CN107488669A - The coded sequence of cauliflower BoTLP1 genes and its application in salt-tolerant drought-resistant genetically modified plants are cultivated - Google Patents
The coded sequence of cauliflower BoTLP1 genes and its application in salt-tolerant drought-resistant genetically modified plants are cultivated Download PDFInfo
- Publication number
- CN107488669A CN107488669A CN201710872471.5A CN201710872471A CN107488669A CN 107488669 A CN107488669 A CN 107488669A CN 201710872471 A CN201710872471 A CN 201710872471A CN 107488669 A CN107488669 A CN 107488669A
- Authority
- CN
- China
- Prior art keywords
- salt
- cauliflower
- resistant
- drought
- genetically modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
- C07K14/43—Sweetening agents, e.g. thaumatin, monellin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Botany (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a cauliflowerBoTLP1The coded sequence of gene, and the method using said gene coded sequence cultivation salt-tolerant drought-resistant genetically modified plants, it comprises the following steps：（1）Cauliflower Total RNAs extraction and cDNA synthesis；（2）Band restriction enzyme site design of primers, synthesis；（3）It is overexpressed conversion carrier structure；（4）Genetic transformation；（5）Transgenic positive seedling screens；（6）The degeneration-resistant biological character observation of genetically modified plants.Observation result shows that genetically modified plants have obvious drought resistance and salt tolerance characteristic compared with wild type, can be survived more than 10 days than wild type under the conditions of continuous drought more；Can normal growth under 200 mmol/L salt treatment.The method disclosed by the invention that salt-tolerant drought-resistant genetically modified plants are cultivated using gene coded sequence, there is important value for disclosing the salt-tolerant drought-resistant molecular basis of cauliflower and cultivating high salt-tolerant drought-resistant crop or economic plants using genetic engineering means.
Description
Technical field
The invention belongs to modern molecular biology transgene plant technology field, is related to a cauliflower salt tolerant in biotechnology
Anti-drought geneBoTLP1Coded sequence and its application in salt-tolerant drought-resistant genetically modified plants are cultivated.
Background technology
The soil salinization, arid are the principal elements for causing crop failure or even having no harvest.China is arid and half in the world
The maximum country of dry areas, while there be the saline alkali soil of large area in China, saline alkali land area accounts for national cultivated area
20%.And because the factors such as inwelling cause saline alkali land area further to expand, seriously nibble the limited arable land face in China
Product.Therefore, in order to ensure the grain security in China, salt tolerant, drought-resistant crops new varieties are cultivated, for improving land utilization efficiency,
Ensure grain yield, the grain security for strengthening China is significant.Traditional breeding method means are cultivating salt tolerant, drought-resistant crops side
Face has achieved certain progress, but because breeding time is long, salt-tolerant drought-resistant germ plasm resource is deficient, causes salt-tolerant drought-resistant new varieties to train
Educate and popularizing planting is seriously restricted so that arid and the saliferous land utilization ratio of generation are still very low.With the modern times point
The development of sub- biology, plant salt tolerance, drought resisting molecular mechanism are progressively disclosed, some salt tolerants, drought resisting key gene by into
Work(is cloned.Correlative study achievement is to use to pass through genetic engineering means, and the salt tolerant and drought-resistant character to plant of targeting are carried out
Molecular improvement, the genetically modified crops for cultivating high salt tolerant and drought resisting have established solid foundation.This method is high, time-consuming due to targeting
Short, the crop tolerance to salt drought resisting effect of cultivation is good, therefore, has important value in arid and salinization land use aspects.
Cauliflower（Brassica oleracea L. var. botrytis）It is important vegetable crop, China is the world
The maximum country of upper cauliflower cultivated area, but the cold-resistant salt resistance ability of cauliflower is weaker, limits its popularizing planting.Cause
This, discloses cauliflower drought resistance and salt tolerance molecular mechanism, clone's gene related to cauliflower drought resistance and salt tolerance, and give birth to by modern molecular
Thing learns to do the Varieties of Cauliflower that section cultivates high salt-tolerant drought-resistant, bad outer for improving cauliflower reply arid, saline Land
The ability of boundary's factor, it is ensured that stable yield, and expand cultivated area there is significant application value.
