JP2006271218A - New lentinan-degrading enzyme gene and recombinant shiitake (lentinus edodes) fungus by utilizing the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a Shiitake fungus suppressed in lentinan-degrading activity by isolating the gene of Thaumatin-like protein having an endo-glucanase activity from the Shiitake fungus, and elucidating its function for the degradation of lentinan. <P>SOLUTION: This new endo-glucanase gene (tlg1) expressed by sequence number 1 (from 1,292th to 3,330th) or sequence number 2 (in the specification), derived from the Shiitake fungus, and having lentinan-degrading activity, a vector for inhibiting the expression of the tlg1 gene and a transformed Shiitake fungus transformed by the vector are provided. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a novel endo-glucanase gene (tlg1) having a lentinan degrading activity derived from Shiitake mushroom, the tlg1 gene expression-suppressing vector, and a transformed shiitake mushroom having a suppressed lentinan degrading activity produced using the vector Etc.

  Shiitake belongs to the genus Shiitake, a basidiomycete, and has been used as an excellent edible fungus since ancient times, and has been cultivated in Japan since ancient times. Shiitake is used not only as raw shiitake but also as dry shiitake. In recent years, however, the rate of self-sufficiency has fallen due to the rapid increase in shiitake imported from China.

  Most breeding of shiitake fungus relies on cross breeding, and breeding by mutagen treatment is not performed. Breeding by crossing involves sporulation, which is very time consuming and requires a lot of labor to select strains with altered traits.

  In recent years, Shiitake transformation methods and vectors using Shiitake-derived gene promoters have been reported (Patent Documents 1 to 4 and Non-Patent Documents 1 to 3), and identification in Shiitake by using antisense vectors and RNAi vectors. It is considered that gene expression can be controlled. However, with regard to the isolation of the target gene for carrying out this method, research on the gene analysis of Shiitake fungus is still under development, and the number of isolated genes is very small.

  Lentinan is β-1,3-1,6-glucan extracted and purified from shiitake mushroom as a substance exhibiting anticancer activity by activating immune function (Non-patent Document 4). Lentinan has already been approved as an anti-cancer drug and is actually used clinically. Moreover, although lentinan is sold as a refined product from raw shiitake by Ajinomoto Co., Inc., lentinan is decomposed in the preservation process after harvesting, and thus there is a problem that the yield is not constant (Non-patent Document 5). . In addition, previous studies have also revealed that lentinan is degraded by an increase in exo-glucanase activity during shiitake preservation (Non-patent Document 6).

  As a shiitake-derived glucanase, a protein similar to Thaumatin-like protein, which is a plant antibacterial protein, has been reported to have endo-type glucanase activity. However, to date, there is a report of a partial sequence deduced from the amino acid sequence of the gene encoding Shiitake-derived Taumatin-like protein (Non-patent Document 7), but the gene including the full length has not been isolated. .

JP 11-155568 A JP2000-069975 JP 2001-321182 A JP2003-189855 Sato et al., Biosci. Biotech. Biochem., 62 (12), 2346-2350 (1998) Hirano et.al., Mol. Gen. Genet., 263, 1047-1052 (2000) Irie et.al., Biosci. Biotech. Biochem., 67 (9) 2006-2009 (2003) Chihara Goro, 2. Lentinan. Mushroom Chemistry, Biochemistry. Taku Mizuno, Masami Kawai, Academic Publishing Center Tokyo. 323-333 (1992) Minato et. Al., Int. J. Med. Mushroom 1, 265-272 (1999) Minato et.al., Carbohydr.Polym. 56, 279-286 (2004) Grenier et.al., Mycologia 92 (5): 841-848 (2000)

  An object of the present invention is to isolate a Thaumatin-like protein gene having endo-glucanase activity derived from Shiitake fungus and to elucidate its function against lentinan degradation. Furthermore, it is an object of the present invention to provide a shiitake bacterium in which lentinan degradation is suppressed more than the corresponding parent strain by suppressing the expression of the gene.

