AU2020100982A4 - Wheat salt tolerance gene taaap3 and its application - Google Patents

Abstract

The invention relates to the technical fields of genetic engineering, molecular biology, genetics and breeding, in particular to a wheat salt tolerance gene TaAAP3 and its application. 5 The invention discloses the genome sequence of the amino acid permease gene TaAAP3 and the expression pattern of the gene under salt stress, and an overexpression vector containing the gene TaAAP3 and a wheat transgenic plant overexpressing the gene are obtained. The experiment proves that the salt tolerance of the transgenic wheat according to the present invention is significantly higher than that of the control (non-transgenic wheat), which can be J used for salt tolerance breeding of wheat, and has great application value. 13

Description

WHEAT SALT TOLERANCE GENE TAAAP3 AND ITS APPLICATION

TECHNICAL FIELD The invention relates to the technical fields of genetic engineering, molecular biology, genetics and breeding, in particular to a wheat salt tolerance gene TaAA3 and its application.

BACKGROUND Soil salinity has become a growing problem in global agriculture. China's salinized and J secondary salinized land accounts for about 10% of the country's cultivated land area. Among them, the Bohai Rim region is china's main saline-alkali land distribution area, with more than 666,666 hectares of saline-alkali barren land and more than 2,666,666 hectares of low- and medium-yield fields harmed by saline. As salt stress affects plant growth, photosynthesis, protein synthesis, energy metabolism and lipid metabolism, etc., under the situation of increasing population and decreasing arable land area, therefore, it is of great significance to ensure national food security and protect the ecological environment to facilitate the cultivation and improvement of new varieties of saline-tolerant crops and their application. The use of transgenic technology to introduce salt-tolerant genes into crops for genetic improvement is a technology with broad application prospects. However, it is difficult to discover salt-tolerant J genes that can be used for genetic improvement of crops from the complicated plant genomes which contains tens of thousands of genes. At present, the wheat salt tolerance genes that have been reported include TaAOC1, TaNAS1, TaCYP81, TaHKT1 and TaSTK and so on. In addition, different research teams are still exploring for genes other than the above-mentioned salt-tolerant genes. Under salt stress, plants can accumulate small molecules of nitrogenous organics (such as free amino acids, betaines, NH", urea, etc.) for metabolism or osmotic adjustment, thereby alleviating the adverse effects of salt stress on plants to a certain extent, among which the response of the free amino acid concentration is particularly sensitive, and its role cannot be ignored. Amino acid permeases (AAPs) are a class of amino acid transporters that play an important role in the content of amino acids in plants. However, there is no report about whether the AAP gene is related to plant salt tolerance.

SUMMARY In view of the lack of existing research on the AAP gene, the present invention provides a new salt tolerance gene, wheat TaAAP3, and its application. In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is: An expression vector PTCK303-TaAAP3, including the gene TaAAP3, where the nucleotide sequence of the gene TaAAP3 is shown in SEQ ID No. 1. Application of the above expression vector PTCK303-TaAAP3 in breeding a salt-tolerant plant. Preferably, the plant is wheat. 1. Clone TaAAP3 gene from wheat. J Based on the AAP3 mRNA sequence of Aegilops tauschii (GeneBank: XM020311037.1), an alignment search was performed in NCBI to obtain the wheat mRNA sequence (GenBank: AK449433.1). Primers were designed based on this sequence. A new wheat variety, Jimai 262 The genomic DNA was used as a template for PCR amplification with a fragment size of 1790bp. Cloning and sequencing obtained AAP3 genomic fragment with a length of 1780bp, as shown in SEQ ID No.1. 2. Provide the expression pattern of TaAAP3 gene under salt stress. Two-leaf-hearted Jimai 262 wheat seedlings were subjected to salt stress treatment, and the roots, stems, and leaves were sampled, RNA extracted, and reverse transcribed at Oh, 6h, 12h, and 24h, 48h after treatment and 24 hours after rehydration. Real-time quantitative PCR (QPCR) J primers QAAP3F: 5'-CGCCTACTCCTATTCGCTCATCC-3' as shown in SEQ ID No.2 and QAAP3R: 5'-ACCCTGACTTGGGCCACCTCT-3' as shown in SEQ ID No.3 were used to perform QPCR to detect the expression pattern of TaAAP3 gene under salt stress. 3. Construction of expression vector (PTCK303-TaAAP3) and wheat transgene. The PMD-18T plasmid (with a total length of about 4050bp) and the PTCK303 plasmid (about 14Kbp) containing the TaAAP3 gene were double digested with BamHI and Spel, and the TaAAP3 gene with a length of 1780 bp and a vector fragment of 14143 bp were recovered using gels. T4 ligase ligates the two fragments. The ligation product was transformed into competent cells of E. coli, and positive colonies were selected by colony PCR. The plasmid was then extracted and digested with BamHlI and SpeI endonucleases to verify the correctness of ligation of the plasmid. Finally, transfer the gene into wheat. 4. TaAAP3 gene function research Transgenic plants were planted, and young leaves were taken from a single plant to extract DNA. The transgenic plants were amplified by Hyg specific primers on the vector to obtain transgenic positive plants. The seeds of T3 generation positive plants and non-transgenic seeds were selected for salt tolerance experiments. The beneficial effects of the present invention: The present invention utilizes genetic engineering technology to obtain the wheat salt tolerance related gene TaAAP3 for the first time, and obtains the wheat salt tolerance related gene TaAAP3 over-expressing transgenic plants. Through experimental comparative analysis, it is proved that the transgenic plants have significantly improved milk salt capacity, which is broad for this gene. It provides the basis for breeding new varieties of salt-tolerant crops.