The content of the invention
The purpose of the present invention is to disclose a cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence, and provide a kind of profit
With the gene coded sequence, salt-tolerant drought-resistant genetically modified plants methods and applications are obtained using genetic engineering means.To realize that this is stated
Purpose, the invention discloses following technical scheme：
One cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence, it is by sequence 5 '
ATGATTTATCAAAAAACACTTCTCACAGTCTTTTTCTTTGCATTTATCACCATATACTTTGTAATCTTAGCAGATGC
GACTACGTTCACAGTAAGGAACAATTGTCCATATGTTGTGTGGGCTGCCACATCTGCTCCGGGAAAGCCTGGCGGTG
GGAAGCGACTCAATCAAGGCGAAACGTGGATCGTTACTGGTGATCCAGGTACCACCCAGGCTCGGATTTGGGGTCGT
ACCAACTGCAACTTCGATGTCTCTGGAAGAGGTGGATGCCAAACTGGAGATTGTAATGGTGTACTTGAGTGCAAATC
TTATGGACGAGCACCAAATACATTGGCAGAATATTCTCTTAAACAATATGCAGACCAAGATTTCATCGATATTTCTG
TGATCGATGGATTCAATATTCCAATGGAATTCAGTTCTGCATCTGGACAATGCACCCGCAAAATTAGGTGTACGGGA
GATATTATAGCTCAATGTCCAGCCCAACTAAGAATGGACGGCGCTTGCAACGGACCGTGTCCGGTGTTGAAGACGGA
GGAACATTGTTGCAACTCTGGTAATTGTGGACCGACCCCACTCTCTATGTTTTTCAAGCAACGTTGTCCAGATGCCT
ATAGTTATCCTAAGGATGATCCCACCAGCCCTTTCACTTGCCCTAGCGGAACCAACTACAATGTCATTTTCTGTCCG
TGA3 ' is formed（SEQ ID NO：1）.
The present invention further discloses a kind of side that salt-tolerant drought-resistant genetically modified plants are cultivated using said gene coded sequence
Method, it comprises the following steps：
（1）Cauliflower Total RNAs extraction and reverse transcription synthesis cDNA；
（2）Amplimer design, synthesis：Band restriction enzyme site design of primers, synthesis：
TLP1-S：5 ' GCCCATGGCTTGATTAGTTTC3 ' (underscore represents Nco I restriction enzyme sites)（SEQ ID NO：2）；
TLP1-A：5 ' GGTCACCGATAATCACACTTCC3 ' (underscore represents Bst EII restriction enzyme sites)（SEQ ID NO：
3）.
Primer sequence is synthesized by Shanghai bio-engineering corporation.
（3）It is overexpressed conversion carrier structure：Use SDS（Lauryl sodium sulfate）Alkaline lysis extracts respectively
PCAMBIA3301 plasmids and the plasmid containing said gene coded sequence；By the plasmid of said gene coded sequence and
PCAMBIA3301 vector plasmids use simultaneouslyNco IWithBstEII double digestions, digestion system are as follows：μ g of plasmid 2,10 × T
buffer 2 μL、Nco I（30U/μL）1.0μL、SacI（100U/μL）1.0 μ L, sterilized water are mended to 25 μ L.By above-mentioned mixing
Liquid is placed in 0.2mL centrifuge tube, 37 degree of incubation 6h；Identical restriction enzyme site target gene fragment and pCAMBIA3301 will be carried
The recovery of plasmid is simultaneously attached, and linked system is as follows：μ L of pCAMBIA3301 plasmids 4, μ L of purpose fragment 4.5,10 ×
ligase buffer（Connect buffer solution） 1μL、Ligase（Ligase）0.5 μ L, sterilized water are mended to 10 μ L, by above-mentioned company
Connect after mixture is placed in 0.2mL centrifuge tube and gently mixes, 16 DEG C of water-baths are incubated 16 h；The conversion of recombinant plasmid：Add 10 μ L
Connection product flicks mixing, the min of ice bath 40 in 50 μ L competent escherichia coli cells；42 DEG C of s of heat shock 30, are immediately placed on
2 min on ice；Add 500 μ L to balance to the LB of room temperature, 180 37 DEG C of rpm and be incubated 1 h；After 4000 rpm centrifugations 1min, discard
Part supernatant, 150 μ L of residue are resuspended thalline, are applied to LB flat boards（Containing 150 mg/L Kan）；37 DEG C of overnight incubations.Picking white
It is cloned in 1 mL LB culture mediums（Containing 150 mg/L Kan）37 DEG C, 180 rpm cultivate 8 h.1 μ L bacterium solutions are taken to enter as template
Performing PCR identifies that screening obtains positive recombinant plasmid；Recombinant plasmid transformed Agrobacterium LBA4404：1 μ g recombinant plasmids are taken to add
In 100 μ L Agrobacterium competence, gently mix；The min of ice bath 30；The min of liquid nitrogen flash freezer 5；37 DEG C of min of thermal shock 5；Add
800 μ L YEB fluid nutrient mediums（Without antibiotic）, 28 DEG C of 180 4 h of rpm recoveries；After 4000 rpm centrifugations 1min, discard
Part supernatant, 150 μ L of residue are resuspended thalline, are applied to YEB flat boards（Rif containing 80mg/L, 120mg/L Str and 150 mg/L
Kan）；28 DEG C are inverted culture 2-3 d.Picking white colonies are in 1 mL YEB culture mediums（Rif containing 80mg/L, 120mg/L Str
With 150 mg/L Kan）, 28 DEG C, 220 rpm cultivate 1 ~ 2 d.1 μ L bacterium solutions are taken to enter performing PCR identification as template；Extract simultaneously
Agrobacterium positive plasmid carries out double digestion identification；The μ L of positive strain bacterium solution 500 of identification of learning from else's experience add 500 μ L 40% glycerine YEB