The present inventors have succeeded in isolating a full-length gene (named tlg1 gene) encoding Thaumatin-like protein, an endo-glucanase having lentinan degrading activity, from Shiitake mushroom. Then, it was clarified that the purified gene product has a lentinan degrading activity, and the present invention has been completed. That is, the present invention provides the following (a) to (d):
(A) a nucleic acid molecule comprising the 1292st to 3330th nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 1,
(B) It hybridizes with a nucleic acid molecule consisting of a base sequence complementary to the nucleic acid molecule consisting of the nucleotide sequence 1292 to 3330 of the base sequence shown in SEQ ID NO: 1 under stringent conditions and has a lentinan degrading activity. A nucleic acid molecule derived from Shiitake, which encodes a protein having
(C) a nucleic acid molecule comprising the base sequence represented by SEQ ID NO: 2,
(D) derived from Shiitake fungus that hybridizes under stringent conditions with a nucleic acid molecule complementary to the nucleic acid molecule consisting of the base sequence shown in SEQ ID NO: 2 and encodes a protein having lentinan degrading activity Nucleic acid molecules,
A tlg1 gene comprising any one of the nucleic acid molecules is provided.

  The present invention also provides a vector containing the tlg1 gene, a transformant obtained by introducing the vector into a host, and culturing the transformant, and recovering a protein having endo-glucanase activity from the obtained culture medium. A method for producing a recombinant tlg1 protein is provided.

  Furthermore, the present invention provides a vector for suppressing the expression of tlg1 gene, comprising a nucleotide sequence consisting of 19 or more consecutive nucleotides in the sequence represented by SEQ ID NO: 2 in the antisense direction. In addition, an RNA comprising the base sequence consisting of 19 or more consecutive nucleotides in the sequence shown in SEQ ID NO: 2 and its complementary sequence at least once each and having the inverted repeat sequence for the base sequence consisting of 19 or more bases A tlg1 gene expression suppression vector to be expressed is provided. These tlg1 gene expression suppression vectors may further contain an appropriate transformation marker gene.

  The present invention also provides a transformed Shiitake bacterium obtained by introducing the tlg1 gene expression suppression vector into Shiitake bacterium.

  Furthermore, the present invention suppresses the expression of the tlg1 gene in Shiitake fungi using any one method selected from an antisense method, an RNA interference method, a gene disruption method, and a co-suppression method, and has a lentinan degradation activity higher than that of the parent strain. Provided are a method for producing a suppressed transformed shiitake bacterium, and a transformed shiitake bacterium produced by the method, wherein the lentinan degrading activity is suppressed more than that of a parent strain.

  Since the transformed shiitake fungus of the present invention has a lentinan degrading activity that is suppressed more than that of a normal shiitake fungus (parent strain), lentinan can be produced efficiently, and the present invention also provides such a production method.

  According to the present invention, it is possible to obtain Shiitake fungi with suppressed lentinan degrading enzyme activity. By using this transformed shiitake fungus, lentinan can be efficiently produced by preventing degradation of lentinan in the preservation process after harvesting.

1. tlg1 gene The tlg1 gene according to the present invention is a gene encoding an endo-glucanase (referred to as "lentinan degrading enzyme") derived from Shiitake mushroom having lentinan degrading activity. The inventors isolated the tlg1 gene for the first time based on the N-terminal sequence of Thaumatin-like protein reported in Shiitake, and determined its full-length sequence.

  The genomic DNA sequence and cDNA sequence of the isolated tlg1 gene are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The genomic sequence shown in SEQ ID NO: 1 is the promoter region of the tlg1 gene (positions 1 to 1201), 12 introns and 13 exons (each exon with ATG A on the genome sequence being number 1) , Exon 1: 1-75, exon 2: 158-186, exon 3: 267-273, exon 4: 423-472, exon 5: 676-755, exon 6: 807-905, exon 7: 1013-1079, Exon 8: 1148-1181, Exon 9: 1307-1365, Exon 10: 1466-1530, Exon 11: 1597-1621, Exon 12: 1713-1796, Exon 13: 1922-2037) (No. 1292) The promoter region includes a TATA box, a CAAT box, and a CT rich region. It was also suggested that the tlg1 gene is present in several copies in the genome.

