CN105368849A - Lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with function of stress resistance and application of lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with function of stress resistance - Google Patents

Abstract

The invention relates to a lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with a function of stress resistance and application of the lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with the function of stress resistance. A nucleotide sequence of the lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene is shown as SEQ ID No.1. A total RNA (ribonucleic acid) of fresh lycium leaves is extracted, and a lycium cytoplasm ascorbate peroxidase gene LmNCED1 is cloned according to a strategy of homology-based cloning and a 3'RACE technology to obtain an intact coding DNA (deoxyribonucleic acid) sequence 1827bp. An escherichia coli expression vector pGEX-4T-1-LmNCED1 is constructed, and activity of enzymes coded by the cloned lycium cytoplasm ascorbate peroxidase gene LmNCED1 is identified by an escherichia coli heterogenous expression system. Further, a binary plant expression vector pCAMBIA2300-LmNCED1 is constructed, the vector is transferred into an agrobacterium C58 cell according to an electroporation method, and the cell is adopted for tobacco transgene to obtain transgenic tobaccos which are used for subsequent transgene research.

Description

There is matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene and the application of degeneration-resistant function

Technical field

The present invention relates to there is degeneration-resistant function a kind of matrimony vine ( lyciumchinensemiller) clone of 9-cis epoxy carotenoid dioxygen synthase gene (Nine-cis-epoxy-carotenoiddioxygenaseenzyme) in cytolemma, be specially can improve the function medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase genes such as plant stress-resistance ( nCED1) and application.

Background technology

Carotenoid in Plants 9-cis epoxy carotenoid dioxygen synthase ( nCED) can catalytic pyrolysis 9-cis Neoxanthine (9-cis-neoxanthin) and 9-cis zeaxanthin diepoxide (9-cis-violaxanthin) 11,12 and 11 ', 12 ' double bond, generate the precursor substance C15 xanthoxin (xanthoxin) of dormin (ABA), xanthoxin is further converted to dormin (Endoetal.,, and dormin is important plant hormone 2008).

nCEDfind in corn viviparous14 (vp14) mutant at first, this mutant endogenous aba content is very low, pore can not normally be closed, plant wither, present ABA and synthesize defective type (Schwartzetal., 1997), because mutant gene products Vp14 is a dioxygen synthase, can catalytic pyrolysis two 9-cis epoxidation carotenoid, therefore named nCED. nCEDcatalysis 9-cis zeaxanthin diepoxide and the cracking of 9-cis Neoxanthine form xanthoxin (xanthoxin) and a C of C15 ₂₅by product (Schwartz, 1997).After scission reaction, xanthoxin is transported in tenuigenin from plastid, under the effect of tenuigenin enzyme, be converted into ABA, and in cell-free extract, xanthoxin is converted into the participation that ABA needs cofactor NAD and NADP.

Abiotic stress such as arid etc. all can promote nCEDmRNA and the expression level of corresponding NCED albumen, the content of ABA also increases sharply simultaneously, proves nCEDplay an important role in ABA biosynthesizing and environmental response.Luchietal. (2001) are reported in Arabidopsis leaf, atNCED3it is main stress inducible gene.And in cowpea blade, drought stress can the expression of induced strong VuNCED1 gene, although vuNCED1the abduction delivering of gene is a little earlier in the accumulation of ABA.Drought stress also can inducing maize, Kidney bean and tomato nCEDexpression (Burbidgeetal., 1997 of gene; QinandZeevaart, 1999; Schwartzetal., 1997).Ren Huibo etc. (2008) report, atNCED3successive induction be the prerequisite that ABA stablizes accumulation, arid can be induced atNCED3genetic expression, atNCED3the persistent accumulation being in abduction delivering state and ABA accompanies, and proves further nCEDplay an important role in ABA biosynthesizing and environmental response.Can find after excised leaf or Osmotic treatment 15-30min nCEDtranscriptional level significantly increases (QinandZeevaart, 1999; Thompsonetal., 2000), show nCEDit is quite rapidly that gene works.Under osmotic stress, use NCED enzyme competitive inhibitor AbamineSG, can obviously suppress pea ( pisumsativum) and Arabidopis thaliana in the biosynthesizing of ABA, obviously reduce ABA content (Kitahataetal., 2006) in plant materials, also show nCEDsin ABA biosynthesizing, there is keying action.At present nCEDgene is cloned multiple plant; such as tomato (Burbidgeetal., 1997), Kidney bean (QinandZeevaart1999), cowpea (Iuchietal., 2000), avocado (ChernysandZeevaart; 2000), Arabidopis thaliana (Iuchietal., 2001; Tanetal., 2003) etc.

nCEDgene comprises a little gene family, in Arabidopis thaliana, found 5 nCEDgene, is all positioned in plastid film.Higher plant nCEDthe reaction of catalysis is committed step in the biosynthesizing of ABA, overexpression nCED1all cause the increase of transgenic plant endogenous aba content.In potato, stNCEDaBA content in the process LAN of gene and potato meristematic tissue and potato peel has dependency ((Destefano-Beltr á netal., 2006)).Kidney bean is expressed in tobacco pvNCED1gene, in tobacco, ABA content has been enhanced 3.5 times, improves the drought resistance (xiaoqiongqinetal., 2002) of plant simultaneously.The NCED gene of tomato is expressed in tomato and tobacco, also can excessive generation ABA, also show on live plant nCEDduring genetic expression and ABA produce, there is high consistency.Process LAN cowpea in creeping bentgrass vuNCED1gene, endogenous ABA significantly increases, and transgenic plant significantly increase the viability under arid and NaCL are coerced.