Culture medium, proper mix save backup after -20 DEG C；
（4）Genetic transformation：The Agrobacterium bacterium solution containing target gene recombinant plasmid of -20 DEG C of preservations is inoculated in 10 mL YEB
Fluid nutrient medium（Rif containing 80mg/L, 120mg/L Str and 150 mg/L Kan）In, 28 DEG C, 220 rpm activation 1 ~ 2
d；By 1：100 ratios take 2.5 mL bacterium solutions to be inoculated in 250 mL YEB fluid nutrient mediums（Rif containing 80mg/L, 120mg/L Str
With 150 mg/L Kan）In, 28 DEG C of 220 rpm is incubated overnight to OD600For 1.2-1.6；5,000 rpm centrifuge 10 min
Thalline is collected, thalline is resuspended in the sucrose solutions of 500 mL 5%, it is transferred to after mixing stand-by as conversion fluid in conversion cup；Treat
Pour within 2 days before the arabidopsis of conversion permeable, remove and born pods, arabidopsis is inverted in conversion cup, gently shakes conversion fluid, is contaminated
Plant is removed after 30 s, unnecessary conversion fluid is shrugged off, is wrapped with preservative film, is placed in pallet, the d of lucifuge 1.
（5）Transgenic positive seedling screens：Take out the good transgenic arabidopsis T of vernalization treatment in 4 DEG C of refrigerators0For seed
And wild type seeds, equably sow respectively in the Nutrition Soil surface of sterilizing, overlay film；After seed sprouting（About 3-4 d）, remove
Preservative film.After one week, when true leaf is grown, certain density Basta herbicides are sprayed（10% Basta mother liquor running water is dilute
Release 10000 times）, the arabidopsis of wild type spray same concentration Basta herbicides and running water respectively as control, one day
Sprinkling is twice.Obvious screening effect can be observed after one week：Wild type and the gradual yellow of non-positive seedling, growth retardation, and
Then blade is emerald green for positive seedling, the normal growth as spraying the wildtype Arabidopsis thaliana of running water；Positive seedling is transferred to and newly gone out
Cultivated in the Nutrition Soil of bacterium, be denoted as T1In generation, when plant to be planted is grown compared with multiple-blade, blade extraction DNA is taken to enter performing PCR Molecular Identification.
（6）The degeneration-resistant biological character observation of genetically modified plants, arid and salt stress are carried out to transfer-gen plant after purification
The result of processing experiment is found：
（1）Genetically modified plants have obvious Characteristics of Drought compared with wild type, can be with than wild type under the conditions of continuous drought
More survivals more than 10 days；
（2）Genetically modified plants plant has obvious salt-tolerant trait compared with wild type, can be just under 200 mmol/L salt treatment
It is frequently grown.
Emphasis of the present invention solves plants in crop or energy-source plant breeding of new varieties to obtaining salt-tolerant drought-resistant crop or the energy
The demand of thing new varieties.
YEB culture mediums of the present invention refer to Rif containing 80mg/L（Rifampin）、120mg/L Str（Streptomysin）With
150 mg/L Kan（Kanamycins）Culture medium.
The present invention also discloses that gene coded sequence simultaneously（SEQ ID NO：1）Should in intervention cauliflower salt and drought stress
Application in answering.Experimental result is shown：Genetically modified plants have obvious Characteristics of Drought compared with wild type, in continuous drought bar
It can be survived more than 10 days than wild type under part more；Particularly turn plant has obvious salt tolerant special compared with wild type
Property, under 200 mmol/L salt treatment can normal growth, illustrate cauliflower BoTLP1 genes coded sequence can cultivate it is resistance to
Played a role in salt drought resisting genetically modified plants.
It is disclosed by the invention to utilize the gene coded sequence, obtain salt-tolerant drought-resistant genetically modified plants using genetic engineering means
Method possessed good effect is compared with prior art：
（1）Operating process is simpler, and the requirement to operating environment is lower, only possesses simple molecules biology even in general
Equipment, the laboratory of instrument can also carry out；
（2）Low-cost, broad spectrum activity is high, can carry out in most dicotyledons；
（3）Transformation efficiency is high, it is possible to achieve being obtained in the short time largely has the transfer-gen plant of high salt-tolerant drought-resistant.