  The ORF of the tlg1 gene (positions 91 to 873 of SEQ ID NO: 1) encodes a protein of 783 bp and 260 amino acid residues. This protein shows 40% homology with Thaumatin-like protein, which is an antibacterial protein of plants, has endo-glucanase activity, and has lentinan degrading activity. Hereinafter, the protein encoded by the tlg1 gene is referred to as “tlg1 protein”.

  The tlg1 gene of the present invention is not limited to the sequence shown in SEQ ID NO: 1 (positions 1292 to 3330) and SEQ ID NO: 2 as long as it encodes the tlg1 protein and has lentinolytic activity. It may be a nucleic acid molecule having a sequence capable of hybridizing under stringent conditions with a nucleic acid molecule having a complementary base sequence. The stringent conditions are, for example, conditions in which the sodium concentration is 300-2000 mM and the temperature is 40-75 ° C., preferably the sodium concentration is 600-900 mM and the temperature is 65 ° C. Those skilled in the art can refer to Molecular Cloning (Sambrook, J. et al., Molecular Cloning: a Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press, 10 Skyline Drive Plainview, NY (1989)), etc. Such a tlg1 gene homolog can be easily obtained.

2. Production of recombinant tlg1 protein (1) tlg1 gene expression vector A vector (tlg1 gene expression vector) for production of recombinant tlg1 protein can be obtained by linking (inserting) the tlg1 gene of the present invention to a known vector. . The vector is not particularly limited as long as it can be replicated in a host, and examples thereof include plasmid DNA and phage DNA.

  Examples of the plasmid DNA include plasmids derived from E. coli (eg, pBR322, pBR325, pUC18, pUC119, pTrcHis, pBlueBacHis, etc.), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, etc.), yeast-derived plasmids (eg, YEp13, YEp24, YCp50, pYE52, etc.), plasmids for plant cell hosts (pBI221, pBI121) and the like, and phage DNAs include λ phage and the like. Furthermore, animal viruses such as retrovirus or vaccinia virus, and insect virus vectors such as baculovirus can be used.

  In order to insert the gene of the present invention into a vector, first, the purified DNA is cleaved with a suitable restriction enzyme, inserted into a restriction enzyme site or a multicloning site of a suitable vector DNA, and linked to the vector. Adopted. The gene of the present invention needs to be introduced by linking to a promoter corresponding to the host in such a manner that the gene can function. Here, the “functional aspect” means that the gene of the present invention arranged downstream thereof is appropriately expressed in the host and exerts its function by the promoter activity. The type of promoter used is appropriately determined depending on the host cell, and details thereof will be described in the next section.

  The vector of the present invention includes a promoter, the gene of the present invention, a cis element such as an enhancer, a splicing signal, a poly A addition signal, a transformation marker gene (for example, a dihydrofolate reductase gene, an ampicillin resistance gene, a neomycin resistance, if desired. Gene, kanamycin resistance gene, hygromycin resistance gene, bialaphos resistance gene, carboxin resistance gene, phleomycin resistance gene, etc.), ribosome binding sequence (SD sequence) and the like.

  In particular, when Shiitake fungus is used as a host, pLG vectors (Hirano, T. et al., Ltd.), which have already been developed by the inventors as shiitake expression vectors and disclosed in JP-A-2000-069975 and JP-A-2001-157586. , Mol. Gen. Genet. 263, 1047-1052, 2000), pLT vector, pCHS vector, pChG vector (Japanese Patent Laid-Open No. 2001-321182) and the like can be suitably used.

(2) Transformant (recombinant tlg1 protein production host cell)
A transformant for producing a recombinant tlg1 protein can be obtained by introducing the vector into an appropriate host. The host is not particularly limited as long as it can express the tlg1 gene of the present invention. For example, Escherichia such as Escherichia coli, Bacillus subtilis such as Bacillus subtilis, Pseudomonas putida such as Pseudomonas genus, Rhizobium meliloti and Rhizobium meliloti Plant cells and protoplasts established from yeasts such as Saccharomyces cerevisiae and Schizosaccharomyces pombe, Aspergillus oryzae, Arabidopsis thaliana, tobacco, corn, rice, carrot, etc. Examples thereof include animal cells such as cells and CHO cells, and insect cells such as Sf9 and Sf21.