ABA biosynthesizing is generally through two approach: C ₁₅direct way and C ₄₀degradation pathways (Zeeva-art, 1999).C ₁₅approach, namely three isopentene units are polymerized 15 cis farnesyl pyrophosphate (Farnesyulpyrophosphate, FPP), more directly synthesize C by FPP through cyclisation and oxidation ₁₅cis ABA, this approach mainly occurs in (CreelmanandZeevaart, 1984) in some fungies; C ₄₀approach is the main path that higher plant ABA synthesizes, and namely first aggregates into C by mevalonic acid (Mevalonicacid, MVA) ₄₀precursor--carotenoid, then the compound xanthoxin (Xanthoxin, XAN) being cracked into C15 by carotenoid, be finally transformed into ABA by XAN.

ABA is a Plant Hormone, and it plays an important role in the dormancy of the growth of regulating plant, growth, seed and plant are to the adaptation of environment stress.And utilize nCEDgene can improve the resistance of various plants, reports to some extent in various kinds of document, current existing various plants nCEDgene is cloned.Due to nCEDgene energy improving plant growth is grown and is resisted the vital role such as abiotic stress, has therefore become a focus in current plant improvement research.

Summary of the invention

The object of the present invention is to provide a kind of medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene.

Second object of the present invention is to provide the protein of this genes encoding.

The present invention also aims to provide the recombinant vectors containing this gene and host cell.

Another object of the present invention is the purposes providing this gene.

The invention provides a kind of medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene ( lmNCED1), the nucleotide sequence as shown in SEQ ID NO.1 is formed.

The invention provides a kind of above-mentioned medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1the protein of coding, the protein of the aminoacid sequence as shown in SEQ ID NO.2.

The invention provides a kind of above-mentioned medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1recombinant cloning vector pMD18-T- lmNCED1.

The invention provides a kind of above-mentioned medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1recombinant plant expression vector pCAMBIA2300- lmNCED1.

Containing above-mentioned medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1recombinant vectors, these recombinant vectorss comprise plasmid.

Described plasmid expression vector coli expression carrier pGEX-4T-1- lmNCED1.

Described plasmid expression vector binary plant expression vector pCAMBIA2300- lmNCED1.

Containing above-mentioned medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1the host cell of complete coding reading frame sequence, as the host cell containing above-mentioned recombinant vectors also belongs to protection scope of the present invention.

Described host cell is selected from Bacillus coli cells, agrobatcerium cell or tobacco cell.

The invention provides one to contain lmNCED1genetic engineering bacterium.

Above-mentioned medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1application, comprise this lmNCED1the application of albumen in intestinal bacteria and plant of genes encoding; With described recombinant vectors, as plant expression vector maize transformation cell; Or by the described Agrobacterium and corn, soybean, Sunflower Receptacle, potato, cotton, millet, barley and the co-culture of cells such as flowers and vegetables that contain this gene, obtain genetically modified regeneration plant; Or obtain above-mentioned species transfer-gen plant with described LmNCED1 genetic transformation.

A kind of medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene provided by the invention lmNCED1, the nucleotide sequence as shown in SEQ ID NO.1, also comprises shown nucleotide sequence and add, replace, insert or delete more than 70% homologous sequence of one or more Nucleotide or its allelotrope and derivative nucleotide sequence thereof.

A kind of medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene provided by the invention lmNCED1the albumen of coding, aminoacid sequence as shown in sequence table SEQ IDNO.2.

Cloning process of the present invention is made up of following step:

Total serum IgE is extracted, according to the conserved nucleotide sequence of tomato (Z97215) listed in NCBI, potato (AJ276244), tobacco (JX101472), respectively from 5 ' end and middle conservative region design upstream degenerated primer from matrimony vine blade nCED1-JF:5 '-ATGGCMACTACTTCTTCTCCTGCTAC-3 ' and middle specific upstream primer NCED1-BF:5 '-ATCCTGTTTCAGGGGAGCTT-3 '.Middle special upstream primer nCED1-BF and 3'RACE test kit middle and lower reaches Outer primer utilize RACE technology to increase to obtain it 3 ' to hold end full length sequence; Simultaneously according to acquired 3 ' terminal sequence design downstream specific primer, obtained by pcr amplification lmNCED1the full length sequence of gene.

