04 × 10-5 The recombinant plasmid standard sample of ng/ μ L is carried out at the same time PCR amplification, weighs respectively
Multiple 3 detections, examine the Stability and veracity of detection method.
10th, clinical sample detects
50 parts of tissue samples of clinical acquisitions are ground respectively, multigelation, extract genomic DNA/RNA using kit, make
Expanded with the RT-PCR method of foundation.
Embodiment 2 quickly detects the annealing temperature experiment of 3 type RT-PCR method of bovine parainfluenza virus
Respectively to 50 DEG C of annealing temperature, 52 DEG C, 54 DEG C, 56 DEG C, 58 DEG C, 60 DEG C, 62 DEG C of progress RT-PCR amplifications, really
Fixed optimal annealing temperature.The results show that the pardon of designed primer pair annealing temperature is big, annealing temperature be 50 DEG C,
52 DEG C, 54 DEG C, 56 DEG C, 58 DEG C, 60 DEG C, under 62 DEG C of response procedures, can amplify single purpose bar well
Band（Fig. 1）.For this reason, used RT response procedures are 45 DEG C of 30 min, 85 DEG C of 5 min；PCR response procedures are 95 DEG C 5
min；Then carry out 30 95 DEG C of 35 s, 58 DEG C of 40 s, the circulation of 72 DEG C of 50 s；10 min of last 72 DEG C of extensions.
Embodiment 3 detects the specific detection result of 3 type RT-PCR method of bovine parainfluenza virus
Extract 3 type of bovine parainfluenza virus, Pyrogenes, klepsiella pneumoniae, Mycoplasma bovis, infectious bovine rhinotrachetis disease
Poison, genomic DNA/RNA of Mannheimia haemolytica（It is cDNA that RNA virus, which first carries out reverse transcription,）, use the reaction optimized
System and response procedures carry out RT-PCR amplifications, the specificity of detection method are detected, the results show that only bovine parainfluenza
Viral 3 pattern product have amplified purpose fragment band, are positive findings, 5 plants of control strain reaction tubes and the water control equal nothing of reaction tube
Amplification situation occurs, and is negative findings（Fig. 2）, show that this method has specificity well.
Embodiment 4 detects the sensitivity Detection result of 3 type RT-PCR method of bovine parainfluenza virus
The RT-PCR of 3 type of the bovine parainfluenza virus purpose fragments expanded are connected with PMD-18T carriers, convert Escherichia coli
DH5α, plasmid is extracted with small amount plasmid extraction agent box, is identified through RT-PCR, it is limited that recombinant plasmid serves extra large English fine horse biotechnology
Company carries out sequencing and determines.Positive recombinant plasmid is purified, measure initial concentration is 2.04 × 101After ng/ μ L, RNA-Free is used
The continuous 10 times of doubling dilutions of Water, carry out RT-PCR amplifications using the reaction condition of optimization, carry out sensitivity Detection, as a result show
Show, the RT-PCR detection method lowest detection of foundation is limited to 2.04 × 10-4 ng/μL（Fig. 3）.
The Stability and veracity testing result of 5 bovine parainfluenza virus of embodiment, 3 type RT-PCR method
With 2.04 × 101 ng/μL、2.04×100 ng/μL、2.04×10-1 ng/μL、2.04×10-2 ng/μL、2.04×
10-3、2.04×10-4 Ng/ μ L and 2.04 × 10-5 The standard sample of ng/ μ L is carried out at the same time RT-PCR amplifications, is repeated 3 times respectively
Detection.The results show that reproducible results is good, show that the RT-PCR detection method of foundation is reproducible, stability is high.
The Preliminary Applications of 6 bovine parainfluenza virus of embodiment, 3 type RT-PCR method
50 parts of tissue samples of clinical acquisitions are ground respectively, multigelation, extract genomic DNA using kit, respectively RT-
PCR amplification.Fig. 4 shows the testing result of wherein 19 parts samples, the results showed that, there are 7 parts of sample detections to go out 3 type of bovine parainfluenza virus
Specific band, be positive findings.
The above description is merely a specific embodiment, but protection scope of the present invention is not limited thereto, any
The change or replacement expected without creative work, should be covered by the protection scope of the present invention.Therefore, it is of the invention
Protection domain should be determined by the scope of protection defined in the claims.