  When a bacterium such as Escherichia coli is used as a host, it is preferable that the vector of the present invention is capable of autonomous replication in the bacterium, and at the same time is composed of a promoter, a ribosome binding sequence, a gene of the present invention, and a transcription termination sequence. . Moreover, the gene which controls a promoter may be contained. Examples of Escherichia coli include Escherichia coli HMS174 (DE3), K12, DH1, and the like, and examples of Bacillus subtilis include Bacillus subtilis MI 114, 207-21, and the like. . The promoter is not particularly limited as long as it can be expressed in the above host such as Escherichia coli, and examples thereof include promoters derived from Escherichia coli and phages such as trp promoter, lac promoter, PL promoter, PR promoter and the like. An artificially designed and modified promoter such as a tac promoter may be used. The method for introducing a vector into bacteria is not particularly limited. For example, a method using calcium ions [Cohen, SN et al .: Proc. Natl. Acad. Sci., USA, 69: 2110-2114 (1972)] And electroporation method.

  When yeast is used as a host, for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris and the like are used. The promoter is not particularly limited as long as it can be expressed in yeast.For example, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter, etc. Can be mentioned. The method for introducing a vector into yeast is not particularly limited. For example, electroporation [Becker, DM et al .: Methods. Enzymol., 194: 182-187 (1990)], spheroplast method [Hinnen, A. et al .: Proc. Natl. Acad. Sci., USA, 75: 1929-1933 (1978)], lithium acetate method [Itoh, H .: J. Bacteriol., 153: 163-168 (1983)] Etc. can be mentioned.

  When a koji mold is used as a host, examples of the promoter include GlaA promoter (Hata et al. Curr. Genet., Vol 22, 85-91, 1992), AmyB promoter (Tuchiya et al. Biosci. Biotechnol. Biochem., Vol. 46, 1849-1853, 1992), No. 8 promoter (Ozeki et al. Biosci. Biotech. Biochem., Vol 60, 383-389, 1996). The method for introducing a vector into Aspergillus is not particularly limited, and for example, an electroporation method, a calcium ion method, or the like can be used.

  When plant cells are used as hosts, for example, cells established from rice, corn, wheat, Arabidopsis thaliana, tobacco, carrots, etc., or protoplasts prepared from the plants are used. In this case, the promoter is not particularly limited as long as it can be expressed in plants, and examples thereof include cauliflower mosaic virus 35S RNA promoter, rd29A gene promoter, and rbcS promoter. Examples of a method for introducing a vector into a plant include an indirect introduction method such as an Agrobacterium infection method, a direct introduction method such as a particle gun method, a polyethylene glycol method, a liposome method, and a microinjection method.

  When Shiitake is used as a host, the vector is preferably introduced into the protoplast of Shiitake using the polyethylene glycol method, electroporation method, REMI method or the like. The REMI method is a method for introducing a vector into Shiitake fungus developed by the inventors, and details thereof are described in Sato, T. et. Al., Biosci. Biotech. Biochem., 62, 2346-2350, (1998 ), And JP-A-11-155568.

(3) Production of recombinant tlg1 protein The tlg1 protein of the present invention is obtained by culturing the above-mentioned transformant (host cell) in an appropriate medium, and collecting a protein having endo-glucanase activity or lentinan degradation activity from the culture. Can be obtained. The transformant of the present invention may be cultured according to a conventional method. For example, in the case of a transformant having a microorganism such as Escherichia coli or yeast as a host, a natural medium containing a carbon source, a nitrogen source, inorganic salts and the like that can be assimilated by the microorganism, and capable of efficiently culturing the transformant, Alternatively, it may be cultured in a synthetic medium. In addition, when plant cells are used as a host, the cells may be cultured in a plant cell medium supplemented with vitamins such as thiamine and pyridoxine.

  As the carbon source, carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol are used. As the nitrogen source, ammonium salts of inorganic acids or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate, or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor and the like are used. As the inorganic substance, monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like are used.

  In the medium, antibiotics such as ampicillin and tetracycline may be added to the medium as necessary. When culturing a microorganism transformed with a vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, isopropyl-β-D-thiogalactopyranoside (IPTG) is used when cultivating microorganisms transformed with a vector using the Lac promoter, and indole when culturing microorganisms transformed with a vector using the trp promoter. Acrylic acid (IAA) or the like may be added to the medium.