Brief description of the drawings
Fig. 1 shows this case cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence transgenic Arabidopsis plants Basta resistances
The selection result；
Fig. 2 shows this case cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence transgenic arabidopsis positive plant Molecular Identification result；
Fig. 3（a, b,c）Transgenic arabidopsis and open country after display this case cauliflower salt-tolerant drought-resistant gene BoTLP1 arabidopsis thaliana transformations
Phenotypic results of the raw type under drought stress（The left side shows wildtype Arabidopsis thaliana growth and development state, and the right shows that transgenosis is intended
Southern mustard growth and development state）.Wherein a shows phenotype before wild type and BoTLP1 transgenic arabidopsis Osmotic treatments；B displays are wild
10 days phenotypes of raw type and BoTLP1 transgenic arabidopsis Osmotic treatment；C shows wild type and BoTLP1 transgenic arabidopsis arid
Handle 20 days phenotypes；
Fig. 4（a,b,c）Show transgenic arabidopsis and wild after this case cauliflower salt-tolerant drought-resistant gene BoTLP1 arabidopsis thaliana transformations
Phenotypic results of the type under salt stress（The left side shows wildtype Arabidopsis thaliana growth and development state, and the right shows transgenic arabidopsis
Growth and development state）.Wherein a shows phenotype before wild type and BoTLP1 transgenic arabidopsis 200mmol/L salt treatment；B shows
Show wild type and BoTLP1 transgenic arabidopsis 200mmol/L 7 days phenotypes of salt treatment；C shows wild type and BoTLP1 transgenosis
14 days phenotypes of arabidopsis 200mmol/L salt treatment.
Embodiment
With reference to Figure of description and specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only used
In the explanation present invention rather than limitation the scope of the present invention.The experimental method of unreceipted actual conditions in the following example, lead to
Often according to normal condition such as Sambrook et al., molecular cloning：Laboratory manual（New York: Cold Spring Harbor
Laboratory Press,1989）Described in condition.All biochemical reagents of the present invention, enzyme, carrier, bacterial strain can be various
Bought in biochemical reagents company, primer sequence is synthesized by Shanghai bio-engineering corporation.
The source such as biochemical reagents needed for the present invention and enzyme see the table below：
Embodiment 1
One cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence, it is by sequence 5 '
ATGATTTATCAAAAAACACTTCTCACAGTCTTTTTCTTTGCATTTATCACCATATACTTTGTAATCTTAGCAGATGC
GACTACGTTCACAGTAAGGAACAATTGTCCATATGTTGTGTGGGCTGCCACATCTGCTCCGGGAAAGCCTGGCGGTG
GGAAGCGACTCAATCAAGGCGAAACGTGGATCGTTACTGGTGATCCAGGTACCACCCAGGCTCGGATTTGGGGTCGT
ACCAACTGCAACTTCGATGTCTCTGGAAGAGGTGGATGCCAAACTGGAGATTGTAATGGTGTACTTGAGTGCAAATC
TTATGGACGAGCACCAAATACATTGGCAGAATATTCTCTTAAACAATATGCAGACCAAGATTTCATCGATATTTCTG
TGATCGATGGATTCAATATTCCAATGGAATTCAGTTCTGCATCTGGACAATGCACCCGCAAAATTAGGTGTACGGGA
GATATTATAGCTCAATGTCCAGCCCAACTAAGAATGGACGGCGCTTGCAACGGACCGTGTCCGGTGTTGAAGACGGA
GGAACATTGTTGCAACTCTGGTAATTGTGGACCGACCCCACTCTCTATGTTTTTCAAGCAACGTTGTCCAGATGCCT
ATAGTTATCCTAAGGATGATCCCACCAGCCCTTTCACTTGCCCTAGCGGAACCAACTACAATGTCATTTTCTGTCCG
TGA3 ' is formed（SEQ ID NO：1）.