The present invention builds containing medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1coli expression carrier pGEX-4T-1- lmNCED1, be made up of following step:

build containing matrimony vine 9-cis-epoxy carotenoid dioxygen synthase gene lmNCED1intermediate carrier pMD-18T- lmNCED1:

Design is by upstream primer the P1(P1:5 '-ATGGCAACTACTTCTTCTCCTGC-3 ' shown in SEQIDNO.3), with by downstream primer the P2(P2:5 '-TTAGGCCTGATTTGCCAAGTC-3 ' shown in SEQIDNO.4), with matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene lmNCED1cDNA be template, carry out pcr amplification, pcr amplification product be connected to pMD18-T carrier, to obtain containing shown in SEQ ID NO.1 lmNCED1the intermediate carrier pMD18-T-of gene lmNCED1.

build coli expression carrier pGEX-4T-1- lmNCED1:

Design is by upstream primer the P3(P3:5 '-CGCGGATCCATGGCAACTACTTCTTCTCCTGC-3 ' shown in SEQIDNO.5), with by downstream primer the P4(P4:5 '-CCGCTCGAGTTAGGCCTGATTTGCCAAGTC-3 ' shown in SEQIDNO.6), with plasmid pMD18-T- lmNCED1for template, carry out pcr amplification, by pcr amplification product warp bamHi and xholafter I enzyme is cut, by coli expression carrier pGEX-4T-1 warp bamHi and xholi double digestion, the two carries out ligation, obtains coli expression carrier pGEX-4T-1- lmNCED1.

The invention provides a kind of recombinant vectors of matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene and host cell and application, the global cDNA of coding 9-cis epoxy carotenoid dioxygen synthase gene is isolated first from matrimony vine, be connected on coli expression carrier, utilize heterogenous expression system verification matrimony vine lmNCED1gene has the activity of enzyme at the product of protein expression.

The present invention, by extracting fresh matrimony vine blade total serum IgE, has cloned matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene by 3'-RACE technology lmNCED1, obtaining complete coding gene sequence is 1827bp.Construct coli expression carrier pGEX-4T-1- lmNCED1, to the matrimony vine 9-cis-epoxy carotenoid dioxygen synthase gene of clone lmNCED1the enzymic activity of coding is identified, by recombinant protein heterogenous expression in intestinal bacteria of pGEX-4T-1 Prokaryotic expression vector construction.Construct binary plant expression vector pCAMBIA2300-simultaneously lmNCED1, carrier is proceeded to Agrobacterium C58 cell by electric shocking method, with this cell transformation tobacco, obtains transgene tobacco, for follow-up research.It is for the preparation of transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, potato, cotton, millet, barley and flowers and vegetable plant strain.

Accompanying drawing explanation

Fig. 1 pMD18-T- lmNCED1carrier schematic diagram.

Fig. 2 pGEX-4T-1- lmNCED1carrier schematic diagram.

Fig. 3 pGEX-4T-1- lmNCED1digestion verification result.

Fig. 4 LmNCED1 recombinant protein is at expression in escherichia coli result figure, and the HPLC of (a) cis Neoxanthine content schemes (b) cis Neoxanthine and produced C by LmNCED1 proteolytic degradation ₂₅compound, i.e. C ₂₅the HPLC figure of-allenic-apo-aldehyde content.

Fig. 5 is lmNCED1neoxanthine (Neoxanthin) and zeaxanthin diepoxide (Violaxanthin) are degraded to the biosynthetic precursor substance xanthoxin (Xanthoxin) of ABA by recombinant protein, and xanthoxin generates the process of dormin (ABA) further.

Fig. 6 pCAMBIA2300- lmNCED1carrier schematic diagram.

Fig. 7 pCAMBIA2300- lmNCED1digestion verification result.

Fig. 8 is lmNCED1gene successfully proceeds to tobacco result.

Embodiment

The invention will be further elaborated, the experimental technique of unreceipted actual conditions in embodiment, usually conveniently condition and the condition described in handbook, or according to the condition that manufacturer advises.

Embodiment 1

Matrimony vine 9-cis-epoxy carotenoid dioxygen synthase gene lmNCED1clone:

With RNeasyPlantMiniKit(QIAGEN, German) test kit, from the fresh matrimony vine blade of 100mg, extract TotalRNA, the conserved nucleotide sequence according to tomato (Z97215) listed in NCBI, potato (AJ276244), tobacco (JX101472) designs upstream degenerated primer from 5 ' end and middle portion respectively nCED1-JF:5 '-ATGGCMACTACTTCTTCTCCTGCTAC-3 ' and middle specific upstream primer nCED1-BF:5 '-ATCCTGTTTCAGGGGAGCTT-3 '.Utilize 3'-FULLRACECoreSetVer.2.0(TaKaRa, Japan) test kit amplification obtain complete gene order.Concrete steps:

1. be template with TotalRNA, use 3'RACEAdaptor primer to carry out reverse transcription reaction, synthesis 1stStrandcDNA, reaction system is as follows:

RNA：2μl

3'RACEAdaptor：1μl

5×M-MLVBuffer：2μl

2.5mMdNTPMixture：1μl

RNaseInhibitor：0.25μl

ReverseTranscriptaseM-MLV：0.25μl

RNaseFreedH2O：3.5μl

Reaction conditions: 42 DEG C, 60min; 70 DEG C, 15min.