  The culture is usually performed at about 30 to 37 ° C. for about 6 hours to 3 days under aerobic conditions such as shaking culture or aeration and agitation culture. During the culture period, the pH is maintained at about 7.0 to 7.5. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like. When the protein of the present invention is produced in cells or cells after culturing, the protein is extracted by disrupting the cells or cells. When the protein of the present invention is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Then, general biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, SDS-PAGE, gel chromatography, ion exchange chromatography, hydrophobic chromatography, affinity chromatography, etc., alone or in combination as appropriate The protein of the present invention can be isolated and purified from the culture.

3. tlg1 Gene Expression Suppression Vector The tlg1 gene expression suppression vector according to the present invention is an antisense vector or an RNAi vector for suppressing the expression of the tlg1 gene.

  The antisense vector has an appropriate base sequence consisting of 100 bases or more, preferably 100 to 1000 bases, more preferably 300 to 800 bases) in the cDNA sequence of tlg1 gene (sequence shown in SEQ ID NO: 2). It is produced by ligating to a vector in the antisense direction. The antisense vector suppresses the expression of the tlg1 gene by expressing an antisense RNA against the base sequence consisting of 100 bases or more in the introduced host. The construction of the antisense vector may basically be as described in the previous section.

  The RNAi vector is a vector that can suppress the expression of a target tlg1 gene in a host by RNA interference (RNAi). Specifically, the RNAi vector includes one or more consecutive base sequences consisting of at least 19 bases or more in the cDNA sequence of the tlg1 gene (sequence shown in SEQ ID NO: 2) and one or more complementary sequences thereof. It is produced so that RNA which has the inverted repeat sequence may be expressed with respect to the base sequence.

The gene repression effect of RNAi vector is generally said to depend on the length of its double-stranded region (Yang, D. et al., 2000, Curr. Biol., 10, 1191-1200), and thus the inverted repeat. It is preferable that the sequence is prepared so as to be 100 base pairs or more. Such RNAi vectors can be easily constructed according to methods well known in the art or using commercially available RNAi vectors and systems (eg, psiRNA (Invitrogen), pSUPER RNAi System ^™ (OligoEngine), etc.). it can.

  For both the antisense vector and the RNAi vector, it is preferable to use a vector suitable for the aforementioned mushrooms such as pChG.

4). Transformed Shiitake mushroom The present invention specifically suppresses the expression of the tlg1 gene of the present invention, thereby reducing the expression level of the lentinan-degrading enzyme (tlg1 protein) encoded by the gene, and lentinan degrading activity over the parent strain The present invention provides a transformed shiitake mushroom in which is suppressed.

  Methods for suppressing the expression of the tlg1 gene include, for example, antisense method, RNA interference method, gene disruption method, and co-suppression method (Napoli, C. et al. (1990), Plant Cell 2, 279-289, Van Der Krol , AR et al (1990), Plant Cell 2, 291-299).

  The antisense method and the RNA interference method can be carried out by introducing the antisense vector and the RNAi vector described in the previous section, respectively, into the protoplast of the host shiitake bacterium. As described above, the vector can be introduced into Shiitake fungi using the polyethylene glycol method, electroporation method, REMI method or the like. The transformed Shiitake bacterium is easily selected by a transformation marker gene linked in a vector.

  In the transformed shiitake mushroom of the present invention, the expression of tlg1 protein involved in the degradation of lentinan is suppressed more than that of normal shiitake mushroom (ie, parent strain). Therefore, by using this transformed shiitake bacterium, it is possible to prevent the degradation of lentinan during the preservation process after harvesting and to efficiently produce lentinan. In addition, the production of lentinan using transformed shiitake mushrooms is performed by a conventional method (for example, Chihara G. et al. (1969) Nature 222, 687-688, Chihara G. et al. (1970) Cancer Res. 30, 2776). -2781).

