CN110618259A - Colloidal gold test strip for detecting grouper iridovirus and preparation and detection methods thereof - Google Patents
Colloidal gold test strip for detecting grouper iridovirus and preparation and detection methods thereof Download PDFInfo
- Publication number
- CN110618259A CN110618259A CN201910873701.9A CN201910873701A CN110618259A CN 110618259 A CN110618259 A CN 110618259A CN 201910873701 A CN201910873701 A CN 201910873701A CN 110618259 A CN110618259 A CN 110618259A
- Authority
- CN
- China
- Prior art keywords
- colloidal gold
- test strip
- aptamer
- iridovirus
- pad
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/52—Use of compounds or compositions for colorimetric, spectrophotometric or fluorometric investigation, e.g. use of reagent paper and including single- and multilayer analytical elements
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of virus detection, and discloses a colloidal gold test strip for detecting iridovirus of grouper and a preparation method thereof, wherein the colloidal gold test strip comprises a bottom plate, and a sample pad, a combination pad, a nitrocellulose membrane and an absorption pad which are sequentially lapped and fixed on the bottom plate, a gold-labeled probe is coated on the combination pad, a detection line and a quality control line are arranged on the nitrocellulose membrane, a capture probe is fixed on the detection line, and a quality control probe is fixed on the quality control line; the invention also discloses a method for detecting the grouper iridovirus by adopting the colloidal gold test strip. The colloidal gold test strip is prepared based on the principles of aptamer combination with a lateral flow biosensor and colloidal gold color development, has high specificity and sensitivity, is simple to assemble and carry, is simple and convenient to operate, and can be used for efficiently, accurately and quickly detecting the iridovirus of the grouper in real time on site.
Description
Technical Field
The invention relates to the technical field of virus detection, in particular to a colloidal gold test strip for detecting grouper iridovirus as well as a preparation method and a detection method thereof.
Background
In recent years, iridovirus outbreaks and epidemics in mariculture animals such as grouper have seriously threatened the development of aquaculture. Iridovirus has been discovered and identified over 60 worldwide, and is divided into five genera, iridovirus, frog iridovirus, chloroiridovirus, megavirus, and lymphocystis virus, based on the host range and whole genome sequencing information of iridovirus.
In 2003, scientific researchers and the like isolated an iridovirus from cultured groupers with high pathogenicity and over 90% lethality to the groupers, and the structure of the virus particle is found to be a regular icosahedron under a microscope, and most of the virus particle is gathered in host cytoplasm. The particle center is a core body, the periphery of the core body is coated with a shell, and the shell is further coated with an envelope, and the size of the core body is about 200 nm. After the iridovirus is analyzed, the iridovirus is found to have a close relationship with a member of the frog iridovirus genus, is identified as a new species of the frog iridovirus genus and named as Singapore Grouper Iridovirus (SGIV). Frequent explosion of SGIV brings huge economic loss to the aquaculture industry, but at present, no effective method is available for treating SGIV infection, so that the establishment of an effective diagnosis method for early detection and prevention of the viral disease is very necessary, but the traditional SGIV detection method such as a polymerase chain reaction method or an electron microscope observation method is time-consuming and needs professional instruments and equipment, so that the requirement of real-time detection is difficult to meet.
In summary, it is necessary to develop a colloidal gold test strip for detecting grouper iridovirus and a preparation and detection method thereof.
Disclosure of Invention
The colloidal gold test strip for detecting the garrupa iridovirus and the preparation and detection methods thereof solve the problems that the existing garrupa iridovirus detection method is time-consuming and labor-consuming, high in detection condition requirement, complex in detection procedure and incapable of being detected in real time on site. The colloidal gold test strip and the detection method are based on the principle that the aptamer is combined with a lateral flow biosensor and the colloidal gold develops color, have high sensitivity and specificity, are simple to prepare and assemble and carry, have simple detection method and convenient operation, and can be used for efficiently, accurately and quickly detecting the iridovirus of the grouper.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
the colloidal gold test strip for detecting the iridovirus of groupers comprises a bottom plate, and a sample pad, a combination pad, a nitrocellulose membrane and an absorption pad which are sequentially fixed on the bottom plate in an overlapping manner, wherein the combination pad is coated with a gold-labeled probe which is a nucleic acid aptamer modified by 5' end sulfhydryl, and the nucleotide sequence of the nucleic acid aptamer is as follows: 5' -SH-TATGTCCATGGC CGCATATT (SEQ ID NO: 1);
the nitrocellulose membrane is provided with a detection line and a quality control line, the detection line is fixed with a capture probe, and the quality control line is fixed with a quality control probe:
the nucleotide sequence of the capture probe is as follows: TTTGGACTATGTGGAAGTT (SEQ ID NO: 2);
the nucleotide sequence of the quality control probe is as follows: AATATGCGGCCATGGACATA (SEQ ID NO: 3).
The invention also discloses a preparation method of the colloidal gold test strip for detecting the grouper iridovirus, which comprises the following steps:
s1, preparing a sample pad;
s2, preparing a bonding pad, and coating a gold-labeled probe on the bonding pad;
s3, processing of the nitrocellulose membrane: scribing a capture probe and a quality control probe on a nitrocellulose membrane by adopting a three-dimensional scribing and gold spraying instrument according to a sample spraying amount of 0.5-0.8 mu L/cm to obtain a detection line and a quality control line, wherein the distance between the detection line and the quality control line is 5-6 mm;
s4, assembling the colloidal gold test strip: and fixing the sample pad, the combination pad, the cellulose nitrate membrane and the absorption pad on the bottom plate in sequence, overlapping each adjacent part for 2-3 mm, cutting the whole body into 4mm wide, and storing for later use in a light-proof closed environment.