Sequence table
<110>Veterinary Institute of Guangxi Zhuang Autonomous Region
<120>A kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus and its application
<130> 2017
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence (Artificial sequence Latin)
<220>
<221> misc_feature
<223>Description to artificial sequence：Sense primer Forward primer
<400> 1
tcccmagagt cacacatac 19
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence (Artificial sequence Latin)
<220>
<221> misc_feature
<223>Description to artificial sequence：Anti-sense primer Reverse primer
<400> 2
gattcctggt cctactgatg g 21
Claims (9)
1. a kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus, it is characterised in that by with SEQ ID
NO:The sense primer of nucleotide sequence shown in 1 and there is SEQ ID NO:The anti-sense primer composition of nucleotide sequence shown in 2.
2. the RT-PCR amplimers of 3 type of bovine parainfluenza virus are quickly detected according to claim 1, it is characterised in that institute
The RT-PCR amplimers stated are that the hemagglutinin-neuramidinase gene of foundation 3 type of bovine parainfluenza virus is designed, amplification
Purpose fragment size is 260 bp.
3. the RT-PCR amplimers of 3 type of bovine parainfluenza virus are quickly detected according to claim 1, it is characterised in that institute
The RT-PCR amplimers stated detect the application of survey 3 type kit of bovine parainfluenza virus preparing.
4. a kind of RT-PCR amplification kits of quick detection 3 type of bovine parainfluenza virus, it is characterised in that including with SEQ ID
NO:The sense primer of nucleotide sequence shown in 1 and there is SEQ ID NO:The anti-sense primer of nucleotide sequence shown in 2.
5. the RT-PCR amplification kits of 3 type of bovine parainfluenza virus are quickly detected according to claim 4, it is characterised in that
It is characterized in that, further include 10 × RT-PCR Buffer, dNTPs, ES-Taq archaeal dna polymerase, cDNA templates and RNase-
Free water。
6. the RT-PCR amplification kits of 3 type of bovine parainfluenza virus are quickly detected according to claim 5, it is characterised in that
10 × RT-PCR Buffer include KCL 20-30 mM, MgSO4 3-10 mM、10-20 mM Tris-HCL。
7. the RT-PCR amplification kits of 3 type of bovine parainfluenza virus are quickly detected according to claim 5, it is characterised in that
It is characterized in that, the cDNA templates are using DNA/RNA extracts kits extraction tissue sample geneome RNA, reuse
RNA reverse transcriptions are cDNA templates by reverse transcription reagent box HiFiScript cDNA Synthesis Kit.
8. according to the RT-PCR amplification kits of quick detection 3 type of bovine parainfluenza virus of claim 4 or 5, its feature exists
In the SEQ ID NO of the RT-PCR amplification kits:1 primer and SEQ ID NO:2 primer concentrations are 25 pmol.
9. the RT-PCR amplification kits of 3 type of bovine parainfluenza virus are quickly detected according to claim 5, it is characterised in that
In the RT-PCR amplification kits, RT response procedures are 45 DEG C of 30 min, 85 DEG C of 5 min；PCR response procedures are 95
℃ 5 min；Then carry out 30 95 DEG C of 35 s, 58 DEG C of 40 s, the circulation of 72 DEG C of 50 s；Last 72 DEG C of extensions 10
min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711323273.XA CN107988431A (en) | 2017-12-13 | 2017-12-13 | A kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711323273.XA CN107988431A (en) | 2017-12-13 | 2017-12-13 | A kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107988431A true CN107988431A (en) | 2018-05-04 |
Family
ID=62037319
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711323273.XA Pending CN107988431A (en) | 2017-12-13 | 2017-12-13 | A kind of RT-PCR amplimers of quick detection 3 type of bovine parainfluenza virus and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988431A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004027037A2 (en) * | 2002-09-18 | 2004-04-01 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | RECOVERY OF RECOMBINANT HUMAN PARAINFLUENZA VIRUS TYPE 2 (HPIV2) FROM cDNA AND USE OF RECOMBINANT HPIV2 IN IMMUNOGENIC COMPOSITIONS AND AS VECTORS TO ELICIT IMMUNE RESPONSES AGAINST PIV AND OTHER HUMAN PATHOGENS |
| CN102212622A (en) * | 2011-05-12 | 2011-10-12 | 华中农业大学 | Reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for quickly diagnosing bovine parainfluenza virus 3 (BPIV-3) |
| CN106434630A (en) * | 2016-09-26 | 2017-02-22 | 北京农学院 | Nucleic acid aptamers of bovine parainfluenza 3 virus HN proteins and screening method thereof |