2. according to downstream primer the 3'RACEoutprimer:5 '-TACCGTCGTTCCACTAGTGATTT-3 ' that upstream primer and the test kit of gene provide, take 1stStrandcDNA as template, carry out PCR reaction, reaction system is as follows:

1stPCR product: 1 μ l

2.5mMdNTPMixture：2μl

APX-BF：0.5μl

3'RACEoutprimer：0.5μl

10×LAPCRBuffer：2.5μl

TaKaRaLATaq：0.25μl

ddH ₂O：18.25μl

Totalvolume25μL

Reaction conditions: 94 DEG C, 4min; 94 DEG C, 30sec; 55 DEG C, 30sec; 72 DEG C, 1min; 72 DEG C, 8min, 30 circulations.

according to acquired 3 ' terminal sequence design downstream specific primer P2.Take 1stStrandcDNA as template, be upstream and downstream primer with 5 ' terminal specific primer P1 and 3 ' terminal specific primer P2, carry out PCR reaction, the total length of amplification gene.Reaction system is as follows:

1stPCR product: 1 μ l

2.5mMdNTPMixture：4μl

P1：1μl

P2：1μl

10×LAPCRBuffer：5μl

TaKaRaLATaq：0.5μl

ddH ₂O：37.5μl

Totalvolume50μL

Reaction conditions: 94 DEG C, 4min; 94 DEG C, 30sec; 52 DEG C, 30sec; 72 DEG C, 2min; 72 DEG C, 8min, 30 circulations.

Embodiment 2

Cloning vector pMD18-T- lmNCED1building process

By shown in sequence table lmNCED1gene is connected with pMD18-T carrier, and reaction system is as follows:

Object PCR fragment: 4 μ l

PMD18-T carrier: 1 μ l

SolutionI：5μl

Reaction conditions: 16 DEG C, 30min.Connect product conversion e.ColitOP10, the LB coated containing Amp resistance is dull and stereotyped.Be that primer carries out PCR(reaction conditions with goal gene: 94 DEG C, 4min; 94 DEG C, 30sec; 55 DEG C, 30sec; 72 DEG C, 2min; 72 DEG C, 8min, 30 circulations.) obtaining PCR primer, electrophoretic band is correct, and then send Hua Da genome company to check order, sequencing result carries out Blast in NCBI, is indicated as this gene.

Embodiment 3

Coli expression carrier pGEX-4T-1- lmNCED1building process

First, with pMD18-T- lmNCED1for masterplate, P3 and P4 is respectively upstream and downstream primer high-fidelity Pfu enzymatic amplification lmNCED1gene, its reaction conditions is 94 DEG C, 4min; 94 DEG C, 30sec; 57 DEG C, 30sec; 72 DEG C, 2min; 72 DEG C, 8min, 30 circulations.Introduce in P3 bamHi restriction enzyme site (CGCGGATCC), introduces in P4 xholi restriction enzyme site (CCGCTCGAG).Then, PCR primer and pGEX-4T-1 plasmid warp respectively bamHi and xholi double digestion, connects the two digestion products: 22 DEG C, 2hrs, connects (2 μ l carrier DNAs, 5 μ l foreign DNAs, 2 μ l5 × T4buffer, 1 μ lT4DNA ligase enzyme).Connect product conversion e.colibL21 (DE3) competent cell, the LB coated containing ammonia benzyl is dull and stereotyped.Be that primer carries out PCR and obtains about about 1827bp product band with goal gene, enzyme is cut qualification and is obtained object band (swimming lane 3 is pGEX-4T-1-as shown in Figure 3 nCED1enzyme is cut), finally send Hua Da gene sequencing company to check order, result shows vector pGEX-4T-1- lmNCED1build correct.

Embodiment 4

lmNCED1the functional verification of gene in intestinal bacteria

(1) lmNCE1abduction delivering in BL21, concrete steps are:

recombinant vectors pGEX-4T-1- lmNCED1transform BL21 competent cell, picking list bacterium colony, 37 DEG C of incubated overnight;

bacterium liquid is pressed l/20 dilution proportion, and 200ml bacterium liquid is in 37 DEG C, and 200rpm is cultured to OD ₆₀₀=0.6, take out lml bacterium liquid and be stored in 4 DEG C in contrast;

adding IPTG(final concentration is lmmol/L) in 17 DEG C of abduction delivering 12h.

4. 4 DEG C of centrifugal (5000g) collecting cells, washing, suspends with damping fluid (100mMTris-HCl, pH8.0,5mMMgCl2,5%glycerol, 0.1mMphenylmethylsulfonylfluoride, 0.1mM dithiothreitol (DTT)).