BRIEF DESCRIPTION OF THE DRAWINGS J Figure 1: Amplification of the full-length genomic PCR of the TaAAP3 gene. M=Marker (DLxxx) Figure 2: TaAAP3 gene structure map. Yellow represents exons and black represents introns. Figure 3: TaAAP3 expression pattern in wheat rhizomes and leaves under salt stress. Figure 4: Skeleton diagram of vector PTCK303. The gene position was inserted by replacing the position with the TaAAP3 gene. Figure 5: PTCK303-TaAAP3 construction process. 1 and 2 are electrophoretic bands of PMD-18T-TaAAP3 digested with BamHIand Spel endonuclease. The top is PMD-18T vector band (2692), and the bottom is the band of TaAAP3 gene. 3 and 4 are electrophoresis bands after J digestion with Spel endonuclease. M=Marker (DL2000) Figure 6: PCR detection of positive plants: 1 is the positive control (expression vector PTCK303 + TaAAP3); 2-12 are the transgenic plants; the bands are positive plants, and M=Marker (DL2000). Figure 7: Comparison of transgenic lines and control lines under salt stress.

DESCRIPTION OF THE EMBODIMENTS The following examples are for better understanding of the present invention, but are not limited to the present invention. The test methods in the subordinate examples are conventional methods unless otherwise specified. Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores. For the quantitative tests in the following examples, three repeated tests are set, and the results are averaged. Example 1 Cloning and Obtaining TaAAP3 Gene from Wheat 1. Primer design

A search was performed on the NCBI with the mRNA sequence of Aegilops AAP3 (GeneBank: XM_020311037.1) to obtain the wheat mRNA sequence (GenBank: AK449433.1). The primer sequence was designed as follows: TAAPCF1: ATGGGGGAGAACGGCGTGGGCAAGAACTAC (SEQID No. 5), TAAPCR1: GGACTAGTCCTCAGTCAGTTGTGAAGAACGGCTTGTAG (SEQ ID No.

4); The above primers (the bases with horizontal lines at the bottom of the primers are the restriction sites of the introduced Spel endonuclease to facilitate the construction of subsequent expression vectors) were used to amplify the genomic DNA of the new wheat cultivar Jimai J 262.

2. PCR reaction system and procedure 50pl reaction system:

Reagent Amount 10 xEasyPfu buffer (with Mg2 +) 5 pl dNTPs (2.5mM) 5 pl TAAPCFl primer (10gM) 1 pl TAAPCR1 primer (10gM) 1 pl Genome DNA 2 pl EasyPfu enzyme 1 pl ddH 20 35 gl Total 50 pl

The PCR reaction program is: 94°C for 4min; 94°C for 30s, 60°C for 30s, 72°C for 4min, (35 cycles); 72°C for 10min.

3. 1% agarose gel electrophoresis The PCR amplified product was detected by 1% agarose gel electrophoresis and a band with a size of 1790bp was found (Figure 1).