The method that salt-tolerant drought-resistant genetically modified plants are cultivated using said gene coded sequence, it comprises the following steps：
（1）Cauliflower Total RNAs extraction and cDNA synthesis：The Trizol being sold using the precious biological Sheng Gong Engineering Co., Ltd in Dalian is tried
Total serum IgE is extracted in agent.The g of sterile Cauliflower about 0.2, is placed in mortar, is rapidly added appropriate liquid nitrogen and is ground, treats
Its grind into fine powder, move into 10 ml centrifuge tubes；2.5 ml Trizol reagents are added in centrifuge tube, room temperature places 15 min；
12000 rpm centrifuge 15 min, abandon precipitation；Supernatant is moved into another centrifuge tube, added by 200 μ l chloroforms/ml Trizol reagents
Enter chloroform, vibrate 20 min, room temperature places 15 min；4 DEG C of 12000 rpm centrifuges 15 min, draws upper strata aqueous phase, extremely another
In centrifuge tube；Isopropanol is added by 0.5 ml isopropanols/ml Trizol reagents to mix, -20 DEG C of 50 min of placement；4℃
12000 rpm centrifuge 15 min, abandon supernatant, are deposited in room temperature and dry；With 100 μ l DEPC（Diethylpyrocarbonate）Processing
Distilled water dissolves RNA；2 μ l RNA solutions are taken, 1.0% agarose gel electrophoresis detects RNA integrality, takes 1 μ l to utilize
NanDrop®ND-1000 nucleic acid determination instrument, measure extraction RNA OD values.Remaining RNA is used for reverse transcription and synthesizes the first chain cDNA.
Synthesis step is as follows：The μ g of RNA 2, Olig d (T) are sequentially added in 0.2mL carefulness pipes18（500ng/μL）2 μL、RNA-free
The μ L of water 1；Gently mix, 70 DEG C of 5 min after of short duration centrifugation, be immediately placed on 3min on ice；Sequentially add following component：M-MLV 5
×Buffer 6μL、dNTP 2.5μL、RNase Inhibitor（RNase inhibitor）（40 U/μL）1.25μL、M-MLV（Mouse
Source reverse transcriptase）（200U/μL）2 μ L, mend to 30 μ L；Gently mix, 42 DEG C of 1 h；70 DEG C of 15 min inactivation enzymatic activity, -20
DEG C preserve.
（2）Band restriction enzyme site design of primers, synthesis：The gene amplification primer with restriction enzyme site is designed using biological software
Thing, primer sequence are as follows： TLP1-S：(underscore represents 5 ' GCCCATGGCTTGATTAGTTTC3 'Nco IRestriction enzyme site);
TLP1-A：(underscore represents 5 ' GGTCACCGATAATCACACTTCC3 'BstEII restriction enzyme sites).Primer sequence is given birth to by Shanghai
Thing engineering company synthesizes.
（3）It is overexpressed conversion carrier structure：Use SDS（Lauryl sodium sulfate）Alkaline lysis extracts respectively
PCAMBIA3301 plasmids and the plasmid containing said gene coded sequence；By the plasmid of said gene coded sequence and
PCAMBIA3301 vector plasmids use simultaneouslyNco IWithBstEII double digestions, digestion system are as follows：μ g of plasmid 2,10 × T
buffer 2 μL、Nco I（30U/μL）1.0μL、SacI（100U/μL）1.0 μ L, sterilized water are mended to 25 μ L.By above-mentioned mixing
Liquid is placed in 0.2mL centrifuge tube, 37 degree of incubation 6h；Identical restriction enzyme site target gene fragment and pCAMBIA3301 will be carried
The recovery of plasmid is simultaneously attached, and linked system is as follows：μ L of pCAMBIA3301 plasmids 4, μ L of purpose fragment 4.5,10 ×
ligase buffer（Connect buffer solution） 1μL、Ligase（Ligase）0.5 μ L, sterilized water are mended to 10 μ L, by above-mentioned company
Connect after mixture is placed in 0.2mL centrifuge tube and gently mixes, 16 DEG C of water-baths are incubated 16 h；The conversion of recombinant plasmid：Add 10 μ L
Connection product flicks mixing, the min of ice bath 40 in 50 μ L competent escherichia coli cells；42 DEG C of s of heat shock 30, are immediately placed on
2 min on ice；Add 500 μ L to balance to the LB of room temperature, 180 37 DEG C of rpm and be incubated 1 h；After 4000 rpm centrifugations 1min, discard
Part supernatant, 150 μ L of residue are resuspended thalline, are applied to LB flat boards（Containing 150 mg/L Kan）；37 DEG C of overnight incubations.Picking white
It is cloned in 1 mL LB culture mediums（Containing 150 mg/L Kan）37 DEG C, 180 rpm cultivate 8 h.1 μ L bacterium solutions are taken to enter as template
Performing PCR identifies that screening obtains positive recombinant plasmid；Recombinant plasmid transformed Agrobacterium LBA4404：1 μ g recombinant plasmids are taken to add
In 100 μ L Agrobacterium competence, gently mix；The min of ice bath 30；The min of liquid nitrogen flash freezer 5；37 DEG C of min of thermal shock 5；Add
800 μ L YEB fluid nutrient mediums（Without antibiotic）, 28 DEG C of 180 4 h of rpm recoveries；After 4000 rpm centrifugations 1min, discard
Part supernatant, 150 μ L of residue are resuspended thalline, are applied to YEB flat boards（Rif containing 80mg/L, 120mg/L Str and 150 mg/L
Kan）；28 DEG C are inverted culture 2-3 d.Picking white colonies are in 1 mL YEB culture mediums（Rif containing 80mg/L, 120mg/L Str
With 150 mg/L Kan）, 28 DEG C, 220 rpm cultivate 1 ~ 2 d.1 μ L bacterium solutions are taken to enter performing PCR identification as template；Extract simultaneously
Agrobacterium positive plasmid carries out double digestion identification；The μ L of positive strain bacterium solution 500 of identification of learning from else's experience add 500 μ L 40% glycerine YEB
Culture medium, proper mix save backup after -20 DEG C.