5. adopt ultrasonic disruption cell, 4 DEG C of broken 30min of 30000g, with 0.22 μm of membrane filtration supernatant, be then stored in-20 DEG C for subsequent use.

6. the Neoxanthine of 250 μ g and 0.025gTween40, with 5mL0.1mol/Lbis-trisbuffer (pH7.0).Reaction mixture adds 600 μ l substrate solutions, 500 μ l supernatant liquors, 150 μ l50 μm ol/LFeSO ₄, 150 μ l10mmol/LDTT, 0.1mol/Lbis-tris regulate pH to be 7.0.Final volume is 1.5mL.30 DEG C of reaction 3h.

7. reaction product adopts HPLC to analyze, and illustrates that NECD1 albumen can effectively be degraded the Neoxanthine of 40 carbon, and produces the degraded product of one 25 carbon.

Embodiment 5

Binary plant expression vector pCAMBIA2300- lmNCED1structure and transformation Agrobacterium engineering strain C58.

With pMD18-T- lmNCED1for masterplate, P3 and P5(5 '-AAAACTGCAGTTAGGCCTGATTTGCCAAGTC-3 '

) be respectively upstream and downstream primer high-fidelity Pfu enzymatic amplification lmNCED1gene, its reaction conditions is 94 DEG C, 4min; 94 DEG C, 30sec; 57 DEG C, 30sec; 72 DEG C, 2min; 72 DEG C, 8min, 30 circulations, obtain lmNCED1total length.Then lmNCED1with pCAMBIA2300 empty carrier plasmid warp respectively bamHi and psti double digestion, the enzyme system of cutting is: 60 μ l plasmids, 2 μ l bamHi restriction endonuclease, 2 μ l psti restriction endonuclease, 20 μ l10 × FastDigestBuffer, 116 μ lddH ₂o ₂, reaction conditions is 37 DEG C, 2hrs.Cut glue respectively and reclaim object fragment lmNCED1with carrier segments pCAMBIA2300, then the two connected, linked system is with embodiment 3.Connect product conversion e.Coli.tOP10, the LB coated containing 100mg/L concentration kalamycin resistance is dull and stereotyped.Positive colony is correct through digestion verification, as shown in Figure 7 (swimming lane 2 is 2300-NCED cleavage map).The pCAMBIA2300-successfully constructed lmNCED1by bacterium colony PCR, carrier, by electroporated Agrobacterium engineering bacteria C58, verifies that correct positive transformant is stored in-80 DEG C, for follow-up plant transgene.

Embodiment 6

The preparation of Agrobacterium competent cell and electric conversion process

(1) agrobacterium tumefaciens C58 is activated, draw plate, cultivate after 2 days for 28 DEG C and grow mono-clonal.Picking mono-clonal is inoculated in 10mlYEP liquid nutrient medium, and 28 DEG C of shaking culture are to logarithmic phase 0D ₆₀₀=0.5.

(2) the centrifugal 10min of ice bath 30min, 5000rpm, collects thalline.And the HEPES/KOH of ice-cold 1mmol/L (pH7.0) solution is resuspended, and repeat above step 2 ~ 3 time.

(3) Agrobacterium is resuspended in 10% glycerine of 20ml precooling, is distributed in the 1.5ml centrifuge tube that often pipe 100 μ l is precooled, liquid nitrogen flash freezer, be stored in-80 DEG C for subsequent use.

Electroporated process (operating on ice)

(1) 1 μ l plasmid (about 100ng) is added to containing in 100 μ l competence Agrobacteriums, gently ice bath 5min after mixing

(2) transfer to (electric shock cup diameter model is 1mm) in the electric shock cup of ice precooling, electroporated.Electric shock condition is: 1.5KV, 200 Ω, 25 μ F.

(3) add 0.5ml immediately not containing antibiotic YEP substratum, 28 DEG C of 150rpm, cultivate 2 ~ 4h.

(4) the bacterium liquid directly got after 50 μ l conversions is coated on the YEP flat board containing kantlex, 28 DEG C of light culture 2 ~ 3d.Picking list bacterium colony is bacterium colony PCR and verifies positive colony.

