CN114990151A - Crop nitrogen utilization efficiency and grain yield cooperative improvement method based on gene editing technology - Google Patents

Abstract

The invention discloses a crop nitrogen utilization efficiency and grain yield collaborative improvement method based on a gene editing technology, which reduces and/or knocks out the nucleotide sequence shown in SEQ ID NO: 1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3 or the homologous gene/equivalent gene thereof in the crop, so that the grain weight, the grain number per ear and the grain protein content of the crop are simultaneously improved. The invention simultaneously mutates wheat by a genome site-directed editing technologyTaAAP3The obtained homozygous plant obviously increases the grain size, the grain number per ear and the amino acid content of the grains, and improves the grain yield and the nitrogen utilization efficiency.

Description

Crop nitrogen utilization efficiency and grain yield cooperative improvement method based on gene editing technology

Technical Field

The invention relates to the technical field of genetic engineering and crop breeding, in particular to a gene for improving the utilization efficiency and yield of a nitrogen fertilizer of wheat and application thereof.

Background

Wheat (triticum estivum L.) is one of three main grains in the world, and the improvement of the production capacity of wheat is of great importance to guarantee the global grain safety. With the increasing world population and the decreasing arable land area, increasing crop yields has always been an important goal for crop breeding improvement. The major driving force for increasing the yield of food in agricultural practice is the large application of chemical fertilizers, most of which are nitrogen fertilizers. However, excessive application of chemical fertilizer not only causes negative effects such as pollution to air, soil and water, but also brings great environmental protection pressure to sustainable development of agriculture. Currently, the utilization efficiency of nitrogenous fertilizers for wheat in China is less than 40%. To meet the demand of the current population for food, a large amount of nitrogen fertilizer input is required. Therefore, the method ensures that the yield of the wheat is continuously increased, and meanwhile, how to improve the utilization efficiency of the nitrogen fertilizer of the wheat and reduce the use amount of the nitrogen fertilizer are factors which must be considered for wheat breeding and industrial development, so that the problem of conflict between the yield increase of the wheat and the ecological environment is solved.

The wheat mainly absorbs inorganic nitrogen (including nitrate and ammonium salt) and organic nitrogen (including amino acid and polypeptide) in soil through root systems to maintain normal growth and development of plants. Plants have evolved a variety of highly efficient nitrogen uptake and transport systems for different nitrogen sources to support their growth and development in environments of different nitrogen morphologies and nitrogen levels. In recent years, the absorption and transport utilization of inorganic nitrogen by plants have been intensively studied. Among the rice inorganic nitrogen transporter family, the functions of NPF (nitrate transporter 1[ NRT1 ]/peptide transporter [ PTR ] family) members have been extensively studied. OsPTR9 (OsNPF8.20; Fang et al, 2013), NRT1.1B (OsNPF6.5; Hu et al.2015), OsNPF7.2(Wang et al.2018) and OsNPF7.7 (Huang et al.2018) can influence the number of rice tillers by adjusting the N content.

Transport and distribution of nitrogen in plants is mainly carried out in the form of amino acids (Xu et al.2012). Amino acids are important components of plant metabolism, not only as constituents of proteins, but also as carriers of organic nitrogen between important secondary metabolite precursors and plant organs (Dinkeloo et al, 2018; Tegeder, 2012; Jin et al, 2019). The amino acid transporter plays an important role in transmembrane transport of amino acid, and is directly or indirectly involved in nitrogen metabolic processes which are vital to plant growth and development. These processes include the assimilation and partitioning of amino acids within cells, short and long distance transport of amino acids, and the absorption and utilization of amino acids by the organelles (Tegeder, 2014; Tegeder and Masclaux-Daubresse, 2018).

At present, the corresponding gene research aiming at wheat is rarely reported, and no research is carried out on the transport characteristics of amino acid, the yield of wheat and the nitrogen utilization efficiency.

Disclosure of Invention

The invention aims to provide a crop nitrogen utilization efficiency and grain yield synergistic improvement method based on a gene editing technology.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows.