（4）Genetic transformation：The Agrobacterium bacterium solution containing target gene recombinant plasmid of -20 DEG C of preservations is inoculated in 10 mL
YEB fluid nutrient mediums（Rif containing 80mg/L, 120mg/L Str and 150 mg/L Kan）In, 28 DEG C, 220 rpm activation 1 ~
2 d；By 1：100 ratios take 2.5 mL bacterium solutions to be inoculated in 250 mL YEB fluid nutrient mediums（Rif containing 80mg/L, 120mg/L
Str and 150 mg/L Kan）In, 28 DEG C of 220 rpm is incubated overnight to OD600For 1.2-1.6；5,000 rpm centrifugations 10
Min collects thalline, and thalline is resuspended in the sucrose solutions of 500 mL 5%, it is transferred to after mixing in conversion cup and is treated as conversion fluid
With；Pour within 2 days before arabidopsis to be transformed permeable, remove and born pods, arabidopsis is inverted in conversion cup, gently shakes conversion
Liquid, plant is removed after contaminating 30 s, unnecessary conversion fluid is shrugged off, is wrapped with preservative film, is placed in pallet, the d of lucifuge 1..
（5）Transgenic positive seedling screens：Take out the good transgenic arabidopsis T of vernalization treatment in 4 DEG C of refrigerators0For seed
And wild type seeds, equably sow respectively in the Nutrition Soil surface of sterilizing, overlay film；After seed sprouting（About 3-4 d）, remove
Preservative film.After one week, when true leaf is grown, certain density Basta herbicides are sprayed（10% Basta mother liquor running water is dilute
Release 10000 times）, the arabidopsis of wild type spray same concentration Basta herbicides and running water respectively as control, one day
Sprinkling is twice.Obvious screening effect can be observed after one week：Wild type and the gradual yellow of non-positive seedling, growth retardation, and
Then blade is emerald green for positive seedling, the normal growth as spraying the wildtype Arabidopsis thaliana of running water；Positive seedling is transferred to and newly gone out
Cultivated in the Nutrition Soil of bacterium, be denoted as T1In generation, when plant to be planted is grown compared with multiple-blade, blade extraction DNA is taken to enter performing PCR Molecular Identification.
Fig. 1 shows this case cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence transgenic Arabidopsis plants Basta resistance screening results.
Fig. 2 shows this case cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence transgenic arabidopsis positive plant Molecular Identification result.
（6）Genetically modified plants biological character is observed, and arid is carried out to transfer-gen plant after purification and salt stress is handled
The result of experiment is found：
1st, genetically modified plants have obvious Characteristics of Drought compared with wild type, can be more than wild type under the conditions of continuous drought
Survival more than 10 days；
2nd, genetically modified plants plant has obvious salt-tolerant trait compared with wild type, can be normal under 200 mmol/L salt treatment
Growth.Fig. 3（a, b,c）Show this case cauliflower salt-tolerant drought-resistant geneBoTLP1Transgenic arabidopsis and open country after arabidopsis thaliana transformation
Phenotypic results of the raw type under drought stress（The left side shows wildtype Arabidopsis thaliana growth and development state, and the right shows that transgenosis is intended
Southern mustard growth and development state）.Fig. 4（a,b,c）Show this case cauliflower salt-tolerant drought-resistant geneBoTLP1Turn base after arabidopsis thaliana transformation
Because of the phenotypic results of arabidopsis and wild type under salt stress（The left side shows wildtype Arabidopsis thaliana growth and development state, and the right shows
Show transgenic arabidopsis growth and development state）.