Embodiment 7

Agriculture bacillus mediated tobacco genetic transformation

The substratum that this experiment is used:

Aseptic seedling culture base: MS solid medium, pH5.8;

Infect substratum: MS liquid nutrient medium, pH5.8;

Train substratum altogether: MS+1mg/L6-BA+0.1mg/LNAA

De-bacterium screening culture medium: the cephalo of MS+1mg/L6-BA+0.1mg/LNAA+100mg/L kantlex+400mg/L

Mycin, pH5.8;

Resistance seedling rooting substratum: the cephamycin of MS+100mg/l kantlex+400mg/l, pH5.8;

the sterile culture of tobacco seedling: select full, healthy tobacco seed, with 75% alcohol immersion lmin, peace tiformin (available chlorine 2.5%) aqueous solution sterilizing 8min of 25%, rinsed with sterile water three times, be placed on by seed in MS substratum, 25 DEG C of light are cultivated, the 16h/8h photoperiod.

the Agrobacterium-mediated Transformation of tobacco

infect the preparation of bacterium liquid

The single bacterium colony of the positive Agrobacterium of picking, is inoculated into 5ml containing in the YEP liquid nutrient medium of 100mg/L kantlex, in 28 DEG C, the shaker overnight of 200r/min cultivates.

next day, get 3ml bacterium liquid, be inoculated in the 50mlYEP liquid nutrient medium containing 100mg/L kantlex, when bacterium liquid is in vigorous period (OD ₆₀₀=0.6-0.9) time, bacterium liquid is moved into 50ml centrifuge tube, and at 3500r/min, at 4 DEG C, centrifugal 15min, abandons supernatant liquor, collects thalline.

resuspended with the MS liquid nutrient medium of equivalent, make OD ₆₀₀=0.9-1.

explant is contaminated

tobacco leaf is removed master pulse and limb edge, then blade is cut into 0.5 × 0.5cm size, immerse the Agrobacterium bacterium liquid prepared, soak 15-20min, shake 2-3 time therebetween, make blade fully contact bacterium liquid, take out blade, the bacterium liquid exhausting unnecessary with aseptic filter paper, blade face down, blade back is inoculated in common training substratum upward, about 25 DEG C light culture 2 days.

be transferred to by blade in screening culture medium, within about 20 days, change a subculture, induction of resistance bud produces, and when resistant buds grows to about 1cm from callus, cuts resistant buds from callus, is inoculated in resistance seedling rooting substratum.

transgenic seedling is transplanted

The tobacco tissue cultured seedling that root growth is good, vitality is vigorous takes out from tissue culture bottle, with tap water substratum (reducing root system damage) as far as possible, be planted in Nutrition Soil: vermiculite: in the compost of perlite=4:5:1, coating film heat and moisture preserving 15 days, then film is opened, regularly water, apply fertilizer, make it normal growth in greenhouse.

the PCR of transgene tobacco genomic dna detects

cTAB method extracts tobacco STb gene;

be that template performing PCR detects with genomic dna, primer is P3, P4, reaction conditions: 94 DEG C, 4min; 94 DEG C, 30sec; 55 DEG C, 30sec; 72 DEG C, 2min; 72 DEG C, 8min, 30 circulations.

Get above-mentioned PCR primer 5 μ l and carry out electrophoresis detection, Fig. 8 explanation lmNCED1gene successfully proceeds to tobacco.

Sequence table

<110> University Of Tianjin

<120> has a kind of matrimony vine 9-cis epoxy carotenoid dioxygen synthase and the application of degeneration-resistant function

<130>20131116

<160>6

<170>PatentInversion3.3

<210>1

<211>1827

<212>DNA

<213> is manually serial

<220>

<221>gene

<222>(1)..(1827)