A crop nitrogen utilization efficiency and grain yield synergistic improvement method reduces and/or knocks out the nucleotide sequence shown in SEQ ID NO: 1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3 or the homologous gene/equivalent gene thereof in the crop, so that the grain weight, the grain number per ear and the grain protein content of the crop are simultaneously improved.

As a preferred technical solution of the present invention, the reduction/knockout of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3 or the homologous gene/equivalent gene thereof in the crop, so that the grain weight, the grain number per ear and the grain protein content of the crop are simultaneously improved.

As a preferable technical scheme of the invention, the crop is a gramineous crop.

As a preferred technical scheme of the invention, the crop is wheat.

As a preferred technical scheme of the invention, the method comprises the following steps:

A. location and naming: first SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3 are respectively named as TaAAP3-7A, TaAAP3-7B and TaAAP3-7D in sequence, and the three groups of genes are distributed on a wheat genome 7A, a wheat genome 7B and a wheat genome 7D in sequence;

B. designing a target spot: analyzing a TaAAP3 nucleotide sequence in A, B, D genome in wheat to obtain an optimal target spot;

C. sgRNA sequence design: designing a target site sequence for gene editing based on a CRISPR-GE analysis tool to construct an sgRNA sequence;

D. connecting: connecting the sgRNA sequence to a pTaU6-sgRNA vector, and connecting the Cas9 gene to a PJIT163 vector;

E. expressing: after the connection is completed, a constitutive promoter, namely a maize Ubiquitin promoter, is used for driving expression;

F. and (3) transformation: and (3) transforming the wheat callus by adopting a gene gun mediated transformation method through two linear minimum expression frames respectively containing Cas9 and sgRNA to obtain a transformed plant.

As a preferred technical scheme of the invention, in the step B, the fifth exons of TaAAP3-7A, TaAAP3-7B and TaAAP3-7D are taken as targets.

As a preferred technical solution of the present invention, in step C, the sgRNA sequence is: CGTGTACGAC TCCATGTACATGG, the last three sequences are PAW sequences.

As a preferred technical solution of the present invention, the following subsequent steps are also included after step F: G. and (3) detection: and (3) carrying out type analysis on the mutant of the transgenic line by A, B, D genome specific primer PCR-RE detection and sequencing, and screening a A, B, D genome-mutated non-transgenic homozygous TaAAP3 gene editing knockout mutant.

Adopt the produced beneficial effect of above-mentioned technical scheme to lie in: the invention improves the wheat yield and the nitrogen utilization efficiency by inhibiting the expression and/or the activity of TaAAP3 protein in wheat, creates wheat germplasm and variety with larger thousand grain weight and higher protein content, and enriches the high-yield and nitrogen-efficient materials of wheat. Specifically, the invention simultaneously mutates three sites of the TaAAP3 gene of wheat by a genome fixed-point editing technology, namely, the TaAAP3-7A, TaAAP3-7B gene and the TaAAP3-7D gene are simultaneously knocked out, the obtained homozygous plant obviously increases the grain size, the grain number per ear and the amino acid content of the grain, and the grain yield and the nitrogen utilization efficiency are improved.

Drawings

FIG. 1 shows the site distribution of the TaAAP3-7A gene, TaAAP3-7B gene and TaAAP3-7D gene.

Fig. 2 is a PCR enzymatic cleavage map and sequencing results of protoplast transient transformation to verify sgRAN activity; in the figure, 1: transformed protoplasts; 2: wild type control; 3: a wild-type mutant; 4: DNAarker.

FIG. 3 shows the result of PCR digestion of T0 transgenic plants.

FIG. 4 shows the grain size trait phenotype of T2 generation TaAAP3 gene knockout mutant wheat under different nitrogen supply levels.

FIG. 5 shows the wheat grain yield trait phenotype of TaAAP3 gene knockout mutant of T2 generation under different nitrogen supply levels.

FIG. 6 shows the wheat nitrogen utilization efficiency related traits of T2 generation TaAAP3 gene knockout mutant under different nitrogen supply levels.