| WO2017040316A1 (en) * | 2015-08-28 | 2017-03-09 | The Broad Institute, Inc. | Sample analysis, presence determination of a target sequence |
| CN107058630A (en) * | 2017-05-06 | 2017-08-18 | 杨帆 | A kind of multiple RT PCR detection methods of 3 kinds of genotype of bovine parainfluenza type-3 virus |
-
2017
- 2017-12-13 CN CN201711323273.XA patent/CN107988431A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004027037A2 (en) * | 2002-09-18 | 2004-04-01 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | RECOVERY OF RECOMBINANT HUMAN PARAINFLUENZA VIRUS TYPE 2 (HPIV2) FROM cDNA AND USE OF RECOMBINANT HPIV2 IN IMMUNOGENIC COMPOSITIONS AND AS VECTORS TO ELICIT IMMUNE RESPONSES AGAINST PIV AND OTHER HUMAN PATHOGENS |
| CN102212622A (en) * | 2011-05-12 | 2011-10-12 | 华中农业大学 | Reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for quickly diagnosing bovine parainfluenza virus 3 (BPIV-3) |
| WO2017040316A1 (en) * | 2015-08-28 | 2017-03-09 | The Broad Institute, Inc. | Sample analysis, presence determination of a target sequence |
| CN106434630A (en) * | 2016-09-26 | 2017-02-22 | 北京农学院 | Nucleic acid aptamers of bovine parainfluenza 3 virus HN proteins and screening method thereof |
| CN107058630A (en) * | 2017-05-06 | 2017-08-18 | 杨帆 | A kind of multiple RT PCR detection methods of 3 kinds of genotype of bovine parainfluenza type-3 virus |
Non-Patent Citations (2)
| Title |
|---|
| 张忠玉: "一株牛副流感病毒3型的分离鉴定", 《中国畜禽种业》 * |
| 贾连群等: "《现代基础医学理论与技术进展》", 31 August 2015 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN108531629A (en) | A kind of PCR amplification primer of quick detection Friedlander's bacillus and its application | |
| CN107988340B (en) | PCR amplification primer for rapidly detecting mycoplasma ovipneumoniae and application thereof | |
| CN105018489A (en) | Kit for recognizing Brucella wild strain and vaccine strains A19 and S2 | |
| CN103060478B (en) | Dual RT-PCR (reverse transcription-polymerase chain reaction) method for quickly identifying duck hepatitis A virus serotype | |
| CN105420379A (en) | Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof | |
| CN103088165B (en) | Multi-RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method for rapidly identifying virus serotype of duck viral hepatitis | |
| CN103498009A (en) | Multiplex-PCR (polymerase chain reaction) detection kit for bovine respiratory disease complex and preparation method thereof | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN105018628A (en) | Kit for recognizing Brucella A19 vaccine strain and wild strain | |
| CN106834549A (en) | The cross primer amplification immune chromatography test paper of detection pseudorabies virus street strain is combined the primer and probe groups and kit of method | |
| CN107881259A (en) | A kind of pcr amplification primer thing of quick detection infectious bovine rhinotrachetis virus and its application | |
| CN108531659A (en) | A kind of RT-PCR primer and kit of quick detection bovine epizootic fever virus | |
| CN107142331A (en) | A kind of primer and probe for being used to detect mycoplasma ovine pneumoniae | |
| CN110643741A (en) | Palimam serogroup virus group specificity and serotype specificity RT-PCR detection primer and kit | |
| CN110878381A (en) | Primer composition, kit and method for detecting mycoplasma bovis and infectious bovine rhinotracheitis virus | |
| CN102399910A (en) | Primers and method for identifying swine fever virus vaccine strains and wild strains | |
| CN108048600A (en) | A kind of fluorescent quantitative PCR detection method of infectious bovine rhinotrachetis virus | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN106435032B (en) | Duplex RT-PCR primer, kit and method for simultaneously amplifying North American type and European type porcine reproductive and respiratory syndrome viruses | |
| Qian et al. | Clustered regularly interspaced short palindromic Repeat/Cas12a mediated multiplexable and portable detection platform for GII genotype Porcine Epidemic Diarrhoea Virus Rapid diagnosis | |
| CN101875974A (en) | Primer group for detecting Bordetella pertussis, detection test kit and detection method | |
| CN113046476A (en) | Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus | |
| CN107058630B (en) | Multiple RT-PCR detection method for 3 genotypes of bovine parainfluenza 3 virus | |
| CN116656845A (en) | Triple fluorescent quantitative PCR detection kit for diagnosing brucella vaccine immunity and natural infection and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180504 |
|
| RJ01 | Rejection of invention patent application after publication |