4. Recovery of amplified fragments and ligated with the vector After the amplified fragment was recovered, it was ligated with PMD-18T vector to obtain PMD-18T-TaAAP3 containing wheat TaAAP3 gene. The ligation system was:

Reagent Amount

PMD-18Tvector 1 1u

Gel recovery products 2 1u

Solution I 5 1d

ddH 20 2 1u

Total 10 1d

5. Sequencing The PMD-18T-TaAAP3 containing the wheat TaAAP3 gene was sent to Shanghai Biological Engineering Co., Ltd. for sequencing, and the genome sequence of TaAAP3 (NCBI accession number MN184741) was obtained as shown in SEQ ID No.l. The online software Augustus (http://bioinf.uni-greifswald.de/augustus/) was used to analyze the fragment and found that the DNA fragment contains the complete TaAAP3 genomic fragment (the fragment includes the start codon ATG and stop codon TGA). The TaAAP3 genomic fragment contains 4 exons and 3 introns (Figure 2). The CDS is 1476bp in length and encodes 491 amino acids. Sequence J alignment revealed that the DNA fragment had 97.3% similarity to the AAP3 gene of Aegilops and 95.7% to the AAP3 gene of barley. Therefore, the gene was named TaAAP3.

Example 2 Expression pattern of TaAAP3 gene under salt stress Design of primers based on the cloned TaAAP3 cDNA sequence QAAP3F: CGCCTACTCCTATTCGCTCATCC (SEQID No. 2), QAAP3R: ACCCTGACTTGGGCCACCTCT (SEQID No. 3); Select Jimai 262 full seeds and place them in a 9 cm diameter petri dish. After constant temperature cultivation at 25°C for 3 days in a light incubator, select seedlings with consistent growth status and transplant them into a plastic culture box. Cultivated to two leaves and one heart with 1/2 Hogland culture solution, and used for salt stress treatment: the material to be treated is grown in an aqueous solution containing 250 mmol / L NaCl; the processing time is 0 h, 6 h, 12 h, 24 h, 48 h, and 24 hours after rehydration. The sampling positions are roots, stems and leaves. The extracted materials were used to RNA extraction and reverse transcription. The RNA extraction method is: (1) Fully pre-cool the mortar with liquid nitrogen, take about 0.2g of the sample, put it in the mortar, and grind it with a pestle, and continuously add liquid nitrogen until it is ground into a powder; (2) Add 1ml of RNAiso Plus (Bao Bioengineering Co., Ltd., Dalian, China) to the mortar, completely cover the sample ground into powder, and continue grinding to fully homogenize; (3) Transfer the homogenate to a 1.5 ml centrifuge tube, and let stand at room temperature (15-30°C) for 5 minutes, and centrifuge at 12,000 rpm for 5 minutes at 4°C; (4) Aspirate the supernatant, add 1/5 volume of chloroform (about 200 l), shake until the solution is fully emulsified, and let stand at room temperature for 5 minutes; (5) Centrifuge at 12,000 rmp at 4°C for 15 minutes; (6) Carefully remove the centrifuge tube from the centrifuge. At this time, the homogenate is divided into three layers, that is, a colorless supernatant, a white protein layer in the middle, and a colored lower organic phase. Transfer the supernatant to another new centrifuge tube; J (7) Add equal volume of isopropanol to the supernatant, mix thoroughly by inverting the centrifuge tube, and let stand on ice for 10 minutes; (8) Centrifuge at 12,000 rpm for 10 minutes at 4°C. Generally, after centrifugation, RNA precipitation will appear at the bottom of the test tube; (9) Carefully discard the supernatant, slowly add 1ml of pre-chilled 75% ethanol prepared with RNase-free water along the centrifuge tube wall, gently wash the tube wall upside down, and centrifuge at 12,000 rpm at 4°C for 5 minutes. Discard ethanol (10) Dry the precipitate at room temperature for 2-5 minutes, and add an appropriate amount of RNase-free water to dissolve the precipitate.

J The reverse transcription method is: 1. The system for removing genomic DNA is: Reagent Amount 5xgDNA Eraser Buffer 2 [L gDNA Eraser 1 [L Total RNA 2 L RNA Free dH2 0 5 L Total 10 pL 42°C for 2min.

2. Reverse transcription reaction Reagent Amount Reaction solution of step 1 10 L PrimeScript RT Enzyme Mix I 1 L RT Primer Mix I L 5xPrimeScript Buffer 2 (forRealTime) 4 pL RNase Free dH20 4 [L Total 20 [L

Store at 37°C for 15min, 85°C for 5s, and store at 4°C. The above primers were used for real-time quantitative PCR.

Real-time quantitative reaction system: Reagent Amount TB Green Premix Ex Taq II (Tli RNaseH Plus) (2x) 10 pL RT reaction (dilution of cDNA) 2 pL QAAP3F Primer (0pIM) 1 pL QAAP3RPrimer (0pIM) 1 pL dH 20 6 pL Total 20 L

The reaction steps are: 95°C 30 s; 95°C 5s, 60°C 31s, 40 cycles. It was found that the expression pattern of TaAAP3 in rhizomes and leaves changed under salt stress, indicating that the gene responded to salt stress (Figure 3).

Example 3 Construction of expression vector (PTCK303-TaAAP3) and wheat transgene J The PMD-18T plasmid containing the target gene TaAAP3 gene was double digested with BamHlI and Spel endonuclease, and the small fragments after digestion were gel-recovered. At the same time, PTCK303 (Figure 4) was performed double-enzyme digestion using BamHI and Spel endonuclease (Figure 5), the gel recovered large fragments, and the two fragments recovered by gel were ligated with T4 ligase. The ligation product was transformed into competent E. coli cells, and colony PCR verified positive colonies. Then the positive colonies were expanded and cultured, and the plasmid was extracted. The plasmid was double-digested with BamHlI and Spel endonuclease to verify whether the size of the fragment after digestion was the same as the size of the target gene. The plasmid was transferred into Agrobacterium for wheat transgene.

The enzyme digestion reaction system is:

Plasmid (PMD-l8T plasmid or PTCK303) 2 pL Restriction enzyme Spel 2 pL

Restriction enzyme BamHI 2 pL

10 xbuffer 5 pL ddH20 To 50 pL 37°C for 2 h.

Example 4 Salt tolerance experiment of transgenic plants The transgenic plants were planted in the transgenic wheat base of Shandong Academy of

Agricultural Sciences. DNA was extracted from the young leaves of each plant, and the transgenic plants were amplified by Hyg specific primers on the vector to obtain transgenic positive plants (Figure 6). The seeds of T3 generation positive plants and non-transgenic seeds were selected for salt tolerance experiments. The relative salt damage index, relative root length and relative seedling length were used to investigate the salt tolerance of the plants. The experimental steps are as follows: 1. The experiment consists of one control and one treatment, repeated three times. For each repetition, 50 full and undamaged seeds were selected and sterilized with 0.1% HgCl2 for 10 minutes. After rinsing with sterilized water twice, they were placed in a petri dish covered with J two layers of filter paper. In treatment group, add 10 mL of a 2.0% NaCl solution configured with sterilized deionized water. In the control group, 10 mL of sterilized deionized water was added to each petri dish and placed in a constant temperature box at 25°C, and cultured for 7 h under light and dark conditions each for 12 h. The relative salt damage index is the percentage of the difference between the average germination rate of the control and the salt-treated seeds in the average germination rate of the control seeds. The smaller the relative salt damage index, the stronger the salt tolerance. 2. In order to ensure the consistent growth of the seed at the seedling stage, first swell the seeds in distilled water for two days, and select 15 seeds with the same germination condition on a 20-mesh sieve. In order to allow the screen to suspend on the surface of the liquid, plastic foam J is stuck around the screen. Place the sieve in the matching plastic basin. The Hogland nutrient solution containing 1% NaCl was added to the plastic pot for 7 days, and the control group was added to the Hogland nutrient solution without NaCl for 7 days. In a light incubator with a culture condition of 25°C, light and dark treatments were performed for 12 hours each. For each treatment and control, 10 plants with more uniform growth conditions were selected to measure seedling length and root length, and 3 replicates were performed. Relative root length and seedling length are also used as an indicator to judge the salt tolerance of wheat. The larger the value, the stronger the salt tolerance is. The formula is as follows: relative seedling length (root length)= treated seedling length (root length) / control seedling length (root length). The results showed that the germination rate (35.5%) of the transgenic positive plants was significantly higher than the control (24.0%), and the relative root length (0.41) and relative seedling length (0.74) were significantly higher than the control (0.36 and 0.66) (Figure 7).

Claims (1)

Claims WHAT IS CLAIMED IS:

1. An expression vector PTCK303-TaAAP3 comprising the gene TaAAP3, wherein the nucleotide sequence of the gene TaAAP3 is shown in SEQ ID No. 1.