Hereinafter, the present invention will be described in more detail with reference to examples.
Example 1: Acquisition of tlg1 derived from Shiitake mushroom Cloning of tlg1 Lentinura Eddes (H600) strain (Kitaken Co., Ltd.) was used as a gene resource. The mycelia of Shiitake mushrooms obtained from this were collected, and total RNA was extracted according to a conventional method. Using this total RNA, tlg1 was cloned as a cDNA template synthesized with SMART cDNA synthesis kit (Clontech). Based on the N-terminal sequence of Thaumatin-like protein reported in Shiitake (Grenier et.al., Mycologia 92 (5): 841-848 (2000)), a primer was prepared and 3 'RACE was performed. . For 1st PCR, tlg-1U (TAYAAYGGNTGYCCNTTYAC: SEQ ID NO: 3) and Universal Primer Mix (Clontech) were used, and for 2nd PCR, tlg-2U (ATHTGGCCNGCNATGTTYAC: SEQ ID NO: 4) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT: SEQ ID NO: 5) were used. .

  The obtained fragment was sequenced to prepare a 5'RACE primer. In addition, cDNA for 5′RACE was prepared using GeneRacer kit (Invitrogen) using total RNA. In 1st PCR, GeneRace 5′primer (CGACTGGAGCACGAGGACACTGA: SEQ ID NO: 6) and tlg585L RACE (GGACTCGTCGTATGCGTAGGCGTAG: SEQ ID NO: 7) were used. 2nd PCR used GeneRacer 5 'Nested Primer (GGACACTGACATGGACTGAAGGAGTA: SEQ ID NO: 8) and tlg484L RACE (TGCATCCACCATCAAGACACGAGTT: SEQ ID NO: 9).

  The obtained ORF is 783 bp (SEQ ID NO: 1) and encodes a protein consisting of 260 amino acids (SEQ ID NO: 2 (including signal peptide 20aa)), and its mature protein (240 amino acids) has a molecular weight of 25 kDa and a pI value of 3.48. Estimated. When the deduced amino acid sequence was subjected to homology search, it was revealed that it showed about 40% homology with A. thaliana thaumatin-like protein. In addition, it was revealed that it contains a sequence that perfectly matches the N-terminal sequence of the previously reported Shitake mushroom Thaumatin-like protein. The expected cleavage site was also consistent with the previously reported N-terminal sequence. From the above, it was considered that tlg1 is the full-length sequence of Shiitake Thaumatin-like protein. To date, there has been no report that a full-length gene encoding a Thaumatin-like protein has been isolated in fungi. In the protein encoded by tlg1, it was revealed that a region conserved by plant Thaumatin-like protein and an additional 16 cysteine residues were conserved.

2. Southern analysis of tlg1
Genomic DNA was extracted from the cells of H600 strain using ISOPLANT (Nippon Gene Co., Ltd.). The extracted genomic DNA was cleaved with Dra I, Spe I, EcoR V, and Stu I, and a genome walking library was prepared using GenomeWalker kit (Clontech). Based on the obtained cDNA sequence, primers were prepared, genome walking was performed, and a 5374 bp genomic sequence including ORF was determined. Comparison of cDNA and genomic sequences revealed that it contains 12 introns and 13 exons (Figure 1). As a feature of the promoter, the transcription start point was 90 bp upstream from ATG, and TATA box, CAAT box, and CT rich region were confirmed. 5 μg of genomic DNA was treated with a restriction enzyme overnight, blotted by capillary blotting, and subjected to Southern analysis. The tlg1 gene probe was labeled and detected by ECL Direct Nucleic Acid Detection system (Amersham). Southern analysis suggested that it was present in several copies in the genome (Figure 1).

Example 2: Expression analysis of tlg1 gene The fruit bodies harvested at the stage when the membrane of the fungus was cut were subjected to a storage test in a desiccator at about 80% humidity and 25 ° C. Sampling was carried out every day from day 0 to day 4 (day 0 to day 4) with day 0 immediately after harvesting. Sampling was divided into patterns, umbrellas and folds and then frozen in liquid nitrogen. RNA extraction was performed using Fast RNA Pro kit (Q-BIO Gene). 10 μg of the obtained RNA was run on a 1.5% formaldehyde-denaturing gel and blotted onto IMMOBILOM-NY ⁺ (Millipore) by the capillary method. The blotted membrane was subjected to Northern analysis using a probe for each gene. Probe labeling and detection were performed by Alkphos Direct labeling and Detection system (Amersham Bioscience).