SEQUENCE LISTING
<110>Nankai University
<120>The coded sequence of cauliflower BoTLP1 genes and its application in salt-tolerant drought-resistant genetically modified plants are cultivated
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 696
<212> DNA
<213>Artificial sequence
<400> 1
atgatttatc aaaaaacact tctcacagtc tttttctttg catttatcac catatacttt 60
gtaatcttag cagatgcgac tacgttcaca gtaaggaaca attgtccata tgttgtgtgg 120
gctgccacat ctgctccggg aaagcctggc ggtgggaagc gactcaatca aggcgaaacg 180
tggatcgtta ctggtgatcc aggtaccacc caggctcgga tttggggtcg taccaactgc 240
aacttcgatg tctctggaag aggtggatgc caaactggag attgtaatgg tgtacttgag 300
tgcaaatctt atggacgagc accaaataca ttggcagaat attctcttaa acaatatgca 360
gaccaagatt tcatcgatat ttctgtgatc gatggattca atattccaat ggaattcagt 420
tctgcatctg gacaatgcac ccgcaaaatt aggtgtacgg gagatattat agctcaatgt 480
ccagcccaac taagaatgga cggcgcttgc aacggaccgt gtccggtgtt gaagacggag 540
gaacattgtt gcaactctgg taattgtgga ccgaccccac tctctatgtt tttcaagcaa 600
cgttgtccag atgcctatag ttatcctaag gatgatccca ccagcccttt cacttgccct 660
agcggaacca actacaatgt cattttctgt ccgtga 696
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
gcccatggct tgattagttt c 21
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence
<400> 3
ggtcaccgat aatcacactt cc 22
Claims (4)
- A 1. cauliflower salt-tolerant drought-resistant geneBoTLP1Coded sequence, it is by sequence 5 ' ATGATTTATCAAAAAACACTTCTCACAGTCTTTTTCTTTGCATTTATCACCATATACTTTGTAATCTTAGCAGATGC GACTACGTTCACAGTAAGGAACAATTGTCCATATGTTGTGTGGGCTGCCACATCTGCTCCGGGAAAGCCTGGCGGTG GGAAGCGACTCAATCAAGGCGAAACGTGGATCGTTACTGGTGATCCAGGTACCACCCAGGCTCGGATTTGGGGTCGT ACCAACTGCAACTTCGATGTCTCTGGAAGAGGTGGATGCCAAACTGGAGATTGTAATGGTGTACTTGAGTGCAAATC TTATGGACGAGCACCAAATACATTGGCAGAATATTCTCTTAAACAATATGCAGACCAAGATTTCATCGATATTTCTG TGATCGATGGATTCAATATTCCAATGGAATTCAGTTCTGCATCTGGACAATGCACCCGCAAAATTAGGTGTACGGGA GATATTATAGCTCAATGTCCAGCCCAACTAAGAATGGACGGCGCTTGCAACGGACCGTGTCCGGTGTTGAAGACGGA GGAACATTGTTGCAACTCTGGTAATTGTGGACCGACCCCACTCTCTATGTTTTTCAAGCAACGTTGTCCAGATGCCT ATAGTTATCCTAAGGATGATCCCACCAGCCCTTTCACTTGCCCTAGCGGAACCAACTACAATGTCATTTTCTGTCCG TGA3 ' is formed.
- 2. a kind of method using gene coded sequence culture salt-tolerant drought-resistant genetically modified plants described in claim 1, its feature exists Carried out in it by the steps：（1）Cauliflower Total RNAs extraction and cDNA synthesis；（2）Band restriction enzyme site design of primers, synthesis；（3）It is overexpressed conversion carrier structure；（4）Genetic transformation；（5）Transgenic positive seedling screens；（6）The degeneration-resistant biological character observation of genetically modified plants.
- 3. gene coded sequence described in claim 1 is intervening cauliflower and the developmental application of other plant organs.