Further, the step S1 is specifically: the glass fiber was immersed in a solution containing 0.5% of polyethylene glycol octylphenyl ether (Triton X-100), 2% of sucrose, 1% of BSA, and 50mM of boric acid at pH 8.0, and then dried at room temperature for 12 hours.
Further, the step S2 specifically includes the following steps:
a. synthesis of colloidal gold (AuNP): placing 200ml HAuCl4 solution with concentration of 0.01% into 500ml round bottom flask, stirring gently and heating to boil, rapidly adding 8ml trisodium citrate with concentration of 1%, wherein the solution color is changed into dark blue, then into wine red, boiling for 5min, and stirring gently; stopping heating, moving to a magnetic stirrer after 15min, stirring and cooling to room temperature to obtain an AuNP solution;
b. preparation of colloidal gold-aptamer (AuNP-DNA) complexes: concentrating the AuNP solution obtained in the step one by 10 times, adding a gold-labeled probe into 400 mul of concentrated solution, slightly shaking for 12 hours at 4 ℃, then adding Bovine Serum Albumin (BSA) with the concentration of 10%, and reacting for 4 hours to obtain a colloidal gold-aptamer (AuNP-DNA) compound; adding 1% sodium dodecyl sulfate into the compound until the final concentration of the sodium dodecyl sulfate in the system is 0.01%, adding 1.5mol/L NaCl solution to enable the final concentration of salt ions in the system to be 150mM, and placing the obtained compound solution at 4 ℃ for reaction for 12 hours;
c. centrifuging the composite solution obtained in the step b at the rotating speed of 12000rpm for 10-20 min, washing the composite solution with a buffer solution for three times, removing redundant unbound DNA, discarding the supernatant, resuspending the obtained red particles in 150 mu l of the buffer solution to obtain a colloidal gold-aptamer (AuNP-DNA) binding solution, and storing the colloidal gold-aptamer (AuNP-DNA) binding solution at 4 ℃;
d. and d, dropwise adding the colloidal gold-aptamer binding solution obtained in the step c on the binding pad in an amount of 2-3 mu l per strip, and air-drying at room temperature for 5min to obtain the binding pad coated with the gold-labeled probe.
Further, the buffer solution in step c contains 20mM Na3PO45% BSA, 0.25% Tween and 10% sucrose.
The invention also discloses a detection method for detecting the grouper iridovirus by adopting the colloidal gold test strip, which comprises the following steps:
virus incubation: adding a capture Aptamer (Aptamer1) and an amplification Aptamer (Aptamer2) into 100 mu l of Phosphate Buffer Solution (PBS) to enable the concentrations of the capture Aptamer (Aptamer1) and the amplification Aptamer (Aptamer2) to reach 200nM respectively, and adding cells infected by grouper iridovirus (SGIV) to incubate for 10-15 min to obtain a mixture containing the grouper iridovirus (SGIV);
② strand displacement reaction: adding 2 mu l of magnetic beads modified by Streptavidin (SA) into the mixture, oscillating for 10-15 min to obtain an Aptamer1-SGIV-Aptamer 2-magnetic bead compound, collecting the Aptamer1-SGIV-Aptamer 2-magnetic bead compound by using a magnetic separator separation frame, washing the compound three times by using a Phosphate Buffer Solution (PBST) containing Tween-20, transferring the compound into a centrifuge tube to perform chain displacement reaction (SDA) at the reaction temperature of 37 ℃ for 30min to obtain an SDA reaction product;
sampling and detecting: dripping 3-4 SDA reaction products obtained in the second step onto a sample pad of the colloidal gold test strip, reacting for 5min, and observing a color development result of the colloidal gold test strip;
fourthly, interpretation of results:
positive reaction: the detection line and the quality control line of the colloidal gold test strip are colored;
negative reaction: the detection line of the colloidal gold test strip is not colored, and the quality control line is colored.
Further, the strand displacement reaction (SDA) reaction system in the second step includes, by volume: SDA primer 2. mu.l, deoxynucleoside triphosphate (dNTPs) 2. mu.l, polymerase (Klenow fragment exo) 0.6. mu.l, nicking endonuclease (Nt. BbvCI) 0.4. mu.l, SDA-buffer-22. mu.l, 10% BSA 1. mu.l, and ultrapure water 12. mu.l.
Further, the nucleotide sequence of the SDA primer is as follows: GAGACTTCATCTG CGTCCTTCG (SEQ ID NO: 7).
Further, the capture Aptamer (Aptamer1) and the amplification Aptamer (Aptamer2) are prepared by:
screening for viral aptamers: screening by adopting a magnetic bead method SELEX technology to obtain a nucleic acid aptamer of the grouper iridovirus (SGIV for short), wherein the nucleotide sequence of the nucleic acid aptamer is as follows: TATGTCCATGGCCGCATATTGGGAAGGTTGGTTTGG ACTATGTGGAAGTT (SEQ ID NO: 4);
nucleic acid aptamer modification: carrying out 3' end biotin modification on the Aptamer in the step I to obtain a capture Aptamer (Aptamer1), wherein the sequence of the capture Aptamer is as follows: TATGTCCATGGCCG CATATTGGGAAGGTTGGTTTGGACTATGTGGAAGTT-Bio (SEQ ID NO: 5);
modifying the recognition site of a nicking endonuclease (Nt.BbvCI) and the primer binding site of the Aptamer of the step I to obtain an amplified Aptamer (Aptamer2), wherein the sequence of the amplified Aptamer is as follows: TATGTCCATGGCCGCATATTGGGAAGGTTGGTTTGGACTATGTG GAAGTTGCTGAGGCGAAGGACGCAGATGAAGTCTC (SEQ ID NO: 6);
in the amplification Aptamer (Aptamer2) sequence, "GCTGAGG" is the recognition site for nicking endonuclease (nt.bbvci) and "CGAAGGACGCAGATGAAGTCTC" is the primer binding sequence.
The optimized screening and detection principle of the colloidal gold test strip and the detection method thereof is as follows:
culturing infected spleen cells of grouper in culture medium, preparing and purifying grouper iridovirus (SGIV for short), then through a magnetic bead method SELEX technology, SGIV is optimally screened, a single-stranded oligonucleotide library containing different sequences is constructed through chemical synthesis, magnetic beads with SGIV fixed on the surface are incubated with the library so as to facilitate the full combination of a target and corresponding single-stranded nucleic acid, then obtaining nucleic acid single strands specifically combined with the magnetic bead surface targets through a magnetic separation procedure, eluting the combined nucleic acids by an elution procedure, finally amplifying the eluted nucleic acids serving as templates and using the amplified nucleic acids for the next round of screening, through the repeated operation steps of combining, separating, eluting and amplifying, nucleic acid which is not combined with a target and has small affinity is eliminated, while aptamers with high affinity are gradually enriched, and aptamers with specific binding force with SGIV are finally screened out.
Performing biotin modification on the screened SGIV Aptamer to obtain a capture Aptamer (Aptamer1), wherein the capture Aptamer (Aptamer1) has biotin modification and can be captured by Streptavidin (SA) modified magnetic beads so as to be used for enrichment; the amplified Aptamer (Aptamer2) can be obtained by modifying the nucleic acid Aptamer of SGIV with an nt. bbvcci enzyme recognition site and a primer binding site, and the amplified Aptamer (Aptamer2) is used for amplification and can be used as a template for strand displacement reaction (SDA).
Aptamer1 and Aptamer2 are incubated with SGIV in Phosphate Buffered Saline (PBS), SA modified magnetic beads are added into the obtained mixture, then Aptamer1-SGIV-Aptamer 2-magnetic bead complexes are collected by a magnetic separator stand and washed by Phosphate Buffered Saline (PBST) containing Tween-20, and then Aptamer1-SGIV-Aptamer 2-magnetic bead complexes are transferred to a centrifuge tube by ultrapure water for SDA reaction.
In the SDA reaction process, the Aptamer2 is combined with the SDA primer, the formed complementary strand is cut and separated at the recognition site of the Nt.BbvCI enzyme, the amplification reaction is continuously carried out from the cutting site under the action of polymerase, the amplification reaction is continuously cut and separated, the cycle is repeated, after the SDA reaction, a large number of amplification products are generated, then the amplification products are dripped on a sample pad of a colloidal gold test strip, and the amplification products flow through a detection line and a quality control line through the chromatography action and carry out the complementary reaction with the capture probe and the quality control probe.
In summary, in the presence of SGIV, the Aptamer1-SGIV-Aptamer 2-magnetic bead complex first undergoes SDA reaction to obtain ssDNA, and the gold-labeled probe in the AuNP-DNA complex and the SDA product (ssDNA) undergo complementary reaction on the binding pad of the colloidal gold test strip, so that the AuNP-DNA complex captures ssDNA to form ssDNA-AuNP-DNA complex.
Because the ssDNA is also complementary to the capture probe on the detection line, the formed ssDNA-AuNP-DNA complex can be gathered on the detection line to form a visible red band; the excessive AuNP-DNA compound continues to migrate on the nitrocellulose membrane, and because the gold-labeled probe in the AuNP-DNA compound and the quality control probe on the quality control line can carry out complementary reaction, another red band can be formed on the quality control line.
Compared with the prior art, the technical scheme of the invention has the beneficial effects that:
the colloidal gold test strip is manufactured based on the nucleic acid aptamer combined with a lateral flow biosensor and the principle of colloidal gold color development, because the nucleic acid aptamer can be folded into a three-dimensional structure and then is combined with a target substance through space configuration complementation or intermolecular force, various target spots can be combined, including organic molecules, proteins, cells and metal ions, and the colloidal gold test strip has high specificity and the same characteristics as an antibody, the recognition mode of the nucleic acid aptamer and the target substance is similar to that of the antibody, but compared with the traditional protein antibody, the nucleic acid aptamer is essentially oligonucleotide chains and is far smaller than the antibody, so that the colloidal gold test strip can recognize and distinguish slight differences on the structure of the target molecule, is more stable and cheaper, and is easy to synthesize through modification. Therefore, the colloidal gold test paper strip has the advantages of high sensitivity and specificity, stable performance, easy storage and standby, simple preparation and assembly, low cost, convenient carrying, field real-time detection and convenient use.
The method for detecting grouper iridovirus (SGIV) by using the colloidal gold test strip provided by the invention has the advantages of simple steps, convenience in operation and short detection time, is suitable for field real-time detection, and can be used for efficiently, accurately and quickly detecting the grouper iridovirus, so that the early morbidity condition can be known in time, destructive damage can be prevented, and the grouper breeding risk can be reduced, thereby having good application prospect.
Drawings
FIG. 1 is a schematic structural diagram of a colloidal gold test strip of the present invention;
FIG. 2 is a diagram showing the test result of the colloidal gold test strip of the present invention;
FIG. 3 is a graph showing the results of a comparative experiment of the colloidal gold test strip of comparative example 1 according to the present invention;
FIG. 4 is a graph showing the results of a comparative experiment of the colloidal gold test strip of comparative example 2 of the present invention.
In the figure: 1-bottom plate, 2-sample pad, 3-combination pad, 4-nitrocellulose membrane, 41-detection line, 42-quality control line, and 5-absorption pad.
Detailed Description
The present invention is further illustrated by the following specific embodiments, which are presently preferred embodiments of the invention, but the invention is not limited thereto and, therefore, the scope of the invention as claimed is not limited thereto.
Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the materials, reagents and the like used are commercially available. The nucleotide sequence of the invention is obtained by screening and optimizing a large number of experiments by the inventor and then synthesized by Invitrogen Biotechnology Co.Ltd (Shanghai, China).
1. Main reagents and materials:
HPLC purified oligonucleotides were synthesized by Invitrogen Biotechnology co.ltd (shanghai, china);
HAuCl4purchased from sigmaldrich (germany);
bovine Serum Album (BSA) was purchased from SigmaAldrich (Germany);
polymerase (Klenow-exo) was purchased from new england biological laboratory (usa);
nicking endonuclease (nt. bbvci) was purchased from new england biological laboratory (usa);
SDA-buffer-2 was purchased from New England Biolabs (USA);
deoxynucleoside triphosphates (dNTPs) were purchased from Takara (beijing, china);
streptavidin (SA) -modified magnetic beads (DynaBeads)TMMyoneTMStreptavidin C1) was purchased from Invitrogen (usa);
nitrocellulose membranes were purchased from Millipore, usa;
glass fibers, PVC sole plates and absorbent pads were purchased from oswegian biotechnology limited, guangzhou.
2. Example 1:
as shown in fig. 1, a colloidal gold test strip for detecting grouper iridovirus, which comprises a bottom plate 1, and a sample pad 2, a binding pad 3, a nitrocellulose membrane 4 and an absorption pad 5, which are sequentially fixed on the bottom plate 1 in an overlapping manner, wherein a gold-labeled probe is coated on the binding pad 3, the gold-labeled probe is a nucleic acid aptamer modified by a 5' end thiol group, and the nucleic acid aptamer has a nucleotide sequence: 5' -SH-TATGTCCATGGCCGCATATT (SEQ ID NO: 1);
the nitrocellulose membrane 4 is provided with a detection line 41 and a quality control line 42, the detection line 41 is fixed with a capture probe, and the quality control line 42 is fixed with a quality control probe:
the nucleotide sequence of the capture probe is as follows: TTTGGACTATGTGGAAGTT (SEQ ID NO: 2);
the nucleotide sequence of the quality control probe is as follows: AATATGCGGCCATGGACATA (SEQ ID NO: 3).
The preparation method of the colloidal gold test strip for detecting the grouper iridovirus comprises the following steps:
s1, preparing a sample pad 2: soaking glass fiber in solution containing 0.5% of polyethylene glycol octyl phenyl ether (TritonX-100), 2% of sucrose, 1% of BSA, 50mM of boric acid and pH of 8.0, and drying at room temperature for 12h to obtain the glass fiber;
s2, preparing a bonding pad 3, and coating a gold-labeled probe on the bonding pad;
s3, treating the nitrocellulose membrane 4: scribing a capture probe and a quality control probe on the nitrocellulose membrane 4 by adopting a three-dimensional scribing and gold spraying instrument according to the spraying amount of 0.6 mu L/cm to obtain a detection line 41 and a quality control line 42, wherein the distance between the detection line 41 and the quality control line 42 is 6 mm;
s4, assembling the colloidal gold test strip: the sample pad 2, the bonding pad 3, the nitrocellulose membrane 4 and the absorbent pad 5 are sequentially assembled on the base plate 1, adjacent components are overlapped by 2mm, and then the whole is cut into 4mm wide by a paper cutter and stored for standby in a dark closed environment.
Wherein, the step S2 specifically includes the following steps:
a. synthesis of colloidal gold (AuNP): placing 200ml HAuCl4 solution with concentration of 0.01% into 500ml round bottom flask, stirring gently and heating to boil, rapidly adding 8ml trisodium citrate with concentration of 1%, wherein the solution color is changed into dark blue, then into wine red, boiling for 5min, and stirring gently; stopping heating, moving to a magnetic stirrer after 15min, stirring and cooling to room temperature to obtain an AuNP solution;
b. preparation of colloidal gold-aptamer (AuNP-DNA) complexes: concentrating the AuNP solution obtained in the step one by 10 times, adding a gold-labeled probe into 400 mul of concentrated solution, slightly shaking for 12 hours at 4 ℃, then adding Bovine Serum Albumin (BSA) with the concentration of 10%, and reacting for 4 hours to obtain a colloidal gold-aptamer (AuNP-DNA) compound; adding 1% sodium dodecyl sulfate into the compound until the final concentration of the sodium dodecyl sulfate in the system is 0.01%, adding 1.5mol/L NaCl solution to enable the final concentration of salt ions in the system to be 150mM, and placing the obtained compound solution at 4 ℃ for reaction for 12 hours;
c. centrifuging the composite solution obtained in the step b at the rotating speed of 12000rpm for 20min, washing the composite solution with a buffer solution for three times, removing redundant unbound DNA, discarding the supernatant, and resuspending the obtained red particles in 150 mu l of the buffer solution to obtain a colloidal gold-aptamer (AuNP-DNA) binding solution, and storing the colloidal gold-aptamer (AuNP-DNA) binding solution at 4 ℃; the buffer solution contains 20mM Na3PO4A solution of 5% BSA, 0.25% tween and 10% sucrose;
d. and d, dropwise adding the colloidal gold-aptamer binding solution obtained in the step c on the binding pad in an amount of 2.5 mu l per strip, and air-drying at room temperature for 5min to obtain the binding pad coated with the gold-labeled probe.
As shown in fig. 3-4, for convenience of carrying and use, a specially-made packing box can be designed for the colloidal gold test strip, the colloidal gold test strip is embedded in the packing box, a sample adding hole is arranged on the lower section of the packing box, the sample adding hole is opposite to the sample pad, a transparent window is arranged on the upper end of the packing box, the detection line and the quality control line of the colloidal gold test strip can be seen, and the color development result can be observed conveniently.
3. Example 2:
the method for detecting the grouper iridovirus by adopting the colloidal gold test strip comprises the following steps:
virus incubation: adding a capture Aptamer (Aptamer1) and an amplification Aptamer (Aptamer2) into 100 mu l of Phosphate Buffer Solution (PBS) to make the concentrations of the capture Aptamer (Aptamer1) and the amplification Aptamer (Aptamer2) 200nM respectively, and adding spleen cells infected by grouper iridovirus (SGIV) and incubating for 15min to obtain a mixture containing the grouper iridovirus (SGIV);
② strand displacement reaction: adding 2 mu l of magnetic beads modified by Streptavidin (SA) into the mixture, oscillating for 15min to obtain an Aptamer1-SGIV-Aptamer 2-magnetic bead composite, collecting the Aptamer1-SGIV-Aptamer 2-magnetic bead composite by using a magnetic separator stand, washing the composite three times by using a Phosphate Buffer Solution (PBST) containing Tween-20, transferring the composite into a centrifuge tube (EP tube) to perform a chain displacement reaction (SDA), wherein the reaction temperature is 37 ℃, and the reaction time is 30min to obtain a chain displacement reaction (SDA) product;
sampling and detecting: dripping 3-4 of the reaction product obtained in the second step onto a sample pad of the colloidal gold test strip, reacting for 5min, and observing a color development result of the colloidal gold test strip;
fourthly, interpretation of results:
as shown in fig. 2, positive reaction: the detection line and the quality control line of the colloidal gold test strip are colored; negative reaction: the detection line of the colloidal gold test strip is not colored, and the quality control line is colored.
The strand displacement reaction (SDA) reaction system in the step II comprises the following components in volume: SDA primer 2. mu.l, deoxynucleoside triphosphate (dNTPs) 2. mu.l, nicking endonuclease (Nt. BbvCI) 0.4. mu.l, polymerase (Klenow fragmentexo) 0.6. mu.l, SDA-buffer-22. mu.l, 10% BSA 1. mu.l, and ultrapure water 12. mu.l.
Wherein the nucleotide sequence of the SDA primer is as follows: GAGACTTCATCTGCGT CCTTCG (SEQ ID NO: 7).
The capture Aptamer (Aptamer1) and the amplification Aptamer (Aptamer2) are prepared by the following steps:
screening for aptamers: screening by adopting a magnetic bead method SELEX technology to obtain a nucleic acid aptamer of the grouper iridovirus (SGIV for short), wherein the nucleotide sequence of the nucleic acid aptamer is as follows: TATGTCCATGGCCGCATATTGGGAAGGTTGGTTTGGACTAT GTGGAAGTT (SEQ ID NO: 4);
nucleic acid aptamer modification: carrying out 3' end biotin modification on the Aptamer in the step I to obtain a capture Aptamer (Aptamer1), wherein the sequence of the capture Aptamer is as follows: TATGTCCATGG CCGCATATTGGGAAGGTTGGTTTGGACTATGTGGAAGTT-Bio (SEQ ID NO: 5);
modifying the Aptamer of the step I by using an Nt.BbvCI enzyme recognition site and a primer binding site to obtain an amplified Aptamer (Aptamer2), wherein the sequence of the amplified Aptamer is as follows: TATGTCCAT GGCCGCATATTGGGAAGGTTGGTTTGGACTATGTGGAAGTTGCT GAGGCGAAGGACGCAGATGAAGTCTC (SEQ ID NO: 6);
in the amplified Aptamer (Aptamer2) sequence, the "GCTGAGG" fragment is the recognition site for the nt. bbvcci enzyme, and the "CGAAGGACGCAGATGAAGTCTC" fragment is the primer binding sequence.
4. Comparative example 1
In order to analyze the specificity of the colloidal gold test strip and the detection method thereof, a comparison experiment 1 is specially set, an experiment group and comparison groups 1-3 are specially set in the comparison experiment 1, and the specific conditions of each group are as follows:
experimental groups: SGIV infected cell fluid was incubated simultaneously with Aptamer1 and Aptamer 2;
control group 1: RGNNV-infected cell sap is incubated with Aptamer1 and Aptamer2, wherein RGNNV refers to Epinephelus necrotizing virus;
control group 2: incubating LMBV infected cell sap with Aptamer1 and Aptamer2, wherein LMBV refers to largemouth black bass virus;
control group 3 (negative control group): phosphate Buffered Saline (PBS) was incubated with Aptamer1 and Aptamer 2;
after the incubation, the strand displacement reaction (SDA) is performed on each group, the conditions of the incubation method and the strand displacement reaction (SDA) are the same as those in example 2, and then the reaction products of each group are dripped on a colloidal gold test strip for detection.