<400>1

atggcaactacttcttctcctgctacaaatacatggattaaacccaagatatcaatgcca60

tcatcaagagagtttggtcattcttcaaactctatttcactactcaaaaacaagcctaat120

aaaatcacttgctctcttcaagctccacctattctccatttccctaaacaacaatcttca180

aattatcaaacgcctaaaaccaataccattcccacttcaaaaccaaccacaaaaatctca240

catccaaagcaagaaaataaatcctcctcttcttctcctttgaatttagtacaaaaagca300

gcagcaatggctttagatgctgtagaaagtgttttaacaaaacacgaacttgaacaccct360

ttaccaaaaacagctgatccacgtgtccaaatttccggtaacttcgctccggtacctgaa420

aatccagtcactcaatcacttccggtcaccggaaaaataccaaaatgtgttaacggtgta480

tacgttcgtaacggagctaacccgttattcgaaccaacagctggtcaccatttctttgat540

ggcgatggtatggtacatgctgttcaattcaaaaacggatcagcaagttacgcttgccgt600

ttcactgaaactgaaagattggttcaagagaaagctttgggtcgacctgtttttccaaaa660

gccattggtgaattacatggtcattctggtattgcaaggcttatgttgttttatgcacgt720

ggtgtttttggtcttgttgatcatagtaacggaactggtgttgctaacgctggtttggtt780

tattttaataaccgtttacttgctatgtctgaagatgatttgccttaccatgttagggta840

acggctaatggtgatcttgaaactgatggaaggttcgatttcgatgggcaattaaaatca900

acaatgatagctcacccgaaacttgatcctgtttcaggggagctttttgctcttagttac960

gatgtgattcagaaaccgtatttgaagtacttcaggttttcaaaaaacggggagaaatct1020

aatgatgttgagattcctgttgaagacccaacaatgatgcatgatttcgcgataacggag1080

aaattcgttgttattcctgatcaacaagttgtgttcaagatgtctgaaatgatccgtgga1140

ggttcacctgttgtttatgacaagaacaaagtttcaagatttgggattttggataagtat1200

gctaaagatggatcaggtttgaaatgggttgaagtgcctgattgtttttgtttccattta1260

tggaatgcttgggaagagccggaaactgatgaacttgtggtgattggttcatgtatgaca1320

ccacctgactcaatttttaacgaatgtgatgagggattagagagtgttttatcagaaatt1380

cggctcaatttgaaaactggaaaatcaacaagaaaggctcttattcaaaacgaagaagaa1440

caggtgaatttagaagcaggaatggtgaacaggaacaaacttgggagaaaaacgcagtat1500

gcatatttggctattgcagaaccatggccaaaagtttctggttttgccaaagtagacctt1560

tttacaggtgaaattaacaagttcttttatggtgacaacaagtatggcggggagcctctt1620

tttttaccaagagacccaaacagcaaagatgaagatgatggttacattttagcttttgtg1680

catgatgagaaagaatggaaatcagagctgcaaattgttaatgcaatgaccttaaagtta1740

gaggccacagtgaaacttccatcaagagtcccttatggttttcatggaactttcataaat1800

gccaaagacttggcaaatcaggcctaa1827

<210>2

<211>608

<212>PRT

<213> is manually serial

<400>2

MetAlaThrThrSerSerProAlaThrAsnThrTrpIleLysProLys

151015

IleSerMetProSerSerArgGluPheGlyHisSerSerAsnSerIle

202530

SerLeuLeuLysAsnLysProAsnLysIleThrCysSerLeuGlnAla

354045

ProProIleLeuHisPheProLysGlnGlnSerSerAsnTyrGlnThr

505560

ProLysThrAsnThrIleProThrSerLysProThrThrLysIleSer

65707580

HisProLysGlnGluAsnLysSerSerSerSerSerProLeuAsnLeu

859095

ValGlnLysAlaAlaAlaMetAlaLeuAspAlaValGluSerValLeu

100105110

ThrLysHisGluLeuGluHisProLeuProLysThrAlaAspProArg

115120125

ValGlnIleSerGlyAsnPheAlaProValProGluAsnProValThr

130135140

GlnSerLeuProValThrGlyLysIleProLysCysValAsnGlyVal

145150155160

TyrValArgAsnGlyAlaAsnProLeuPheGluProThrAlaGlyHis

165170175

HisPhePheAspGlyAspGlyMetValHisAlaValGlnPheLysAsn

180185190

GlySerAlaSerTyrAlaCysArgPheThrGluThrGluArgLeuVal

195200205

GlnGluLysAlaLeuGlyArgProValPheProLysAlaIleGlyGlu

210215220

LeuHisGlyHisSerGlyIleAlaArgLeuMetLeuPheTyrAlaArg

225230235240

GlyValPheGlyLeuValAspHisSerAsnGlyThrGlyValAlaAsn

245250255

AlaGlyLeuValTyrPheAsnAsnArgLeuLeuAlaMetSerGluAsp

260265270

AspLeuProTyrHisValArgValThrAlaAsnGlyAspLeuGluThr

275280285

AspGlyArgPheAspPheAspGlyGlnLeuLysSerThrMetIleAla

290295300

HisProLysLeuAspProValSerGlyGluLeuPheAlaLeuSerTyr

305310315320

AspValIleGlnLysProTyrLeuLysTyrPheArgPheSerLysAsn

325330335

GlyGluLysSerAsnAspValGluIleProValGluAspProThrMet

340345350

MetHisAspPheAlaIleThrGluLysPheValValIleProAspGln

355360365

GlnValValPheLysMetSerGluMetIleArgGlyGlySerProVal

370375380

ValTyrAspLysAsnLysValSerArgPheGlyIleLeuAspLysTyr

385390395400

AlaLysAspGlySerGlyLeuLysTrpValGluValProAspCysPhe

405410415

CysPheHisLeuTrpAsnAlaTrpGluGluProGluThrAspGluLeu

420425430

ValValIleGlySerCysMetThrProProAspSerIlePheAsnGlu

435440445

CysAspGluGlyLeuGluSerValLeuSerGluIleArgLeuAsnLeu

450455460

LysThrGlyLysSerThrArgLysAlaLeuIleGlnAsnGluGluGlu

465470475480

GlnValAsnLeuGluAlaGlyMetValAsnArgAsnLysLeuGlyArg

485490495

LysThrGlnTyrAlaTyrLeuAlaIleAlaGluProTrpProLysVal

500505510

SerGlyPheAlaLysValAspLeuPheThrGlyGluIleAsnLysPhe

515520525

PheTyrGlyAspAsnLysTyrGlyGlyGluProLeuPheLeuProArg

530535540

AspProAsnSerLysAspGluAspAspGlyTyrIleLeuAlaPheVal

545550555560

HisAspGluLysGluTrpLysSerGluLeuGlnIleValAsnAlaMet

565570575

ThrLeuLysLeuGluAlaThrValLysLeuProSerArgValProTyr

580585590

GlyPheHisGlyThrPheIleAsnAlaLysAspLeuAlaAsnGlnAla

595600605

<210>3

<211>18

<212>DNA

<213> is manually serial

<220>

<221>gene

<222>(1)..(18)

<400>3

atgggtaagtgctatcct18

<210>4

<211>17

<212>DNA

<213> is manually serial

<220>

<221>gene

<222>(1)..(17)

<400>4

gccactactcccaccct17

<210>5

<211>28

<212>DNA

<213> is manually serial

<220>

<221>gene

<222>(1)..(28)

<400>5

cgcggatccatgggtaagtgctatccta28

<210>6

<211>29

<212>DNA

<213> is manually serial

<220>

<221>gene

<222>(1)..(29)

<400>6

acgcgtcgaccacccttcagaatcaccat29

Claims (10)

1. a matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene, is characterized in that this gene is for the nucleotide sequence shown in SEQIDNo.1.

2. the protein of matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene encodes according to claim 1, is characterized in that described protein has the aminoacid sequence shown in SEQIDNo.2.

3. a recombinant vectors, is characterized in that containing matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene complete sequence according to claim 1.

4. a recombinant vectors according to claim 3, is characterized in that it is plasmid expression vector coli expression carrier pGEX-4T-1- LmNCED1.

5. a recombinant vectors according to claim 3, is characterized in that it is the e. coli bl21 of recombinant vectors.

6. a recombinant vectors according to claim 3, is characterized in that it is recombinant plant expression vector pCAMBIA2300- LmNCED1.

7. a host cell, is characterized in that containing medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene complete sequence according to claim 1.

8. a host cell according to claim 7, is characterized in that it is Bacillus coli cells, agrobatcerium cell, tobacco cell, maize cell or soya cells.

9. the cloning process of medlar carotenoid 9-cis epoxy carotenoid dioxygen synthase gene according to claim 1, is characterized in that the step comprised:

One, matrimony vine 9-cis-epoxy carotenoid dioxygen synthase gene lmNCED1clone:

With RNeasyPlantMiniKit test kit, from the fresh matrimony vine blade of 100mg, extract TotalRNA, the conserved nucleotide sequence according to tomato listed in NCBI, potato, tobacco designs upstream degenerated primer from 5 ' end and middle portion respectively nCED1-JF:5 '-ATGGCMACTACTTCTTCTCCTGCTAC-3 ' and middle specific upstream primer nCED1-BF:5 '-ATCCTGTTTCAGGGGAGCTT-3 '; Utilize 3'-FULLRACECoreSetVer.2.0 test kit to increase and obtain complete gene order, concrete steps:

1. be template with TotalRNA, use 3'RACEAdaptor primer to carry out reverse transcription reaction, synthesis 1stStrandcDNA, reaction system is as follows:

RNA：2μl

3'RACEAdaptor：1μl

5×M-MLVBuffer：2μl

2.5mMdNTPMixture：1μl

RNaseInhibitor：0.25μl

ReverseTranscriptaseM-MLV：0.25μl

RNaseFreedH2O：3.5μl

Reaction conditions: 42 DEG C, 60min; 70 DEG C, 15min;

2. according to downstream primer the 3'RACEoutprimer:5 '-TACCGTCGTTCCACTAGTGATTT-3 ' that upstream primer and the test kit of gene provide, take 1stStrandcDNA as template, carry out PCR reaction, reaction system is as follows:

1stPCR product: 1 μ l

2.5mMdNTPMixture：2μl

APX-BF：0.5μl

3'RACEoutprimer：0.5μl

10×LAPCRBuffer：2.5μl

TaKaRaLATaq：0.25μl

ddH ₂O：18.25μl

Totalvolume25μL

Reaction conditions: 94 DEG C, 4min; 94 DEG C, 30sec; 55 DEG C, 30sec; 72 DEG C, 1min; 72 DEG C, 8min, 30 circulations;

according to acquired 3 ' terminal sequence design downstream specific primer P2; Take 1stStrandcDNA as template, be upstream and downstream primer with 5 ' terminal specific primer P1 and 3 ' terminal specific primer P2, carry out PCR reaction, the total length of amplification gene, reaction system is as follows:

1stPCR product: 1 μ l

2.5mMdNTPMixture：4μl

P1：1μl

P2：1μl

10×LAPCRBuffer：5μl

TaKaRaLATaq：0.5μl

ddH ₂O：37.5μl

Totalvolume50μL

Reaction conditions: 94 DEG C, 4min; 94 DEG C, 30sec; 52 DEG C, 30sec; 72 DEG C, 2min; 72 DEG C, 8min, 30 circulations.

10. an application for matrimony vine 9-cis epoxy carotenoid dioxygen synthase gene according to claim 1, is characterized in that it is for the preparation of transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, potato, cotton, millet, barley and flowers and vegetable plant strain.