Detailed Description

The following examples illustrate the invention in detail. The raw materials and various devices used in the invention are conventional commercially available products, and can be directly obtained by market purchase.

It will be understood that the terms "comprises" and/or "comprising," when used in this specification and the appended claims, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.

It should also be understood that the term "and/or" as used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

Furthermore, in the description of the present application and the appended claims, the terms "first," "second," "third," and the like are used for distinguishing between descriptions and not necessarily for describing or implying relative importance.

Reference throughout this specification to "one embodiment" or "some embodiments," or the like, means that a particular feature, structure, or characteristic described in connection with the embodiment is included in one or more embodiments of the present application. Thus, appearances of the phrases "in one embodiment," "in some embodiments," "in other embodiments," or the like, in various places throughout this specification are not necessarily all referring to the same embodiment, but rather "one or more but not all embodiments" unless specifically stated otherwise. The terms "comprising," "including," "having," and variations thereof mean "including, but not limited to," unless expressly specified otherwise.

Example 1 selection of wheat TaAAP3 target sites and construction of knock-out vectors

1. Design of target sequences

Triticum aestivum L is a hexaploid plant, and most of the genes are distributed in multiple copies on genome a, genome B, and genome D. The wheat AAP3 genes are distributed on genome 7A, genome 7B and genome 7D and are respectively named as TaAAP3-7A gene, TaAAP3-7B gene and TaAAP3-7D gene (in figure 1, the TaAAP3-7A gene, the TaAAP3-7B gene and the TaAAP3-7D gene have three sites named as wheat AAP3 genes). The target sequences are as follows: target sequence 5' -CGTGTACGACTCCATGTACATGG-3’(SEQ ID NO：4)。

2. Design of gRNA

The gRNA was designed based on the target sequence, which was: GTTCTGACCGGTTTATAAACTCGCTT GCTGCATCAGACTTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTAT (SEQ ID NO: 5).

3. Construction of recombinant plasmid

The following single-stranded primers with sticky ends (underlined) were synthesized:

AAP3-sgRNA-F:5’-CTTGCGTGTACGACTCCATGTACA-3’(SEQ ID NO：6)；

AAP3-sgRNA-R:5’-AAACTGTACATGGAGTCGTACACG-3’(SEQ ID NO： 7)；

annealing AAP3-sgRNA-F and AAP3-sgRNA-R to form double-stranded DNA with a sticky end, connecting the double-stranded DNA to a pTaU6-sgRNA vector digested by BpiI, transforming DH5 alpha bacteria, performing colony PCR on the monoclonal bacterial plaque, sequencing single spots positive to the colony PCR by using colony PCR primers of M13F and gRNA-R and about 400bp of an amplification product, shaking the bacteria to extract plasmids, namely inserting a DNA fragment 5'-CGTGTACGACTCCATGTACA-3' in the BpiI position of the digestion site of the pTaU6-sgRNA plasmid in the forward direction, and thus obtaining the recombinant plasmid.

In wheat cells, when a PJIT163-Ubi-Cas9 vector and a pTaU6-gRNA plasmid exist at the same time, the pTaU6-gRNA plasmid expresses gRNA, the gRNA guides the Cas9 protein to cut in a target sequence region to generate a double-strand break gap, and a large number of mutations (including insertion, deletion and the like, which can inactivate gene functions) are introduced during the spontaneous repair of the gap by the cells.

The target sequence has a BstXI restriction recognition sequence which can be cut by restriction enzyme BstXI, and the target sequence can be cut by restriction enzyme BstXI if the target sequence has no mutation; if a mutation occurs, the BstXI cleavage recognition sequence is destroyed and will not be cleaved by the restriction enzyme BstXI.

Example 2 transformation of wheat protoplasts and detection of the Activity of recombinant vectors in protoplasts

The constructed PJIT163-Ubi-Cas9 vector and pTaU6-gRNA plasmid are co-transformed into wheat protoplast, and after dark culture for 2 days, the genome DNA of the protoplast is extracted. The TaAAP3 gene is amplified by PCR of protoplast DNA by using a universal primer, the PCR product is 597bp, then BstXI single enzyme digestion is carried out on the PCR amplification product (if the PCR amplification product can not be cut, the designed pTaU6-gRNA is active), and the PCR amplification product which can not be cut by enzyme digestion is sequenced.

The primer pair for amplifying the TaAAP3 gene is as follows:

an upstream primer: AAGACGCATGGCAGGACTAACTGT (SEQ ID NO: 8);

a downstream primer: CTCACCGTGTCCTACGTACAACAGG (SEQ ID NO: 9);

the single cleavage and partial sequencing results for BstXI are shown in FIG. 2. The result shows that the target point has mutation after the wheat protoplast is transformed, the designed pTaU6-gRNA has higher activity, and the TaAAP3 gene has higher site-directed knockout activity.

Example 3 transformation of wheat and phenotypic characterization

1. Transformation of

PJIT163-Ubi-Cas9 and pTaU6-gRNA plasmids were introduced into wheat variety Jimai 325, respectively, by means of biolistic-mediated transformation. And amplifying the TaAAP3 gene of the obtained transgenic wheat by using a universal primer, and then carrying out BstXI single enzyme digestion on a PCR amplification product to obtain the wheat containing the uncut strip, namely the knockout mutant wheat. Designing a specific primer on A, B, D genome of TaAAP3 gene, carrying out PCR amplification and enzyme digestion on the mutant wheat by using the specific primer, further determining the specific occurrence position of mutation on A, B, D genome, and carrying out sequencing verification.

The primer pair for amplifying the TaAAP3-7A gene is as follows:

an upstream primer: TCGTCCGAGATTTTTCGCGT (SEQ ID NO: 10);

a downstream primer: ATGAGGATCATGGAATAGGAGTAGG (SEQ ID NO: 11);

the primer pair for amplifying the TaAAP3-7B gene is as follows:

an upstream primer: GTGGGCCTGTGGTGTTTTTC (SEQ ID NO: 12);

a downstream primer: TTGCCGGTTGGACCTGATAC (SEQ ID NO: 13);

the primer pair for amplifying the TaAAP3-7D gene is as follows:

an upstream primer: GTGGGCCTGTGGTGTTTTTC (SEQ ID NO: 14);

a downstream primer: CGGTAGGGCCTGATATGGTC (SEQ ID NO: 15);

in transgenic T0 generation plants, identifying a transgenic plant with mutation of a wheat TaAAP3 gene, detecting in T0 generation to obtain a transgenic plant with site-directed mutation of a wheat TaAAP3 gene, wherein a plant with site-directed mutation of a TaAAP3-7A gene, a TaAAP3-7B gene and a TaAAP3-7D gene simultaneously carries out single clone sequencing on A, B, D of a mutant plant with three mutations, and the sequencing result shows that the mutant is a homozygous mutant (the result of extracting genomic DNA from a part of transgenic plants in T0 generation and carrying out BstXI enzyme digestion is shown in figure 3, and the sequencing result is shown in figure 3).

Example 4 phenotypic Observation

(1) The TaAAP3 gene editing knockout mutant increases the size of grains, and improves the grain number and grain weight of ears

The T2 generation homozygous mutant and Jimai 325 wild seeds are sown in a field, two nitrogen fertilizer supply levels of low nitrogen (6Kg N/mu) and high nitrogen (12 KgN/mu) are set in a test, the other seeds grow and are harvested under normal conditions, the number of grains per ear, the size of grains, the thousand kernel weight, the yield, the nitrogen concentration of the grains, the protein and amino acid content, the nitrogen harvest index and other properties are determined and analyzed in the wheat harvest period, each material has 4 repetitions, and the results are shown in the following chart.

The TaAAP3 gene editing knockout mutant line had significantly higher grain length and grain width than the wild type control (fig. 4) at either low (6Kg N/acre) or high (12Kg N/acre) nitrogen supply levels, but had no significant effect on the tillering trait. Meanwhile, the yield traits of the grains are examined, the ear grain number, thousand grain weight and the grain yield of homozygous plants with mutation of the TaAAP3-7A gene, the TaAAP3-7B gene and the TaAAP3-7D gene are obviously improved compared with wild wheat (figure 5), the thousand grain weight is improved by 6.13-9.94% and 5.79-8.55% under low nitrogen and high nitrogen levels, and the grain yield is improved by 10.22-16.83% and 9.59-18.98%. Therefore, the TaAAP3 gene has obvious negative regulation and control effects on grain size, grain number per ear and yield.

(2) The TaAAP3 gene knockout mutant improves the nitrogen concentration and nitrogen harvest index of wheat grains

Through analyzing the nitrogen utilization efficiency related traits of the obtained TaAAP3 gene knockout mutant strain, under the supply levels of low nitrogen (6Kg N/mu) and high nitrogen (12Kg N/mu), compared with wild wheat, the nitrogen concentration, the protein content and the grain storage amino acid content of grains of a homozygous plant in which the TaAAP3-7A gene, the TaAAP3-7B gene and the TaAAP3-7D gene are mutated at the same time are all obviously higher than those of the wild wheat. The knockout of the TaAAP3 gene in wheat is shown to not reduce the protein content of grains (fig. 6), but improve the grain storage amino acid content and Nitrogen Harvest Index (NHI).

In the above embodiments, the descriptions of the respective embodiments have respective emphasis, and reference may be made to the related descriptions of other embodiments for parts that are not described or illustrated in a certain embodiment.

In summary, according to the present invention, based on the sequence information of AAP3 gene (Ensembl ID: LOC _ Os06g36180) of rice, by searching database of Ensembl plants (IWGSC, 2018) through bioinformatics method, we identified the homologous gene of AAP3 in wheat, located on 7A, 7B, 7D chromosome of wheat, and cloned three coding genes of TaAAP3, named TaAAP3-7A, TaAAP3-7B and TaAAP3-7D, respectively. Analyzing a TaAAP3 nucleotide sequence in A, B, D genome in wheat, designing a target site sequence for gene editing by using a CRISPR-GE online analysis tool and taking fifth exons of TaAAP3-7A, TaAAP3-7B and TaAAP3-7D as targets to construct a sgRNA sequence (CGTGTACGAC TCCATGTACA)TGGPAW is underlined) and ligated to the pTaU6-sgRNA vector, and a map was constructed as shown in FIG. 2. Cas9 gene is connected to PJIT163 vector, and constitutive promoter corn Ubiquitin promoter is used for driving expression. Adopting a gene gun mediated transformation method, transforming wheat callus by 2 linear minimum expression frames respectively containing Cas9 and sgRNA, wherein the 2 linear minimum expression frames do not contain vector skeletons. 94 transformed plants are obtained in total, and the type of a mutant of a transgenic line is analyzed by A, B, D genome specific primer PCR-RE detection and sequencing, so that a non-transgenic homozygous TaAAP with A, B, D genome mutation (aap-30, aabbdd) is screened3 gene editing knockout mutants. The invention discovers that the TaAAP3 gene has important influence on wheat grain weight, grain number per ear and grain protein content, and can be applied to the synergistic improvement of plant nitrogen utilization efficiency and grain yield, thereby realizing the fertilizer saving and synergism of crops.

The above-mentioned embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the same; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; such modifications and substitutions do not substantially depart from the spirit and scope of the embodiments of the present invention, and are intended to be included within the scope of the present invention.

Sequence listing

<110> institute of grain and oil crops of academy of agriculture, forestry and science of Hebei province

<120> crop nitrogen utilization efficiency and grain yield synergistic improvement method based on gene editing technology

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1479

<212> DNA

<213> wheat (Triticuma estivum L)

<400> 1

atgaccaagg acgtggagat ggcggcgcgg aacggcggca acggcgccgt cgccggcgag 60

gcctactacc cctctccccc ggcgcagggc ggcgacgccg acgtggacga cgacggcaag 120

cagcggcgca cagggacggt atggacagcg agcgcgcaca tcatcaccgc cgtcatcggc 180

tccggcgtgc tctccctcgc ctgggcaacg gcgcagctgg gctgggtcgt cgggccgatc 240

accctgatgc tcttcgcggc gatcacctac tacacctccg gcctcctcgc ggactgctac 300

cgcaccggcg atccgctcac cgggaagagg aactacacct acatggacgc cgtcgcatcc 360

tacttgagtc gtgggcaagt gtgggcctgt ggcgttttcc agtacgtcaa cttggtcggg 420

actgcaatcg ggtacacgat cacagcgtcc atcagcgcgg ctgctataaa caaggccaac 480

tgcttccaca agaacggccg ggcggcggac tgcggcgtgt acgactccat gtacatggtg 540

gtgttcgggg tcgtccagat cttcttctcc caggtgccca acttccacga cctttggtgg 600

ctctccatcc tcgccgccgt catgtctttc acctacgcct ccatcgccgt cggcctctcc 660

ctggcgcaga ccatatcggg cccaaccggc aaggccaccc tgaccggcac cgaggttggc 720

gtggacgtcg attcggccca gaagatctgg ctcgcgttcc aggcgctcgg cgacatcgcc 780

ttcgcctact cctattccat gatcctcata gaaatccagg acacggtgag gtctccgccg 840

gcggagaaca agacgatgaa gaaggcgacc ctggtggggg tgtccaccac gacggccttc 900

tacatgctgt gcggctgcct gggctacgcg gcgttcggca acggcgccaa ggggaacatc 960

ctcaccggct tcggcttcta cgagccctac tggctcatcg acttcgccaa cgtgtgcatc 1020

gtggtgcacc tggtgggcgc ctaccaggtg ttctgccagc ccatcttcgc cgctgtcgag 1080

accttcgccg cggccacctg gcccaacgcc gggttcatca cccgcgagca ccgcgtcgcc 1140

gccggcaacg gcaagcggct cggcttcaac ctcaacctct tcaggctgac gtggaggacg 1200

gcgttcgtga tggtgagcac gctgctggcc atcctcatgc ccttcttcaa cgacatcctc 1260

ggcttcctgg gcgccatcgg cttctggccg ctcaccgtct acttccccgt ggagatgtac 1320

atccggcagc gcgggatacc gaggtacacg acgaggtggg tggcgctgca gacgctcagc 1380

ttcctctgct tcctggtgtc gctcgccgcg gcggtcgcgt ccatcgaggg cgtcacggag 1440

tcgctcaaga actacgtccc gttcaagacc aagtcgtga 1479

<210> 2

<211> 1473

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaccaagg acgtggagat ggcggcgcgg aacggcagca acggcgccgt cgccggcgag 60