  Day 0 and day 1 were in the early stage where almost no browning was observed, day 2 and day 3 were in the middle stage where mottled browning occurred, and day 4 was in the latter stage where browning was progressing as a whole. The expression of tlg1 was hardly observed in the folds of day0, and it became clear that the expression increased during the preservation process. Although the expression pattern was slightly different at each site, the expression increased with storage at any site. From the above, it was suggested that tlg1 is involved in lentinan degradation (FIG. 2).

Example 3: Purification of tlg1 protein and analysis of various properties Purification was performed using a protein extracted from the fruiting body in the later stage of preservation. The sample ground in liquid nitrogen was suspended in an extraction buffer (200 mM sodium acetate pH 4.2), and protein was extracted. The extracted protein was precipitated with 40% ammonium sulfate. The obtained protein was subjected to gel filtration using a Superdex 75 10/30 column with a 10 mM phosphate buffer (pH 6.5) and a flow rate of 0.25 ml / min. The fraction having glucanase activity was applied to an anion exchange column. The sample was adsorbed on an anion exchange column (MonoQ 5/50 GL) and eluted with a 0-0.35 M NaCl gradient, a flow rate of 0.5 ml / min, and 10 mM phosphate buffer (pH 7.0). Glucanase activity was measured using Pakiman as a substrate and reducing sugars by the Somogi-Nelson method. The activity of releasing 1 μmol reducing sugar in one hour was defined as 1 unit. The protein concentration was measured by Bio-Rad Protein Assay (Bio-Rad). The purified glucanase was detected in a single band by SDS-PGE, and the band was detected by Western analysis using a peptide antibody of tlg1 protein (FIG. 3A). From the above, it was confirmed that the purified glucanase was encoded by tlg1. The purified glucanase (tlg1 protein) 1 was found to be able to degrade lentinan using Pakiman as a substrate (FIG. 3B).

  SDS-PAGE was performed using a polyacrylamide gel, NUP-10 (ATTO) according to the Laemmli method. The gel after electrophoresis was stained with CBB. In Western blotting, the gel after electrophoresis was blotted on PVDF by the semi-dry method. The blotted membrane was detected using a peptide antibody of tlg1 protein. Detection was performed by using ECL Direct Nucleic Acid Detection system (Amersham Bioscience) using anti-rabbit Ig (Amersham Bioscience). The expression of tlg1 protein was not observed in fresh fruiting bodies, and it was confirmed that the expression increased during the preservation process. These results suggest that tlg1 protein is involved in lentinan degradation during storage (Fig. 4).

Example 4: Production of tlg1 expression-suppressed strain In this example, a strain into which a vector in which the tlg1 ORF fragment (SEQ ID NO: 11) obtained in Example 1 was linked in the antisense direction was introduced.

  As a parent strain, a hybrid strain SR-1 was used. An antisense vector was prepared as follows. First, a pChG vector (see Japanese Patent Application Laid-Open No. 2001-321182: pChG vector) includes a chs gene promoter region and a gpd terminator region, and a hygromycin resistance gene as a marker gene. A pChG ′ vector was prepared in which a multicloning site was introduced between the gpd promoter (including the terminator region) and the terminator. The multiple cloning site of pChG ′ vector was cleaved with Not I and SacI. After cloning the ORF fragment of the tlg1 gene (SEQ ID NO: 11) into the TA vector, pCR 2.1-TOPO (Invitrogen), cleaved with Not I and Sac I, ligated into the pChG 'vector, and the tlg1 antisense vector pChG'-gtlg1a Made. The produced antisense vector is obtained from Shiitake using the REMI method (see Sato, T. et. Al., Biosci. Biotech. Biochem., 62, 2346-2350, (1998), and JP-A-11-155568). Introduced. As a result, 46 hygromycin-resistant strains were obtained, and the introduction of the vector was confirmed in 35 of them (FIG. 5).

  The effect of the transformed shiitake of the present invention can be confirmed by comparing this transformed shiitake mushroom with the lentinan degrading activity of the parent strain.