- 4. the application described in claim 3, wherein referring to-training in intervention cauliflower and the developmental application of other plant organs Educate the salt-tolerant drought-resistant genetically modified plants for meeting breeding objective.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710872471.5A CN107488669B (en) | 2017-09-25 | 2017-09-25 | CauliflowerBoTLP1Coding sequence of gene and application thereof in cultivating salt-tolerant drought-resistant transgenic plant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710872471.5A CN107488669B (en) | 2017-09-25 | 2017-09-25 | CauliflowerBoTLP1Coding sequence of gene and application thereof in cultivating salt-tolerant drought-resistant transgenic plant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107488669A true CN107488669A (en) | 2017-12-19 |
| CN107488669B CN107488669B (en) | 2021-06-25 |
Family
ID=60653049
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710872471.5A Active CN107488669B (en) | 2017-09-25 | 2017-09-25 | CauliflowerBoTLP1Coding sequence of gene and application thereof in cultivating salt-tolerant drought-resistant transgenic plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107488669B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110627887A (en) * | 2019-09-30 | 2019-12-31 | 中国农业大学 | Application of SlTLFP8 protein and related biological material thereof in regulation and control of tomato drought resistance |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1842599A (en) * | 2003-06-26 | 2006-10-04 | 卡斯坦尼亚农林股份公司 | Genes codifying for allene oxide cyclase, cystatin, beta-1,3-glucanase and thaumatin-like protein and their use |
| JP2006271218A (en) * | 2005-03-28 | 2006-10-12 | Iwate Prefecture | New lentinan-degrading enzyme gene and recombinant shiitake (lentinus edodes) fungus by utilizing the same |
| CN101736024A (en) * | 2010-01-22 | 2010-06-16 | 昆明理工大学 | Thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application |
-
2017
- 2017-09-25 CN CN201710872471.5A patent/CN107488669B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1842599A (en) * | 2003-06-26 | 2006-10-04 | 卡斯坦尼亚农林股份公司 | Genes codifying for allene oxide cyclase, cystatin, beta-1,3-glucanase and thaumatin-like protein and their use |
| JP2006271218A (en) * | 2005-03-28 | 2006-10-12 | Iwate Prefecture | New lentinan-degrading enzyme gene and recombinant shiitake (lentinus edodes) fungus by utilizing the same |
| CN101736024A (en) * | 2010-01-22 | 2010-06-16 | 昆明理工大学 | Thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application |
Non-Patent Citations (3)
| Title |
|---|
| AHMED，N.U.等: "Characterization of Thaumatin-like Gene Family and Identification of Pectobacterium carotovorum subsp. carotovorum Inducible Genes in Brassica oleracea", 《PLANT BREED. BIOTECH.》 * |
| NCBI-GENBANK: "Genbank：XM_013765831.1", 《GENBANK》 * |
| 姜晓玲 等: "植物类甜蛋白基因家族研究进展", 《浙江农林大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110627887A (en) * | 2019-09-30 | 2019-12-31 | 中国农业大学 | Application of SlTLFP8 protein and related biological material thereof in regulation and control of tomato drought resistance |
| CN110627887B (en) * | 2019-09-30 | 2021-03-23 | 中国农业大学 | Application of SlTLFP8 protein and related biological material thereof in regulation and control of tomato drought resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107488669B (en) | 2021-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112831478B (en) | Protein OsCAT8 for regulating rice chalkiness and coding gene and application thereof | |
| CN107383179A (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| AU2020100982A4 (en) | Wheat salt tolerance gene taaap3 and its application | |
| CN110004154B (en) | Application of tea tree CsJAZ1 gene | |
| CN104086637B (en) | Tobacco strigolactones transport protein NtPDR6 and interference expression vector and application thereof | |
| CN109180791B (en) | Gene related to plant drought tolerance, and coding protein and application thereof | |
| CN103014035B (en) | Tumorous stem mustard stress-resistant gene, plant expression vector, construction method and application thereof | |
| CN104711259A (en) | Double miRNA (micro ribonucleic acid) inhibition expression vector, and construction method and application of double miRNA inhibition expression vector | |
| CN104829699B (en) | A kind of and plant adversity resistance related protein Gshdz4 and its encoding gene and application | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN104328127B (en) | Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof | |
| CN110564740B (en) | A gene AtPIP2 for improving disease resistance of plants; 7 and uses thereof | |
| CN104774869A (en) | Method for cultivating long-storage tomato plants by virtue of silent tomato gene SlNZG | |
| CN112322635B (en) | Coding sequence of larch growth and development regulation gene and application thereof | |
| CN107488669A (en) | The coded sequence of cauliflower BoTLP1 genes and its application in salt-tolerant drought-resistant genetically modified plants are cultivated | |
| CN103243108B (en) | Calcium ion binding protein derived from stem nodule as well as encoding gene and application thereof | |
| CN104513825B (en) | Wheat salt-tolerant gene TaNAS1 and application thereof | |
| CN103451190B (en) | Gene coding sequence for regulating and controlling organ development of cauliflowers and application of gene coding sequence | |
| CN105063046B (en) | A kind of chlorenchyma specific promoter of Grain Production of Amaranthus and its application | |
| WO2013010368A1 (en) | Use of rice aerenchyma formation key gene oslsd2 | |
| CN106191059A (en) | Application in Herba Capsellae peroxidase gene promoter and improvement plant cold resistance thereof | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof | |
| CN104829698A (en) | Plant stress resistance-associated protein and its coding gene GsCHX19 and use | |
| CN104498512A (en) | Application of arabidopsis calcium ion-dependent protein kinase gene AtGPK1 in regulation and control of stomatal movement and plant drought resistance | |
| CN116769797B (en) | Application of methyl jasmonate and PpyMYC2 gene in germination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |