CN108239646B - Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer - Google Patents

Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer Download PDF

Info

Publication number
CN108239646B
CN108239646B CN201810082398.6A CN201810082398A CN108239646B CN 108239646 B CN108239646 B CN 108239646B CN 201810082398 A CN201810082398 A CN 201810082398A CN 108239646 B CN108239646 B CN 108239646B
Authority
CN
China
Prior art keywords
aptamer
liver cancer
cells
cell
synthesis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201810082398.6A
Other languages
Chinese (zh)
Other versions
CN108239646A (en
Inventor
葛银林
于晓霞
葛科立
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao University
Original Assignee
Qingdao University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao University filed Critical Qingdao University
Priority to CN201810082398.6A priority Critical patent/CN108239646B/en
Publication of CN108239646A publication Critical patent/CN108239646A/en
Application granted granted Critical
Publication of CN108239646B publication Critical patent/CN108239646B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers

Abstract

The invention provides a nucleic acid aptamer combined with liver cancer cells, application thereof and a detection method using the nucleic acid aptamer, and relates to the technical field of biomedicine. The technical problem that an aptamer capable of targeting hepatoma cells is absent in the prior art is solved.

Description

Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer
Technical Field
The invention relates to the technical field of molecular biomedicine, in particular to a nucleic acid aptamer combined with liver cancer cells, application thereof and a detection method using the nucleic acid aptamer.
Background
Aptamers (aptamers) are ribonucleic acids (RNA) and single-stranded deoxyribonucleic acids (ssDNA) which are folded through hydrogen bonding among bases in a chain to form stable secondary or tertiary structures such as hairpins, stem loops, pseudoknots, pockets, bulge loops and G-quadruplexes and are matched with a target in a space structure and combined with high affinity and specificity. The aptamer generally consists of dozens of nucleotides, has small relative molecular mass, is easy to penetrate cell membranes, has stable property and is easy to prepare and modify; the combined target range is wide, and the combined target range comprises ions, small molecules, proteins, cells, microorganisms and the like; the affinity of the antibody can be equivalent to that of an antibody, and the affinity constant can reach nanomolar or picomolar level. In recent years, nucleic acid aptamers have received much attention from scientists, and research on basic, clinical, and pharmaceutical development has been increasing.
Primary liver cancer is one of the most common digestive system malignant tumors in clinic, and the mortality rate of the primary liver cancer is the second place in China and the third place in the world. The incidence of liver cancer in China is very high, statistics shows that the number of liver cancer patients in China accounts for more than about half of the world, most of the liver cancer patients in China are already in the advanced stage or the advanced stage when being diagnosed, the treatment means is very limited, and the five-year survival rate of liver cancer patients in China is directly lower than that of developed countries in Europe and America along with blood circulation transfer and cancer thrombus formation.
Compared with the traditional treatment means, the molecular targeted therapy has better molecular targeting property, can selectively kill tumor cells, reduces the damage to normal tissues, is not easy to generate drug resistance, and has good safety and tolerance.
The targeted therapy utilizes biospecific interactions such as antigen-antibody binding or ligand-ligand binding to achieve targeted delivery of drugs. The existing ligand or 'targeting carrier' which can be used as active targeting is mainly antibody, polypeptide, folic acid and polysaccharide. Antibodies generally have high affinity for the target, but are highly immunogenic; the polypeptide has small molecular weight and is easy to synthesize, but the polypeptide is easy to carry out enzymolysis in systemic circulation and is not suitable for in vivo application; small molecule compounds, such as folic acid, have small molecular weight and good stability, but have low targeting to tumors. Therefore, screening an aptamer capable of targeting liver cancer cells and applying the aptamer to liver cancer cell detection, liver tumor research, preparation of liver cancer-targeted drugs and the like is a problem to be solved.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first purpose of the invention is to provide an aptamer capable of binding liver cancer cells, and to alleviate the technical problem of the lack of an aptamer capable of targeting liver cancer cells in the prior art.
The second objective of the present invention is to provide a method for detecting liver cancer cells, which alleviates the technical problem of the prior art that a nucleic acid aptamer capable of targeting liver cancer cells is not used for detecting liver cancer cells.
The third objective of the present invention is to provide an application of the aptamer for binding with a liver cancer cell in tumor research or in the preparation of a kit for detecting a liver cancer cell, so as to alleviate the technical problem that an aptamer targeting a liver cancer cell, which can be applied in tumor research or in the preparation of a kit for detecting a liver cancer cell, is absent in the prior art.
The fourth purpose of the present invention is to provide a drug, a probe, DNA or RNA targeting a liver cancer cell, which comprises the aptamer capable of binding to a liver cancer cell, and alleviate the technical problem in the prior art that a drug, a probe, DNA or RNA targeting a liver cancer cell, which comprises an aptamer capable of binding to a liver cancer cell, is lacking.
An aptamer combined with liver cancer cells, wherein the aptamer has a sequence shown as SEQ ID NO. 1.
Further, the 5 'end and/or the 3' end of the aptamer are modified by a modifier.
Further, the modifier comprises a fluorescent label, a biotin label, a drug label or a chemical group label.
Further, the liver cancer cells specifically bound by the aptamer comprise HepG2, SMMC7721 or HCC-LM 3.
Further, the aptamer is artificially synthesized, or any other source of aptamer with homologous sequence.
Further, the artificial synthesis comprises in vitro chemical synthesis or molecular biological method synthesis;
preferably, the molecular biological synthesis is PCR synthesis;
preferably, the PCR synthesis is an asymmetric PCR synthesis.
A method for detecting liver cancer cells, which applies the aptamer.
Further, the method comprises the following steps: synthesizing the aptamer, incubating the sample with the aptamer, and detecting binding of the sample to the aptamer;
preferably, the sample comprises a cell or tissue section.
An application of the aptamer containing the liver cancer-binding cell in tumor research or preparation of a kit for detecting the liver cancer cell.
A medicine, a probe, DNA or RNA of the aptamer combined with the liver cancer cell and targeting the liver cancer cell.
The aptamer combined with the liver cancer cells provided by the invention has the advantages of accurate identification, no immunogenicity, easy in-vitro synthesis and modification and the like. Compared with protein antibodies, the single-chain oligonucleotide is more stable; the aptamer can be directly synthesized in vitro and connected with other nucleic acid sequences or labeled, so that the aptamer can carry targeted drugs and does not need to label a second antibody to directly detect the hepatoma cells, and targeted introduction of siRNA and antitumor drugs and detection operation are simpler and quicker; the synthesis cost of the aptamer is lower than that of preparing the antibody, and the period is short. The aptamer can specifically recognize various liver tumor cell strains, including HepG2, SMMC7721, HCC-LM3 and the like; the nucleic acid aptamer can also specifically identify cancer cells in cancer tissue slices of tested clinical liver cancer patients, and the reference nucleic acid sequence is not combined with the cells and tissues.
The method for detecting the liver cancer cells can directly detect the liver cancer cells in various modes, for example, a flow cytometer and a confocal microscope are adopted to detect the aptamer marked with fluorescence; the digoxigenin-labeled aptamer is detected by immunochemiluminescence, for example, using digoxigenin antibody with alkaline phosphatase, and developing color using NBT or BCIP as a substrate, thereby detecting cancer cells bound to the digoxigenin-labeled aptamer. Therefore, the aptamer is suitable for various detection methods and systems, has wide applicability, and can be used for detection in most laboratories.
The application of the aptamer combined with the liver cancer cell in tumor research or preparation of a kit for detecting the liver cancer cell provided by the invention is wide in application range, can be applied to the field of cancer detection or liver cancer research, is suitable for various fields and laboratories, and is simple and convenient to use.
The liver cancer cell-targeted drug, probe, DNA or RNA containing the aptamer combined with the liver cancer cell can target the liver cancer cell and enhance the targeting property of the drug, probe, DNA or RNA.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a diagram showing the results of flow cytometry method of the present invention for verifying the binding of FAM-07S to hepatoma cell HepG 2;
fig. 2 is a diagram of the flow cytometry method provided in example 2 of the present invention verifying the binding result between FAM-07S and hepatoma cell SMMC 7721;
FIG. 3 is a diagram showing the results of flow cytometry method of the present invention for verifying the binding of FAM-07S to HCC-LM 3;
FIG. 4 is a graph showing the results of flow cytometry method of the present invention, which is provided in example 2, in verifying the binding of FAM-07S to liver normal cells L02;
FIG. 5 is a graph showing the results of flow cytometry method of the present invention, which is provided in example 2, verifying the binding of FAM-07S to HBL100 of normal hepatocytes;
FIG. 6 is a graph showing the results of flow cytometry method of the present invention in example 2 to verify the binding of FAM-07S to normal hepatocyte MCF-7;
FIG. 7 is a graph showing the results of flow cytometry method of the present invention in example 2 to verify the binding of FAM-07S to H460 hepatocyte cells;
FIG. 8 is a diagram showing the results of flow cytometry method of verifying the binding of FAM-07S to MGC-803, which is a hepatocyte normal cell, according to example 2 of the present invention;