  According to the present invention, it is possible to obtain Shiitake fungi with suppressed lentinan degrading enzyme activity. Therefore, the present invention is useful for the production of lentinan having high utility value as a medicine.

FIG. 1 shows the results of Southern analysis of the tlg1 gene. Genomic DNA extracted from the mycelium of H600 strain was digested with Alw I, Acc I, Nsi I, Sal I, and ScaI, and Southern hybridization was performed using the tlg1 gene partial DNA fragment as a probe. FIG. 2 is a diagram showing the results of Northern analysis during the preservation process of the tlg1 gene. Northern blotting was performed using RNA extracted from the fruiting bodies during the preservation process, and Southern hybridization was performed using the cDNA fragment of the tlg1 gene as a probe. FIG. 3 shows an electrophoresis image obtained by purifying the tlg1 protein and the substrate specificity of the purified enzyme. A1 is obtained by electrophoresis of purified tlg1 protein by SDS-PAGE and staining with CBB. A2 is the result of Western blot analysis of purified tlg1 protein. B is the result of examining the activity of the purified tlg1 protein by the Somogi-Nelson method using various substrates. FIG. 4 is a view showing Western blot analysis using a protein extracted from the fruiting body during the preservation process of tlg1 protein. FIG. 5 is a conceptual diagram of an antisense vector for the tlg1 gene.

SEQ ID NO: 1-tlg1 gene genomic DNA SEQ ID NO: 2-tlg1 gene cDNA sequence SEQ ID NO: 3-tlg1 protein SEQ ID NO: 4-description of artificial sequence: primer SEQ ID NO: 5-description of artificial sequence: primer SEQ ID NO: 6- Description: Primer SEQ ID NO: 7-Description of Artificial Sequence: Primer Sequence Number 8-Description of Artificial Sequence: Primer Sequence Number 9-Description of Artificial Sequence: Primer Sequence Number 10-Description of Artificial Sequence: Primer Sequence Number 11-Antisense Vector Tlg1 ORF built in

Claims (11)

The tlg1 gene comprising a nucleic acid molecule of any of the following (a) to (d):
(A) a nucleic acid molecule comprising the 1292 to 3330th nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 1 (b) a nucleic acid molecule comprising the 1292 to 3330th nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 1 A nucleic acid molecule derived from Shiitake fungus that encodes a protein having a lentinan degrading activity, which hybridizes with a nucleic acid molecule consisting of a base sequence complementary to DNA under stringent conditions (includes the base sequence represented by SEQ ID NO: 2) Nucleic acid molecule (d) Shiitake bacterium that hybridizes under stringent conditions with a nucleic acid molecule complementary to the nucleic acid molecule consisting of the base sequence represented by SEQ ID NO: 2 and encodes a protein having lentinan degrading activity Nucleic acid molecules   A vector comprising the tlg1 gene according to claim 1.   A transformant obtained by introducing the vector according to claim 2 into a host.   A method for producing a recombinant tlg1 protein, comprising culturing the transformant according to claim 3 and recovering a protein having endo-glucanase activity from the obtained culture solution.   A tlg1 gene expression suppression vector comprising a base sequence consisting of 100 or more consecutive bases in the sequence represented by SEQ ID NO: 2 in the antisense direction.   The base sequence consisting of 19 or more consecutive bases in the sequence shown in SEQ ID NO: 2 and its complementary sequence are each included once or more, and RNA having the inverted repeat sequence is expressed with respect to the base sequence consisting of 19 or more bases , Tlg1 gene expression suppression vector.   The vector for suppressing tlg1 expression according to claim 5 or 6, further comprising a transformation marker gene.   A transformed shiitake bacterium obtained by introducing the tlg1 gene expression suppression vector according to any one of claims 5 to 7 into a shiitake bacterium.   Transformation in which the expression of tlg1 gene in Shiitake mushroom is suppressed using any method selected from the antisense method, RNA interference method, gene disruption method, and co-suppression method, and the lentinan degradation activity is suppressed more than the parent strain How to make shiitake fungus.   A transformed shiitake fungus produced by the method according to claim 9, wherein the lentinan degrading activity is suppressed more than that of the parent strain.   A method for producing lentinan using the transformed shiitake mushroom according to claim 8 or 10.

Images