As shown in fig. 3, the test lines (T-line) and the quality control line (C-line) of the colloidal gold test strips of the experimental group both showed color bands, and the test lines (T-line) of the colloidal gold test strips of the control groups 1 to 3 did not develop color.
Therefore, only in the presence of SGIV, the Aptamer1-SGIV-Aptamer 2-magnetic bead complex first undergoes SDA reaction to obtain ssDNA as a reaction product, and then the gold-labeled probe in the AuNP-DNA complex undergoes complementary reaction with the SDA product (ssDNA) on the binding pad of the colloidal gold test strip, so that the AuNP-DNA complex captures ssDNA to form an ssDNA-AuNP-DNA complex.
Because the ssDNA is also complementary to the capture probe on the detection line, the formed ssDNA-AuNP-DNA complex can be gathered on the detection line to form a visible red band; the excessive AuNP-DNA compound continues to migrate on the nitrocellulose membrane, and because the gold-labeled probe in the AuNP-DNA compound and the quality control probe on the quality control line can carry out complementary reaction, another red band can be formed on the quality control line.
In the absence of SGIV or other viruses, the detection line did not develop color because neither Aptamer1 was enriched with magnetic beads or the Aptamer2 amplified to yield SDA product.
Therefore, only in the presence of both Aptamer1 and Aptamer2 and SGIV, the color development of the detection line (T line) of the colloidal gold test strip was observed. Experiments show that the colloidal gold test strip and the detection method can effectively detect the grouper iridovirus (SGIV) and have good specificity for detecting the grouper iridovirus (SGIV).
6. Comparative example 2
In order to analyze the sensitivity of the colloidal gold test strip and the detection method, a comparative experiment 2 is specially set, wherein the comparative experiment 2 is to respectively dissolve SGIV infected cells with different numbers in PBS to obtain PBS solution groups with different virus infected cell contents, and for example, the numbers of the SGIV infected cells in each PBS solution group are respectively as follows: 1051, 1041, 1031, 102And 0 (i.e., no SGIV infected cells in PBS).
After the incubation, the strand displacement reaction (SDA) is performed on each group, the conditions of the incubation method and the strand displacement reaction (SDA) are the same as those of the example 2, and then the reaction products of each group are dripped on a colloidal gold test strip for detection.
As shown in FIG. 4, each of the colloidal gold test strips showed a color development result for detecting SGIV-infected cells of different numbers, the colloidal gold test strip detection line (T line) corresponding to the group having the number of SGIV-infected cells of 0 did not develop color, and the number of SGIV-infected cells was 102The colloidal gold test strip detection line (T line) corresponding to each experimental group shows a shallow color band, which indicates that the minimum quantity of grouper iridovirus (SGIV) observed by the detection line (T line) is 102The colloidal gold test strip and the detection method have high detection sensitivity.
The above-mentioned embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. It will be apparent to those skilled in the art that other variations and modifications may be made in the invention without departing from the spirit or scope of the invention as defined in the appended claims. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Claims (10)
1. A colloidal gold test strip for detecting grouper iridovirus, which comprises a bottom plate, a sample pad, a combination pad, a nitrocellulose membrane and an absorption pad, wherein the sample pad, the combination pad, the nitrocellulose membrane and the absorption pad are sequentially lapped and fixed on the bottom plate,
the combination pad is coated with a gold-labeled probe, the gold-labeled probe is a nucleic acid aptamer modified by 5' end sulfydryl, and the nucleotide sequence of the gold-labeled probe is as follows: 5' -SH-TATGTCCATGGCCGCATATT;
the nitrocellulose membrane is provided with a detection line and a quality control line, the detection line is fixed with a capture probe, and the quality control line is fixed with a quality control probe:
the nucleotide sequence of the capture probe is as follows: TTTGGACTATGTGGAAGTT, respectively;
the nucleotide sequence of the quality control probe is as follows: AATATGCGGCCATGGACATA are provided.
2. The method for preparing the colloidal gold test strip for detecting the iridovirus of grouper according to claim 1, which is characterized by comprising the following steps:
s1, preparing a sample pad;
s2, preparing a bonding pad, and coating a gold-labeled probe on the bonding pad;
s3, processing of the nitrocellulose membrane: marking the capture probe and the quality control probe on the nitrocellulose membrane by a gold spraying instrument according to the sample spraying amount of 0.5-0.8 mu L/cm to obtain a detection line and a quality control line, wherein the distance between the detection line and the quality control line is 5-6 mm;
s4, assembling the colloidal gold test strip: and fixing the sample pad, the combination pad, the nitrocellulose membrane and the absorption pad on the bottom plate in sequence, overlapping each adjacent part for 2-3 mm, cutting the whole body into 4mm wide, and storing in a dark place.
3. The method for preparing the colloidal gold test strip for detecting the iridovirus of grouper according to claim 2, wherein the S1 specifically comprises: soaking glass fiber in solution containing 0.5% Triton X-100, 2% sucrose, 1% Bovine Serum Albumin (BSA), 50mM boric acid, pH 8.0, and drying at room temperature for 12 hr.