fig. 9 is a diagram showing the results of flow cytometry method provided in example 2 of the present invention to verify the binding of FAM-07S to normal liver cells SW 480.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments and the accompanying drawings, and it is to be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention provides a nucleic acid aptamer combined with liver cancer cells, which has a sequence shown as SEQ ID No. 1.
In recent years, the research of using aptamer (aptamer) as a carrier for active targeted drug delivery has become a new topic in the field of active targeted drug delivery system research. The aptamer is a section of oligomeric single-stranded DNA or RNA, generally comprises 20-80 bases, has a molecular weight of 6-25 kD, can be folded into a special three-dimensional structure, and can specifically recognize and combine molecules such as proteins, saccharides, nucleotides and the like. Because the aptamer has the advantages of accurate identification, no immunogenicity, easy in vitro synthesis and modification and the like, the aptamer is also called as an artificial substitute antibody. By designing the combination of the aptamer and the drug, the targeted delivery of the drug or drug carrier can be realized, the curative effect of the drug is improved, the adverse reaction is reduced, and a new direction is provided for the development of an active targeted drug delivery system. Therefore, the method has wide application prospects in the aspects of basic medicine, new drug research and development and the like, particularly, a composite target SELEX technology which is started in recent years enables screening of unknown target molecules to be possible, and by introducing a subtractive screening step, an aptamer which can specifically identify molecules which are different in two groups of cells or composite targets can be obtained, and the aptamer can be used for reversely and differentially guiding drugs in a targeted manner, so that a new way is opened for developing novel targeted drugs, particularly for specifically and targetedly killing tumor cells.
The exponential enrichment ligand system evolution technology (SELEX) is based on the knowledge of molecular biology: the specific interaction between nucleic acid molecule and protein molecule in vivo is the guarantee of orderly progress of a series of basic life activities such as gene transcription, nucleic acid replication, protein expression, etc. Basic principles of SELEX technology: artificially synthesized single-stranded nucleic acid library (ssDNA or RNA) containing about 40nt random sequences, and the possible sequences of the library can reach 4 in theory40And (4) seed preparation. The diversity of the primary sequence also results in the diversity of the secondary and tertiary structures of ssDNA or RNA. Through multiple cycles of screening, various target substances, such as organic molecules of proteins, nucleic acids, small peptides, amino acids and the like, even metal ions, can theoretically find the nucleic acid sequence specifically and firmly combined with the different sequences and the nucleic acids with different spatial structures. Warp beamAfter multiple rounds of circular screening and PCR/RT-PCR amplification, and cloning, sequencing and identification, the nucleic acid chain-ligand of the section of specific sequence combined with the target substance, also called aptamer, can be produced in large quantities and purified.
In an alternative embodiment, the 5 'end and/or the 3' end of the aptamer is modified with a modifier.
Because the aptamer can be artificially synthesized, different chemical groups can be modified at the tail end of the aptamer and connected with a drug carrier to prepare drug delivery systems with different functions, for example, the aptamer can be connected with polymers, inorganic nanoparticles, dendritic molecules, liposomes and micelles to form different drug delivery systems. In addition, the aptamer can also be connected with various markers and applied to detection and identification of liver cancer cells or tissues.
In an alternative embodiment, the modifier comprises a fluorescent label, a biotin label, a drug label, or a chemical group label.
After labeling the aptamer at the 5 'end and/or 3' end, the aptamer is introduced into a sample to be detected, and the binding of the aptamer to the sample to be detected can be detected by various means, such as flow cytometry, confocal microscopy, and immunochemiluminescence detection, so that the aptamer is suitable for various detection methods and systems. Furthermore, the insertion of drugs into aptamers is a simple and effective means of targeted drug delivery, and drugs can also be chemically modified to form stable ester, amine and disulfide bonds bound to the aptamers or covalently bound through linkers.
In an alternative embodiment, the liver cancer cell specifically bound by the aptamer comprises HepG2, SMMC7721 or HCC-LM 3.
The aptamer can specifically recognize various liver tumor cell strains, including HepG2, SMMC7721, HCC-LM3 and the like; the nucleic acid aptamer can also specifically identify cancer cells in cancer tissue slices of tested clinical liver cancer patients, and the reference nucleic acid sequence is not combined with the cells and tissues.
In an alternative embodiment, the aptamer is artificially synthesized, or any other source of aptamers having homologous sequences.
