CN109055361A - It is a kind of extract ganoderma lucidum total DNA reagent and its application - Google Patents
It is a kind of extract ganoderma lucidum total DNA reagent and its application Download PDFInfo
- Publication number
- CN109055361A CN109055361A CN201811099989.0A CN201811099989A CN109055361A CN 109055361 A CN109055361 A CN 109055361A CN 201811099989 A CN201811099989 A CN 201811099989A CN 109055361 A CN109055361 A CN 109055361A
- Authority
- CN
- China
- Prior art keywords
- dna
- ganoderma lucidum
- rpm
- centrifuged
- adsorption column
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Saccharide Compounds (AREA)
Abstract
The present invention provide it is a kind of extract ganoderma lucidum total DNA reagent and its application, from its mycelium of 50 mg or so and fructification sample, adsorb, rinse by broken cracking, DNA, eluting and etc., extraction total DNA rapidly and efficiently, for fresh dry-eye disease, the total DNA for being suitable for the molecular biology experiments such as ITS identification equally also can extract.Further it is demonstrated experimentally that this method can also be applied on the edible and medical fungis such as Cordceps militaris, Agricus blazei, grifola frondosus.This method single sample extraction time foreshortens to 15 min, and extracted DNA integrality is good, with high purity, can be directly used for the test of the downstream molecular biologies such as PCR, Real-Time PCR, molecular labeling.
Description
Technical field
The invention belongs to technique for gene engineering molecular biology field, be related to a kind of reagent for extracting ganoderma lucidum total DNA and its
Using this method develops a kind of suitable for the fast of the downstream molecular biologies such as PCR, Real-Time PCR, molecular labeling test
The Total DNA extraction method of the fungies such as fast ganoderma lucidum, can fructification, mycelium and other tunnings to fungies such as ganoderma lucidums etc. it is total
DNA carries out rapidly extracting, and extracting product can be used for the research and Molecular Identification of molecular biology and science of heredity.
Background technique
DNA is the carrier of hereditary information in life entity, contains the inhereditary feature of organism.High quality, high-purity it is total
DNA be guarantee carry out PCR amplification, digestion with restriction enzyme, genetic map analysis, molecule hybridization, analysis of genetic diversity with
And the most important condition of the molecular biology researches such as genomics.Therefore, the good total DNA of high-purity, integrality efficiently, is quickly prepared
Sample seems particularly important.
Currently, the method for tradition preparation fungi total DNA includes CTAB method, SDS method, alkaline lysis and conventional reagent cassette method
Release genome, then pass through for cracking fungal cell using ionic surfactant Deng, CTAB method and SDS method
The multiple extracting of phenol/chloroform/isoamyl alcohol etc. is deposited in protein etc. in organic reagent, finally passes through isopropanol or ethyl alcohol
Precipitating obtains the good DNA molecular of purity is high, integrality.There is the process be centrifuged repeatedly, precipitate, waiting, behaviour in this approach
Make cumbersome and time-consuming, extraction process needs 2-3 h；And the organic solvents such as phenol, chloroform and isoamyl alcohol have poison in drug
Property, certain injury may cause to operator；Under next may cause organic solvent residual in total DNA sample to cause
Trip test can not be successfully progress.
Conventional reagent cassette method is to combine the progress of DNA adsorption column excellent on the basis ofs conventional methods such as CTAB method, SDS method etc.
Change, solves the DNA sample sedimentation time long disadvantage low with sample purity, and whole experiment process shortens to 1h or so.But
It still needs to be related to the toxic reagents such as chloroform, phenol, beta -mercaptoethanol in conventional reagent cassette method extraction process.
Alkaline lysis directly makes cellular membrane lysis using highly basic NaOH solution, and albuminous degeneration discharges total DNA, using TE
Buffer, which dilutes aqueous slkali, to be neutralized, so that having obtained DNA solution is directly used in PCR amplification, is presently the most common quick
The method that simplicity extracts total DNA.The DNA that this method obtains due to without any purification process, containing a large amount of pigments, polysaccharide and
The substances such as albumen, content and purity are all low to be unfavorable for subsequent experimental, and highly basic NaOH can interrupt DNA fragmentation in reaction process,
The DNA sample for causing this method to obtain only expands the gene that the upper limit is 1000 bp or so, and for longer genetic fragment and
Speech, this extracting method are obviously not suitable for.
Ganoderma lucidum is the treasure in traditional Chinese medicine and pharmacy, and in China, applicating history is long, in the earliest Herbal Textuals monograph " legendary god of farming in China
Book on Chinese herbal medicine warp " in, the effect of being classified as herbal medicine top grade, and being strengthened the body resistance to consolidate the constitution to it, is proved.Research, which has proven to ganoderma lucidum, to be had
Enhance the pharmacological effects such as immune function, anticancer, liver protection.With the fast development of modern biotechnology, carry out ganoderma lucidum molecular biosciences
Learn the hot spot that correlative study is also many focus of attention, due in ganoderma lucidum fruitbody and mycelium containing a large amount of active more
The interference such as carbohydrate and triterpenes isoreactivity substance, therefore the extracting method of ganoderma lucidum total DNA has complicated for operation with duration at present, has
Use the noxious materials such as phenol, chloroform, mercaptoethanol, some DNA integrity degrees are poor.Therefore, against the above deficiency and by pair
This method has been invented in the improvement of existing extractive technique, has safety, quick, easy, efficient, product integrity degree height, economy etc. excellent
Point.
Summary of the invention
The purpose of the present invention is to provide a kind of reagent for extracting ganoderma lucidum total DNA and its applications, by repeatedly optimizing experiment
Process and agent prescription sum up a kind of safe, quick, simple, high efficiency extraction ganoderma lucidum total DNA method.This method utilizes silicon
The combination degree difference of sour aluminium ceramic fibre film and DNA under the conditions of different salt ionic concentrations and pH to reach extracting and developing,
Purify the purpose of DNA.This method safe operation, quickly, it is simple, 15 min can complete the preparation process of entire total DNA, extraction
Raw material dosage is few in the process, is not necessarily to phenol, chloroform, avoids pollution of the organic solvent to operator；Experimental result shows,
Total DNA integrality is good, purity is high, is suitable for the experiment such as PCR, SSR, ISSR, qPCR.To solve existing extractive technique sample
The disadvantages of DNA fragmentation that dosage is big, time-consuming, reagent is toxic, extracts is shorter, to meet the precious material molecule biology such as ganoderma lucidum
The needs of experiment.
Specific steps are as follows:
(1) add Balance Buffer 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column SC, abandon waste liquid, it is right
DNA adsorption column is pre-processed；
(2) 400 μ l of Lysis Buffer will be added after the grinding of 2-50 mg sample, mixes, 10,000 rpm of room temperature, centrifugation 30
s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 600 μ l of Wash Buffer is added into DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, will after abandoning waste liquid
DNA adsorption column recovers waste collection pipe, and 10,000 rpm of room temperature is centrifuged 1 min.
(5) DNA adsorption column is moved on in 1.5 new mL EP pipes, uncaps and place 1-2 min removal ethyl alcohol residual, is added
The elution buffer EB(of 65 DEG C of preheatings can be incubated for 30 in the RNA enzyme that 20 μ g/ mL are wherein added, 37 DEG C if you need to remove RNA
Min) 30-100 μ l stands 1-2 min
(6) 12,000 rpm are centrifuged 2 min, and eluted dna saves backup.
Remarks: the DNA of extraction can deposit in 4 DEG C, if you need to long-term preservation, please be placed in -20 DEG C and save.
In the method for the above rapidly extracting fungi total DNA, the reagent optimization of C/C composites is as follows:
A kind of rapidly extracting ganoderma lucidum total DNA reagent, extract reagent include Balance Buffer(equilibrium liquid), Lysis
Buffer(lysate), Wash Buffer(DNA cleaning solution), Elution Buffer(DNA eluent) and DNA adsorption column.Its
In:
(1) Balance Buffer(equilibrium liquid, BB) include: 2 wt.% Na2SiO3·9H2O, 1 wt.% NaOH；
(2) Lysis Buffer(lysate, LB) include: 5.0M guanidine hydrochloride, 30% v/v isopropanol and 2 wt.%PVP K30；
(3) Wash Buffer(cleaning solution, WB) include: 20 mM NaCl, 20 mM Tris-HCl, 90%v/v ethyl alcohol, pH
7.5；
(4) Elution Buffer(eluent, EB) include: 10 mM Tris-HCl, pH 8.5.
The DNA adsorption column is alumina-silicate ceramic fibre film DNA adsorption column.
The advantages and benefits of the present invention are:
(1) during DNA is isolated and purified, present invention uses alumina-silicate ceramic fibre film DNA adsorption columns, and by using this
The equilibrium liquid of invention research and development pre-processes alumina-silicate ceramic fibre film, can obviously increase alumina-silicate ceramic fibre film and DNA
Percentage bound；
(2) by the formula of optimization lysate and cleaning solution, it on the one hand can adequately go removing protein, polysaccharide etc. other miscellaneous
Matter, on the other hand due to without using the organic reagents such as phenol, chloroform, can avoid toxic reagent is poisoned caused by operator with
Inhibiting effect of the remaining reagent to downstream tests；
(3) in the step of DNA is eluted, make DNA by 65 DEG C of preheating Elution Buffer to accelerate the warm-up movement of molecule
Molecule is easier and silica gel post separation, the maximum elution efficiency for guaranteeing DNA.
Operation of the present invention is simple, quick, with high purity, integrity degree is high, can be directly used for PCR, Real-Time PCR, molecule
The Total DNA extraction method of the fungies such as the quick ganoderma lucidum of the downstream molecular biologies such as label test, can be to the sub real of the fungies such as ganoderma lucidum
The total DNAs such as body, mycelium and other tunnings carry out rapidly extracting, and extracting product can be used for molecular biology and science of heredity
Research and Molecular Identification, can preferably meet the needs of molecular biology.
Detailed description of the invention
Fig. 1 is the race glue of ganoderma lucidum fruitbody, mycelium total DNA and Cordceps militaris, Agricus blazei, Grifola Frondosa sporophore total DNA
As a result.Sample is successively in figure are as follows: M, Beijing Quan Shi King Company Trans 15K DNA Marker；1, ganoderma lucidum fruitbody total DNA；2,
Ganoderma lucidum mycelium total DNA；3, Cordyceps militaris fruiting body total DNA；4, Agricus blazei fructification total DNA；5, Grifola Frondosa sporophore total DNA.
Fig. 2 is ganoderma lucidum fruitbody, mycelium, dry-eye disease DNA and Cordceps militaris, Agricus blazei, the ash extracted using this method
Setting flower total DNA is that template carries out ITS sequence amplification.Sample is successively in figure are as follows: M, Beijing Quan Shi King Company Trans 15K DNA
Marker；1, ganoderma lucidum fruitbody ITS segment；2, Ganoderma lucidum mycelium ITS segment；3, ganoderma lucidum dry-eye disease ITS segment；4, Cordceps militaris entity
ITS segment；5, Agricus blazei fructification ITS segment；6, Grifola Frondosa sporophore ITS segment.
Specific embodiment
Below in conjunction with drawings and examples, the present invention is further described, is only intended to clearly illustrate made by the present invention and lifts
Example, should not be construed as limitation of the invention.For those of ordinary skill in the art, on the basis of the above description
It can also make other variations or changes in different ways.There is no necessity and possibility to exhaust all the enbodiments.And
Thus amplify out it is obvious to modifications or substitutions made by the method for the present invention, step or condition still in of the invention
Among protection scope.
Embodiment: selection ganoderma lucidum fruitbody and the sample of mycelia carry out DNA extraction and purity detecting, and carry out ITS sequence
Detection and analysis.
Embodiment 1, the total DNA that ganoderma lucidum mycelium and fructification are extracted using this method
The mycelium and fructification of ganoderma lucidum under same condition of culture are collected respectively, the specific steps are as follows:
(1) add Balance Buffer 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column SC, abandon waste liquid, it is right
DNA adsorption column is pre-processed；
(2) 400 μ l of Lysis Buffer will be added after the grinding of 2-50 mg sample, mixes, 10,000 rpm of room temperature, centrifugation 30
s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 600 μ l of Wash Buffer is added into DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, will after abandoning waste liquid
DNA adsorption column recovers waste collection pipe, and 10,000 rpm of room temperature is centrifuged 1 min.
(5) DNA adsorption column is moved on in 1.5 new mL EP pipes, uncaps and place 2 min removal ethyl alcohol residual, is added 65
The elution buffer EB(of DEG C preheating, can be in the RNA enzyme that 20 μ g/ mL are wherein added if you need to remove RNA, and 37 DEG C are incubated for 30
Min) 30-100 μ l stands 2min
(6) 12,000 rpm are centrifuged 2 min, and eluted dna saves backup.
Its extract reagent include Balance Buffer(equilibrium liquid), Lysis Buffer(lysate), Wash Buffer
(DNA cleaning solution), Elution Buffer(DNA eluent) and DNA adsorption column.Wherein:
(1) Balance Buffer(equilibrium liquid, BB) include: 2wt.% Na2SiO3·9H2O, 1wt.% NaOH；
(2) Lysis Buffer(lysate, LB) include: 5.0M guanidine hydrochloride, 30%v/v isopropanol and 2wt.%PVP K30；
(3) Wash Buffer(cleaning solution, WB) include: 20 mM NaCl, 20 mM Tris-HCl, 90%v/v ethyl alcohol, pH
7.5；
(4) Elution Buffer(eluent, EB) include: 10 mM Tris-HCl, pH 8.5.
The concentration mensuration result of mentioned genomic DNA is mycelium 300ng/ μ l,OD 260/OD 280It is 1.892；Fructification
400ng/ μ l,OD 260/OD 280It is 1.912；.
Embodiment 2
Ganoderma lucidum fruitbody, mycelium and Cordceps militaris, Agricus blazei, Grifola Frondosa sporophore are collected respectively, the specific steps are as follows:
(1) add Balance Buffer 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column SC, abandon waste liquid, it is right
DNA adsorption column is pre-processed；
(2) 400 μ l of Lysis Buffer will be added after the grinding of 2-50 mg sample, mixes, 10,000 rpm of room temperature, centrifugation 30
s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 600 μ l of Wash Buffer is added into DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, will after abandoning waste liquid
DNA adsorption column recovers waste collection pipe, and 10,000 rpm of room temperature is centrifuged 1 min.
(5) DNA adsorption column is moved on in 1.5 new mL EP pipes, uncaps and place 1 min removal ethyl alcohol residual, is added 65
The elution buffer EB(of DEG C preheating, can be in the RNA enzyme that 20 μ g/ mL are wherein added if you need to remove RNA, and 37 DEG C are incubated for 30
Min) 30-100 μ l stands 1min
(6) 12,000 rpm are centrifuged 2 min, and eluted dna saves backup.
Its extract reagent include Balance Buffer(equilibrium liquid), Lysis Buffer(lysate), Wash Buffer
(DNA cleaning solution), Elution Buffer(DNA eluent) and DNA adsorption column.Wherein:
(1) Balance Buffer(equilibrium liquid, BB) include: 2wt.% Na2SiO3·9H2O, 1wt.% NaOH；
(2) Lysis Buffer(lysate, LB) include: 5.0M guanidine hydrochloride, 30%v/v isopropanol and 2wt.%PVP K30；
(3) Wash Buffer(cleaning solution, WB) include: 20 mM NaCl, 20 mM Tris-HCl, 90%v/v ethyl alcohol, pH
7.5；
(4) Elution Buffer(eluent, EB) include: 10 mM Tris-HCl, pH 8.5.
2 μ L are taken to carry out agarose gel electrophoresis detection, the result is shown in Figure 1, the results showed that, it extracts with the inventive method above-mentioned
Five kinds of samples can obtain the visible genome of electrophoresis.
Embodiment 3, ganoderma lucidum ITS sequence PCR amplification
According to ganoderma lucidum ITS sequence, using edible mushroom ITS segment universal primer ITS-4/5, ganoderma lucidum fruitbody, mycelia to extraction
Body, dry-eye disease DNA and Cordceps militaris, Agricus blazei, grifola frondosus total DNA genome carry out PCR detection.
Primer sequence are as follows:
ITS-4: 5’- TCCTCCGCTTATTGATATGC -3’
ITS-5: 5’- GGAAGTAAAAGTCGTAACAAGG -3’
PCR amplification agents useful for same is purchased from Beijing Quan Shijin Biotechnology Co., Ltd, the system of reaction are as follows:
The condition of PCR reaction are as follows: 94 DEG C of 7min → [94 DEG C of 30s → 56 DEG C 30s → 72 DEG C 30s] ×
34cicles → 72℃ 10min → 4℃。
Agarose gel electrophoresis analysis
Total DNA and pcr amplification product are detected with 1% agarose gel electrophoresis, and sample-loading buffer is 10 × Loading
Buffer, electrophoretic buffer are 1 × TAE, and molecular weight standard Marker is Trans 15K, and EB is dyed, and ultraviolet gel imager exists
It observes and takes pictures under 312nm.
The result shows that extracting ganoderma lucidum sample with the inventive method obtains the visible complete genomic DNA that becomes clear of electrophoresis
Band, other three kinds of edible mushroom samples also obtain the complete band that becomes clear, ganoderma lucidum total DNA and other are expanded with universal primer ITS
The total DNA of three kinds of edible mushroom samples, all samples can obtain size 600 bp or so purpose band and luminance difference not
(Fig. 2) greatly has wide applicability.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification, is all covered by the present invention.
SEQUENCE LISTING
<110>University Of Agriculture and Forestry In Fujian
<120>a kind of reagent for extracting ganoderma lucidum total DNA and its application
<130> 2
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
tcctccgctt attgatatgc 20
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<400> 2
ggaagtaaaa gtcgtaacaa gg 22
Claims (4)
1. a kind of reagent for extracting ganoderma lucidum total DNA, which is characterized in that its reagent includes equilibrium liquid, lysate, Wash Buffer
Cleaning solution, eluent, in which:
(1) equilibrium liquid includes following component: 2% Na2SiO3·9H2O, 1% NaOH；
(2) lysate includes following component: 5.0M guanidine hydrochloride, 30% isopropanol and 2%PVP K30；
(3) cleaning solution includes following component: 20 mM NaCl, 20 mM Tris-HCl, 90% ethyl alcohol, pH 7.5；
(4) eluent includes following component: 10 mM Tris-HCl, pH 8.5.
2. the method for extracting ganoderma lucidum total DNA based on reagent described in claim 1, which is characterized in that comprise the steps of:
(1) add equilibrium liquid 200 μ L, 10,000 rpm to be centrifuged 1 min into DNA adsorption column, abandon waste liquid, DNA adsorption column is carried out
Pretreatment；
(2) 400 μ l of lysate will be added after the grinding of 50 mg or so sample, mixes, 10,000 rpm of room temperature, is centrifuged 30 s；
(3) supernatant is transferred to processed DNA adsorption column, 10,000 rpm of room temperature is centrifuged 1 min, abandons waste liquid；
(4) 600 μ l of cleaning solution is added into DNA adsorption column, and 10,000 rpm of room temperature is centrifuged 1 min, DNA is inhaled after abandoning waste liquid
Attached column recovers waste collection pipe, and 10,000 rpm of room temperature is centrifuged 1 min；
(5) DNA adsorption column is moved on in 1.5 new mL EP pipes, uncaps and place 1-2 min removal ethyl alcohol residual, is added 65 DEG C
The eluent 30-100 μ l of preheating stands 1-2 min；When removing RNA, it is added the RNA enzyme of 20 μ g/ mL in eluent, 37
DEG C be incubated for 30 min；
(6) 12,000 rpm are centrifuged 2 min, and eluted dna saves backup.
3. according to the method described in claim 2, it is characterized in that, the DNA adsorption column is alumina-silicate ceramic fibre film DNA suction
Attached column.
4. reagent as described in claim 1 is extracting the application in ganoderma lucidum total DNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811099989.0A CN109055361A (en) | 2018-09-20 | 2018-09-20 | It is a kind of extract ganoderma lucidum total DNA reagent and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811099989.0A CN109055361A (en) | 2018-09-20 | 2018-09-20 | It is a kind of extract ganoderma lucidum total DNA reagent and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109055361A true CN109055361A (en) | 2018-12-21 |
Family
ID=64762328
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811099989.0A Withdrawn CN109055361A (en) | 2018-09-20 | 2018-09-20 | It is a kind of extract ganoderma lucidum total DNA reagent and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055361A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112280776A (en) * | 2020-11-05 | 2021-01-29 | 广西民族师范学院 | Wild Ganoderma applanatum RNA extraction method |
| CN116287416A (en) * | 2023-04-06 | 2023-06-23 | 中国医学科学院药用植物研究所 | Fungus species identification method based on time-base method, target nucleotide, primer pair, kit and application of fungus species identification method |
-
2018
- 2018-09-20 CN CN201811099989.0A patent/CN109055361A/en not_active Withdrawn
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112280776A (en) * | 2020-11-05 | 2021-01-29 | 广西民族师范学院 | Wild Ganoderma applanatum RNA extraction method |
| CN116287416A (en) * | 2023-04-06 | 2023-06-23 | 中国医学科学院药用植物研究所 | Fungus species identification method based on time-base method, target nucleotide, primer pair, kit and application of fungus species identification method |
| CN116287416B (en) * | 2023-04-06 | 2024-03-15 | 中国医学科学院药用植物研究所 | Fungus species identification method based on time-base method, target nucleotide, primer pair, kit and application of fungus species identification method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Maio | DNA strand reassociation and polyribonucleotide binding in the African green monkey, Cercopithecus aethiops | |
| CN101935646B (en) | Kit and method for extracting DNA from micro samples | |
| NL8900725A (en) | METHOD AND COMBINATION OF AGENTS FOR INSULATING NUCLEIC ACID. | |
| CN109055361A (en) | It is a kind of extract ganoderma lucidum total DNA reagent and its application | |
| CN112899266A (en) | Cracking binding solution for nucleic acid extraction, kit and application thereof | |
| Balijja et al. | A non-phenol–chloroform extraction of double-stranded RNA from plant and fungal tissues | |
| CN104404030B (en) | A kind of kit and method of rapid extraction plant genome DNA | |
| US20230203476A1 (en) | Nucleic acid extraction method and application | |
| CN110819625A (en) | Method for extracting genome DNA (deoxyribonucleic acid) suitable for bacteria and/or fungi | |
| CN110618259A (en) | Colloidal gold test strip for detecting grouper iridovirus and preparation and detection methods thereof | |
| CN110172526A (en) | A kind of Rapid identification Fusarium graminearum produces kit and its application of virus gene type | |
| US6699986B2 (en) | Electrophoretic separation of nucleic acids from proteins at low ph | |
| KR100454869B1 (en) | Cell lysis buffer for extracting DNA and extraction method by using thereof | |
| CN108998448A (en) | It is a kind of extract halimasch total DNA reagent and its application | |
| CN108998449A (en) | It is a kind of extract grifola frondosus total DNA reagent and its application | |
| CN108949749A (en) | A method of the rapidly extracting DNA long fragment from fresh fungal mycelium | |
| CN109022426A (en) | It is a kind of extract Antrodia camphorata total DNA reagent and application | |
| CN109055362A (en) | A kind of kit and method extracting long root mushroom genomic DNA | |
| CN111019940A (en) | Extracting solution for directly extracting whole blood genome DNA and extracting method thereof | |
| CN102433322A (en) | Extraction method for honey gene | |
| CN109022424A (en) | It is a kind of extract dictyophora phalloidea total DNA reagent and application | |
| CN116622909A (en) | Isothermal amplification detection reagent and detection method for feline herpesvirus I type | |
| CN106957923B (en) | Universal primer for identifying species of pathogenic bacteria of potato scab and detection method | |
| CN109022425A (en) | It is a kind of extract Agricus blazei total DNA reagent and application | |
| CN105296470A (en) | Kit for extracting high-purity DNA of colla corii asini and derivative products of colla corii asini, as well as extraction method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20181221 |