4. The method for preparing the colloidal gold test strip for detecting the iridovirus of grouper according to claim 2, wherein the S2 specifically comprises the following steps:
a. synthesis of colloidal gold: 200ml of 0.01% HAuCl were taken4Stirring and heating the solution to boiling, adding 8ml of 1% trisodium citrate, continuing to boil for 5min when the solution turns red, stopping heating, stirring and cooling to room temperature to obtain colloidal gold solution;
b. preparation of colloidal gold-aptamer complex: concentrating the colloidal gold solution obtained in the step I by 10 times, adding 400 mu l of concentrated solution into a gold-labeled probe, and shaking at 4 ℃ for 12 hours; then adding BSA with the concentration of 10% to react for 4 hours to obtain a colloidal gold-aptamer compound;
adding 1% of sodium dodecyl sulfate into the compound until the final concentration is 0.01%, then adding 1.5mol/L of NaCl solution to enable the final concentration of salt ions to be 150mM, and placing the obtained compound solution at 4 ℃ for reaction for 12 hours;
c. centrifuging the composite solution obtained in the step b at the rotating speed of 12000rpm for 10-20 min, washing the composite solution with a buffer solution for three times, discarding the supernatant, suspending the obtained particles in 150 mu l of the buffer solution to obtain a colloidal gold-aptamer binding solution, and storing the colloidal gold-aptamer binding solution at 4 ℃;
d. and d, dropwise adding 2-3 mu l of the colloidal gold-aptamer combined solution obtained in the step c on the combined pad, and air-drying at room temperature for 5min to obtain the combined pad coated with the gold-labeled probe.
5. The colloidal gold test strip for detecting iridovirus of grouper as claimed in claim 4, wherein the buffer solution in step c is 20mM Na3PO45% BSA, 0.25% Tween and 10% sucrose.
6. The method for detecting the colloidal gold test strip for detecting the iridovirus of grouper as claimed in any one of claims 1 to 5, wherein the method comprises the following steps:
virus incubation: adding a capture Aptamer (Aptamer1) and an amplification Aptamer (Aptamer2) into 100 mu l of phosphate buffer solution to make the concentrations of the capture Aptamer and the amplification Aptamer 200nM respectively, and adding cells infected by grouper iridovirus (SGIV) to incubate for 10-15 min to obtain a mixture containing the SGIV;
② strand displacement reaction: adding 2 mu l of magnetic beads modified by streptavidin into the mixture, oscillating for 10-15 min to obtain an Aptamer1-SGIV-Aptamer 2-magnetic bead compound, collecting the compound by using a magnetic separator separation frame, washing the compound three times by using PBST, transferring the compound into a centrifuge tube to perform a strand displacement reaction to obtain a strand displacement reaction product;
sampling and detecting: dropwise adding the chain displacement reaction product obtained in the step two on a sample pad of the colloidal gold test strip, reacting for 5min, and observing the color development result of the colloidal gold test strip;
fourthly, interpretation of results:
positive reaction: the detection line and the quality control line of the colloidal gold test strip are colored;
negative reaction: the detection line of the colloidal gold test strip is not colored, and the quality control line is colored.
7. The method of claim 6, wherein the temperature of the strand displacement reaction is 37 ℃ and the time is 30 min.
8. The method of claim 7, wherein the strand displacement reaction system of step (II) comprises, by volume: SDA primer 2. mu.l, deoxynucleoside triphosphate (dNTPs) 2. mu.l, polymerase (Klenow-exo) 0.6. mu.l, nicking endonuclease (Nt. BbvCI) 0.4. mu.l, SDA-buffer-22. mu.l, 10% BSA 1. mu.l, and ultrapure water 12. mu.l.
9. The method for detecting the colloidal gold test strip of the grouper iridovirus of claim 8, wherein the nucleotide sequence of the SDA primer is as follows: GAGACTTCATCTGCGTCCTTCG are provided.
10. The method for detecting the colloidal gold test strip of the grouper iridovirus according to any one of claims 6 to 9, wherein the sequence of the capture Aptamer (Aptamer1) is as follows: TATGTCCATGGCCGCATATTGGGAAGGTTGGTTTGGACTATGTGGAAGTT-Bio;
the sequence of the amplification Aptamer (Aptamer2) is as follows: TATGTCCATGGCCGCATATTGGGAAGGTTGGTTTGGACTATGTGGAAGTTGCTGAGGCGAAGGACGCAGATGAAGTCTC are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910873701.9A CN110618259A (en) | 2019-09-17 | 2019-09-17 | Colloidal gold test strip for detecting grouper iridovirus and preparation and detection methods thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910873701.9A CN110618259A (en) | 2019-09-17 | 2019-09-17 | Colloidal gold test strip for detecting grouper iridovirus and preparation and detection methods thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110618259A true CN110618259A (en) | 2019-12-27 |
Family
ID=68923044
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910873701.9A Pending CN110618259A (en) | 2019-09-17 | 2019-09-17 | Colloidal gold test strip for detecting grouper iridovirus and preparation and detection methods thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110618259A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111073892A (en) * | 2019-10-30 | 2020-04-28 | 广西科学院 | Aptamer for identifying grouper iridovirus infected cells and construction method and application thereof |
| CN112522274A (en) * | 2020-12-25 | 2021-03-19 | 华南农业大学 | ssDNA nucleic acid aptamer for identifying iridovirus of micropterus salmoides and application thereof |