In an alternative embodiment, the artificial synthesis comprises in vitro chemical synthesis or molecular biological synthesis
The oligonucleotide can be synthesized in vitro or by PCR in various ways, and can be added with a modifier or connected with siRNA in the in vitro synthesis process, and can also be connected with other DNA sequences in the PCR process.
In a preferred embodiment, the molecular biological method is synthesized as a PCR synthesis.
The PCR synthesis has low cost and high speed, and can synthesize multiple oligonucleotides at one time.
In a more preferred embodiment, the PCR synthesis is an asymmetric PCR synthesis.
Asymmetric PCR (asymmetric PCR) is a PCR amplification that produces large amounts of single-stranded DNA (ssDNA) using unequal amounts of a pair of primers. A large amount of nucleic acid aptamers can be obtained by using a common PCR method and reagents, and the method is convenient and simple to operate and low in cost.
The invention provides a method for detecting liver cancer cells, and the aptamer is applied.
In an alternative embodiment, the method comprises the steps of: synthesizing the aptamer, incubating the sample with the aptamer, and detecting the binding between the sample and the aptamer.
In a preferred embodiment, the sample comprises a cell or tissue section.
The aptamer can specifically recognize various liver tumor cell strains, including HepG2, SMMC7721, HCC-LM3 and the like; the nucleic acid aptamer can also specifically identify cancer cells in a cancer tissue slice of a tested clinical liver cancer patient, and a reference nucleic acid sequence is not combined with the cells and the tissues; the aptamer can be modified to directly detect liver cancer cells in various ways, for example, a flow cytometer or a confocal microscope is adopted to detect the aptamer marked with fluorescence, and an immunochemiluminescence detection method is adopted to detect the aptamer marked with digoxin, so that the aptamer is suitable for various detection methods and systems.
The invention provides an application of the aptamer combined with the liver cancer cell in tumor research or preparation of a kit for detecting the liver cancer cell. The kit is wide in application range, can be applied to the field of cancer detection or liver cancer research, is suitable for various fields and laboratories, and is simple and convenient to use.
The invention provides a medicine, a probe, DNA or RNA of the aptamer combined with the liver cancer cell and targeting the liver cancer cell.
The incorporation of chemotherapeutic drugs into aptamers is a simple and effective means of targeted drug delivery, and such incorporation conditions are generally mild and do not require any chemical modification of the drug or ligand, and both the drug and the aptamer retain biological activity and achieve high drug loading. The drug may also be chemically modified to form stable esters, amines and disulfide bonds bound to the aptamer or covalently bound through a linker.
Antitumor drugs generally play a role in cells, and the key to the effectiveness is to improve the drug intake. The nanoparticles can enter cells through a cell endocytosis way, if the aptamer is connected to the surface of the nanoparticles, the medicine can mediate endocytosis after targeting tumor cells, so that the medicine intake is improved, and the administration mode becomes a hotspot of the current research.
Modern science has proved that the pathogenesis of cancer is caused by too much expression of related oncogenes, inactivation or reduced expression of cancer suppressor genes. Inhibiting the expression of cancer genes and improving the expression of cancer suppressor genes are basic strategies for treating tumors. In cells and animals, small double-stranded RNA has been shown to be the best method for inhibiting gene expression, and small amounts of double-stranded RNA introduced into cells can control the expression of the corresponding gene, which is also known as RNA interference (RNAi). Small double-stranded RNA can be synthesized in vitro. However, when small interfering RNA (siRNA) is introduced into a body as a drug, the targeting property of the siRNA is a main obstacle influencing the application of the technology to clinical treatment because the siRNA does not have the targeting capability to tissues or cells. When the siRNA is synthesized in vitro, the aptamer is synthesized at the same time, so that the siRNA has targeting property, and the technical problem that the siRNA does not have the targeting capability on tissues or cells is solved.
The invention will now be further described with reference to the preferred embodiments
Example 1 screening of aptamers that bind to hepatoma cells
The screening of aptamers is based on SELEX technology. Synthesizing a random oligonucleotide ssDNA library GP30(5 '-gcaatggtac ggtacttccn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc aaaagtgcacgctactttgc taa-3', n represents any one of a, t, c and g),
the method comprises the steps of using a human immortalized liver cell line L-02 as a depletion cell, incubating a library GP30 with the depletion cell, incubating a GP30 library which is not combined with the depletion cell with a target cell, using two liver cancer cells of human HepG2 and SMMC7721 as the target cell, washing away the non-combined part, eluting ssDNA combined on the target cell, and performing PCR amplification and recovery. Repeating the above process for secondary screening. After several rounds of screening, the enriched library was sequenced in high throughput, and ligated with T vector to transform Ecoli and establish clones. And selecting monoclonal sequencing to obtain an aptamer sequence in the enrichment library. After secondary structure and homology analysis of each sequence, selecting proper ssDNA for synthesis and FAM labeling, and identifying the binding force of the aptamer and the target cell by using flow cytometry. Finally, the obtained ssDNA with the best binding force is named as 07S, and the sequence of the ssDNA is shown as SEQ ID NO. 1; random oligonucleotide libraries GP30 and 07S were FAM modifications; the sequence of aptamer 07S is as follows: 5'-gtactgtcaa ttggaagtggtgttacgttg tgtagtcaaa tcagtgc-3', respectively;
example 2 detection of binding of aptamer binding to hepatoma cells to target cells
Cell preparation:
(a) the day before the experiment, the cell renewal culture medium is high-sugar DMEM (gibco) medium containing 10% fetal bovine serum (Kangyuan organism);
(b)75cm2the culture bottle cultures the cells to 7 generationsWhen the cells are full, the cells are in the optimal growth state, and the cells are rinsed twice by using 3mL of 1 multiplied by PBS;
(c) digesting cells with 1mL of pancreatin (containing EDTA), removing pancreatin after the cells become round, neutralizing with 2mL of complete culture medium, centrifuging at 1000rpm multiplied by 5min, and removing supernatant;
(d) washing the cells twice by 10mL serum-free DMEM medium, centrifuging at 1000rpm multiplied by 3min respectively, and discarding the supernatant (ensuring no EDTA residue);
(e) the appropriate volume of wash buffer 1 XPBS-1 mM MgCl2 was counted in a resuspension and 3 ten thousand cells were kept on ice and incubated with aptamers.
The whole cell preparation process is operated gently, so that cell rupture caused by cell blowing is avoided, endogenous Dnase is released, and the combination detection of the aptamer and the target cell is influenced.
Preparing an aptamer:
200pmol of FAM-GP30 and FAM-07S were each placed in 1 XPBS-1 mM MgCl2, heated at 95 ℃ for 5min, and then rapidly cooled on ice for 10 min.
Incubation binding of aptamers to target cells:
(a) the pre-treated cells were mixed with the aptamers and 1. mu.g/. mu.L yeast tRNA precooled on ice and 1. mu.g/. mu.L salmon sperm DNA were added to make the final incubation system 1 XPBS-1 mM MgCl20.1. mu.g/. mu.L yeast tRNA, 0.1. mu.g/. mu.L salmon sperm DNA, 200pmol aptamer, for a total of 100. mu.L.
(b) Placing the incubation system on ice, incubating for 10min with gentle shaking on a shaker, centrifuging at 1000rpm × 5min, discarding the supernatant, and adding 1 × PBS-1mM MgCl23% BSA to 300. mu.L, and the FAM fluorescence intensity was measured by flow cytometry.
The whole process shortens the retention time of the cells in 1 XPBS-1 mM MgCl2 as much as possible, and the aptamers are marked by FAM and need to be protected from light to prevent fluorescence quenching.
Results as shown in fig. 1-9, with the ordinate of count and the abscissa of FL1-FITC, channel 1 was selected for the flow cytometry experiment, and this channel parameter was set as the FITC acquisition channel and can be used for the experiment.
As can be seen from FIGS. 1-9, the 07S aptamer can specifically recognize HepG2, SMMC7721 and HCC-LM3, which are hepatocellular carcinomas of human origin. Other human immortalized normal cell lines and other non-liver cancer tumor cell lines were not identified.
The conclusion is drawn from fig. 1: compared with the control sequence GP30, FAM-07S can specifically recognize HepG2 cell of hepatocellular carcinoma of human origin.
From fig. 2, it follows that: compared with the control sequence GP30, FAM-07S can specifically recognize human hepatocellular carcinoma SMMC7721 cells.
The conclusion is drawn from fig. 3: compared with the control sequence GP30, FAM-07S can specifically recognize human hepatocellular carcinoma HCC-LM3 cells.
The conclusion is drawn from fig. 4: FAM-07S did not recognize human immortalized normal liver cell line L02 cells compared to control sequence GP 30.
The conclusion is drawn from fig. 5: FAM-07S did not recognize human immortalized breast cell line HBL100 cells compared to control sequence GP 30.
From fig. 6, it follows that: FAM-07S did not recognize human breast cancer cell line MCF-7 cells compared to the control sequence GP 30.
The conclusion is drawn from fig. 7: FAM-07S did not recognize H460 cells, a human large cell lung carcinoma cell, as compared to the control sequence GP 30.
From fig. 8, it follows that: FAM-07S did not recognize human gastric adenocarcinoma cells MGC-803 cells compared to control sequence GP 30.
From fig. 9, it follows that: FAM-07S did not recognize SW480 cells as human colon adenocarcinoma cells compared to control sequence GP 30.
In conclusion, FAM-07S can specifically recognize various human liver tumor cells, does not recognize other human cells, and has wide clinical application and basic application prospect of targeting human liver cancer cells.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Qingdao university
<120> aptamer binding to hepatoma cells, use thereof and detection method using same
<160>1
<170>PatentIn version 3.5
<210>1
<211>47
<212>DNA
<213> Artificial sequence
<400>1
gtactgtcaa ttggaagtgg tgttacgttg tgtagtcaaa tcagtgc 47

Claims (13)

1. An aptamer capable of binding with liver cancer cells, wherein the sequence of the aptamer is shown as SEQ ID No. 1.
2. The aptamer according to claim 1, wherein the aptamer is modified at the 5 'end and/or 3' end with a modifier.
3. The aptamer according to claim 2, wherein the modifier comprises a fluorescent label, a biotin label, a drug label or a chemical group label.
4. The aptamer according to claim 1, wherein the liver cancer cells specifically bound by the aptamer comprise HepG2, SMMC7721 or HCC-LM 3.
5. The aptamer according to any one of claims 1 to 4, wherein the aptamer is artificially synthesized or derived from any other source and has a sequence shown as SEQ ID No. 1.
6. The aptamer according to claim 5, wherein the artificial synthesis comprises in vitro chemical synthesis or molecular biological synthesis.
7. The aptamer according to claim 6, wherein the molecular biological synthesis is PCR synthesis.
8. The aptamer according to claim 7, wherein the PCR synthesis is an asymmetric PCR synthesis.
9. A method for detecting hepatoma cells for non-diagnostic and therapeutic purposes, wherein an aptamer according to any of claims 1 to 8 is used.
10. The method according to claim 9, characterized in that it comprises the steps of: synthesizing the aptamer, incubating the sample with the aptamer, and detecting binding of the sample to the aptamer.
11. The method of claim 10, wherein the sample comprises a cell or tissue section.
12. Use of the aptamer binding to hepatoma cells according to any of claims 1 to 8 for tumor research for non-diagnostic and therapeutic purposes or for the preparation of a kit for detecting hepatoma cells.
13. A drug or probe targeting a hepatoma cell comprising the aptamer binding to a hepatoma cell of any of claims 1 to 8.
CN201810082398.6A 2018-01-26 2018-01-26 Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer Expired - Fee Related CN108239646B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810082398.6A CN108239646B (en) 2018-01-26 2018-01-26 Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810082398.6A CN108239646B (en) 2018-01-26 2018-01-26 Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer

Publications (2)

Publication Number Publication Date
CN108239646A CN108239646A (en) 2018-07-03
CN108239646B true CN108239646B (en) 2020-06-12

Family

ID=62698708

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810082398.6A Expired - Fee Related CN108239646B (en) 2018-01-26 2018-01-26 Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer

Country Status (1)

Country Link
CN (1) CN108239646B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110408620B (en) * 2019-08-16 2023-03-21 中山大学附属第三医院 Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof
CN110564731B (en) * 2019-09-02 2023-04-14 湖南大学 Aptamer and detection kit for detecting human drug-resistant hepatoma cell strain HepG2/ADM

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101942445A (en) * 2010-07-19 2011-01-12 谭蔚泓 Nucleic acid aptamer derivative and application thereof in preparation of medicament carrier
CN102766693A (en) * 2012-07-25 2012-11-07 湖南大学 Nucleic acid aptamer for detecting human hepatoma cell line SMMC-7721 as well as screening method and application thereof
CN103374573A (en) * 2012-04-28 2013-10-30 复旦大学附属华山医院 Hepatoma cell aptamer sequence and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101942445A (en) * 2010-07-19 2011-01-12 谭蔚泓 Nucleic acid aptamer derivative and application thereof in preparation of medicament carrier
CN103374573A (en) * 2012-04-28 2013-10-30 复旦大学附属华山医院 Hepatoma cell aptamer sequence and application thereof
CN102766693A (en) * 2012-07-25 2012-11-07 湖南大学 Nucleic acid aptamer for detecting human hepatoma cell line SMMC-7721 as well as screening method and application thereof

Also Published As

Publication number Publication date
CN108239646A (en) 2018-07-03

Similar Documents

Publication Publication Date Title
CN102498211B (en) Nucleic acid aptamer specifically binding to pancreatic cancer cells or tissues and use thereof
US9376679B2 (en) Microvesicles carrying small interfering RNAs, preparation methods and uses thereof
CN109072240A (en) Use the composition and method of piRNA diagnosing and treating cancer
Cao et al. A DNA aptamer with high affinity and specificity for molecular recognition and targeting therapy of gastric cancer
US20220073921A1 (en) Aptamer and use of the aptamer in the diagnosis and treatment of cancer
CN107868786B (en) Single-stranded DNA aptamer of multidrug resistant colon cancer cell
CN112567034A (en) micro-RNA-based therapy for LCP-1 positive cancers
CN111278469A (en) Methods for treating triple negative breast cancer
CN108239646B (en) Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer
CN107250378A (en) Diagnosis, prevention and the treatment method of the brain metastes of cancer and for the drug delivery system by blood-brain barrier
CN106714811A (en) Anti-tumor compositions and methods
CN106032534B (en) A kind of rna aptamer and its screening technique in conjunction with Non-small cell lung carcinoma cell-specific
CN112779261B (en) Aptamer combined with human B7-H4 protein, application thereof and detection method using aptamer
Li et al. Selection of CD133-targeted DNA aptamers for the efficient and specific therapy of colorectal cancer
US11319541B2 (en) Anticancer therapeutic intervention
Yu et al. Exosomes derived from pulmonary metastatic sites enhance osteosarcoma lung metastasis by transferring the miR-194/215 cluster targeting MARCKS
CN116367863A (en) Aptamer penetrating blood brain barrier and application thereof
CN114410636A (en) Improved AS1411 aptamers and EVs conjugated therewith
CN112771165A (en) Aptamer capable of passing blood brain barrier and application thereof
CN104189920A (en) Gene composition h-R3/PAMAM siRNA for reversing multidrug resistance of tumors and application of gene composition
US10835551B2 (en) Double-stranded nucleic acid molecule, DNA, vector, cancer cell growth inhibitor, cancer cell migration inhibitor, and drug
US20230310617A1 (en) Microrna oligonucleotide therapeutics for ovarian cancer
WO2022160374A1 (en) Aptamer that targets cd206-positive cells, and application thereof
US20220175935A1 (en) RNA Aptamers and Uses Thereof
CN101821410A (en) Gene silencing of the brother of the regulator of imprinted sites (BORIS)

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200612