| CN114231664A (en) * | 2021-11-30 | 2022-03-25 | 华南农业大学 | Epinephelus akaara nervous necrosis virus RGNNV detection kit and detection method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090087838A1 (en) * | 2007-05-02 | 2009-04-02 | Reif John H | Analyte detection using autocatalytic chain reactions |
| CN104789570A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| CN105785024A (en) * | 2016-04-22 | 2016-07-20 | 中国科学院南海海洋研究所 | Aptamer-based enzyme-linked immunosorbent assay method for detecting iridovirus infection of groupers |
| CN107179404A (en) * | 2017-06-02 | 2017-09-19 | 中国科学院广州生物医药与健康研究院 | A kind of furans metabolite derivatization reagent and its rapid detection card |
| US20180319657A1 (en) * | 2015-11-04 | 2018-11-08 | Biocifer Pty Ltd | Multiplex Lateral Flow Devices and Assays |
-
2019
- 2019-09-17 CN CN201910873701.9A patent/CN110618259A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090087838A1 (en) * | 2007-05-02 | 2009-04-02 | Reif John H | Analyte detection using autocatalytic chain reactions |
| CN104789570A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| US20180319657A1 (en) * | 2015-11-04 | 2018-11-08 | Biocifer Pty Ltd | Multiplex Lateral Flow Devices and Assays |
| CN105785024A (en) * | 2016-04-22 | 2016-07-20 | 中国科学院南海海洋研究所 | Aptamer-based enzyme-linked immunosorbent assay method for detecting iridovirus infection of groupers |
| CN107179404A (en) * | 2017-06-02 | 2017-09-19 | 中国科学院广州生物医药与健康研究院 | A kind of furans metabolite derivatization reagent and its rapid detection card |
Non-Patent Citations (3)
| Title |
|---|
| PENGFEI LI等: "Selection and characterization of novel DNA aptamers specifically recognized by Singapore grouper iridovirus-infected fish cells", 《JOURNAL OF GENERAL VIROLOGY》 * |
| ZHIYUAN FANG等: "Lateral flow biosensor for DNA extraction-free detection of salmonella based on aptamer mediated strand displacement amplification", 《BIOSENSORS AND BIOELECTRONICS》 * |
| 李鹏飞 等: "基于核酸适配体的石斑鱼病毒病防控技术体系的研究", 《中国水产学会学术年会论文摘要集》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111073892A (en) * | 2019-10-30 | 2020-04-28 | 广西科学院 | Aptamer for identifying grouper iridovirus infected cells and construction method and application thereof |
| CN111073892B (en) * | 2019-10-30 | 2023-11-17 | 广西科学院 | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof |
| CN112522274A (en) * | 2020-12-25 | 2021-03-19 | 华南农业大学 | ssDNA nucleic acid aptamer for identifying iridovirus of micropterus salmoides and application thereof |
| CN112522274B (en) * | 2020-12-25 | 2023-02-28 | 华南农业大学 | ssDNA nucleic acid aptamer for identifying iridovirus of micropterus salmoides and application thereof |
| CN114231664A (en) * | 2021-11-30 | 2022-03-25 | 华南农业大学 | Epinephelus akaara nervous necrosis virus RGNNV detection kit and detection method |
| CN114231664B (en) * | 2021-11-30 | 2023-07-28 | 华南农业大学 | Epinephelus akaara nerve necrosis virus RGNNV detection kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7210518B2 (en) | Methods and systems for rapid detection of microorganisms using recombinant bacteriophage | |
| CN110579591A (en) | Colloidal gold test strip for detecting nervous necrosis virus of grouper and preparation and detection methods thereof | |
| CN110618259A (en) | Colloidal gold test strip for detecting grouper iridovirus and preparation and detection methods thereof | |
| CN109406778B (en) | Time-resolved fluorescence quantitative test strip for detecting ralstonia solanacearum in tobacco leaves and preparation method and application thereof | |
| CN108410951B (en) | Novel nucleic acid extraction reagent and application thereof | |
| CN105018590B (en) | Protein ligands and gene detection kit and application at the same time | |
| CN111443199B (en) | Reagent for rapidly detecting novel coronavirus antibody by magnetic nanoparticle immunochromatography and preparation method thereof | |
| CN103898203B (en) | The detection method of Cryptosporidum parvum and detection kit | |
| JP2021516964A (en) | Methods for Detecting Microorganisms Using Microbial Detection Proteins and Other Uses of Cell-Binding Components | |
| JPH03277972A (en) | Method of detecting listeria germ | |
| WO2020206828A1 (en) | Alternariol aptamer affinity column and preparation method and application therefor | |
| US20130224730A1 (en) | Peptide ligands | |
| CN114814215B (en) | Pathogenic microorganism detection test paper strip based on aptamer latex particles | |
| JP2023182818A (en) | Methods and systems for rapid detection of Cronobacter using infectious agents | |
| CN113490849A (en) | Methods and systems for rapid detection of listeria using infectious agents | |
| CN108841828B (en) | Single-stranded DNA aptamer for specifically recognizing tobramycin and application thereof | |
| CN108866060B (en) | Nucleic acid aptamer specifically binding to crustacean arginine kinase, kit and detection method | |
| CN114107282A (en) | Method for extracting nucleic acid by modified diatomite and application | |
| CN111808852B (en) | Composition, kit, application and method for 2019 novel coronavirus nucleic acid extraction | |
| CN103695419B (en) | A kind of Viral nucleic acid extraction reagent | |
| CN114814216B (en) | Aptamer-antibody mixed sandwich method for identifying novel corona nucleocapsid protein | |
| CN106353499A (en) | Kit for detecting lung cancer serum marker aptamer and gene at same time and application thereof | |
| CN104293979B (en) | Avian infectious bronchitis virus and/or the genetic chip of avian infectious laryngotracheitis virus and kit | |
| CN110734990A (en) | Detection reagent, kit and application thereof | |
| CN109055361A (en) | It is a kind of extract ganoderma lucidum total DNA reagent and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191227 |
|
| RJ01 | Rejection of invention patent application after publication |