gcctactacc cccctccccc ggcgcagggc ggcgacgtcg acgtggacga cgacggcaag 120

cagcggcgaa caggcacggt atggacagcg agcgcgcaca tcatcacggc cgtcatcggc 180

tccggcgtgc tgtccctcgc ctgggcgacg gcgcagctgg gctgggtcgt cgggccggtc 240

accctgatgc tcttcgcagc aatcaccttc tacacctccg ggctcctcgc cgactgctac 300

cgcaccggcg atgcgctcac cgggaagaga aactacacct acatggacgc cgtcgcatcc 360

tacttgagtc ggccgcaagt gtgggcctgt ggtgtttttc agtacgtcaa cttggtcgga 420

actgcaatcg ggtacacgat cacggcgtcc atcagcgcgg ctgctataaa caaggccaac 480

tgcttccaca agaacggccg ggcggccgac tgcggcgtgt acgactccat gtacatggtg 540

gtgttcgggg tcgtccagat cttcttttcc caggtcccca acttccacga cctgtggtgg 600

ctctccatcc tcgcggcggt catgtcgttc acctacgcct ccatcgccgt cggcctctcc 660

ctggcgcaga ccgtatcagg tccaaccggc aaggccaccc tgaccggcac cgaggttgga 720

gtggacgtcg attcggccca gaagatctgg ctcgcgttcc aggcgctcgg tgacatcgcc 780

ttcgcctact cctactcgat gatcctcata gaaatccagg acacggtgag gtcgccgccg 840

gcggagaaca agacgatgaa gaaggcgacc ctggtgggag tctccaccac gacggccttc 900

tacatgctgt gcggctgcct cggctacgcg gcgttcggca acggcgccaa ggggaacatc 960

ctcaccggct tcggcttcta cgagccctac tggctcatcg acttcgccaa cgtctgcatc 1020

gtggtgcacc tggtgggcgc ctaccaggtg ttctgccagc ccatcttcgc cgccgtcgag 1080

ggcttcgcgg ccgcgacctg gcccaacgcc gggttcatca cccgcgagca ccgcgtcgcc 1140

accggcaagc ggctcggctt gaacctcaac ctcttcaggc tgacgtggag gacggcgttc 1200

gtgatcgtga gcacgctgct cgccatcctc atgcccttct tcaacgacat cctcggcttc 1260

ctgggcgcca tcgggttctg gccgctcacc gtctacttcc ccgtggagat gtacatccgg 1320

cagcgcggga taccgaggta cacgacgagg tgggtggcgc tgcagacgct cagcttcctc 1380

tgcttcctgg tgtcgctggc tgcggcggtc gcgtccatcg agggggtcac ggagtcgctc 1440

aagaactacg tccctttcaa gaccaagtca tga 1473

<210> 3

<211> 1473

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgaccaagg acgtggagat ggcggcgcgg aacggcagca acggcgccgt cgccggcgag 60

gcctactacc cccctccccc ggcgcagggc ggcgacgtcg acgtggacga cgacggcaag 120

cagcggcgaa cagggacggt atggacagcg agcgcgcaca tcatcacggc cgtcatcggc 180

tccggcgtgc tctccctcgc ctgggcgacg gcgcagctcg gctgggtcgt ggggccagtc 240

accctgatgc tcttcgcggc gatcacctac tacacctccg gcctcctcgc cgactgctac 300

cgcaccggcg atgcgcacac cgggaagaga aactacacct acatggacgc cgtcgcatcc 360

tacttgagtc ggccgcaagt gtgggcctgt ggtgtttttc agtacgtcaa cttggtcggg 420

actgcaatcg ggtacacgat cacagcgtcc atcagcgcgg ctgctataaa caaggccaac 480

tgcttccaca agaacggccg ggcggccgac tgcggcgtgt acgactccat gtacatggcg 540

gtgttcgggg tcgtccagat cttcttctcc caggtcccca acttccacga cctgtggtgg 600

ctctccatcc tcgcggcggt catgtcgttc acctacgcct ccatcgccgt cggcctctcc 660

ctggcgcaga ccatatcagg ccctaccggc aaggccaccc tgaccggcac cgaggttgga 720

gtggacgttg attcggccca gaagatctgg ctcgcgttcc aggcgctcgg cgacatcgcc 780

ttcgcctact cctactccat gatcctcata gaaatccagg acacggtgag gtcaccgccg 840

gcggagaaca agacgatgaa gaaggcgacc ctggtgggag tctccaccac gacggccttc 900

tacatgctgt gcggctgcct cggctacgcg gcgttcggca acggcgccaa ggggaacatc 960

ctcaccggct tcggcttcta cgagccctac tggctcatcg acttcgccaa cgtctgcatc 1020

gtggtgcacc tggtgggcgc ctaccaggtg ttctgccagc ccatcttcgc cgccgtcgag 1080

ggcttcgcgg ccgcgacctg gcccaacgcc gggttcatca cccgcgagca ccgcgtcgcc 1140

gccggcaagc ggctcggctt caacctcaac ctcttcaggc tgacgtggag gacggcgttc 1200

gtgatcgtga gcacgctgct ggccatcctc atgcccttct tcaacgacat cctcggcttc 1260

ctgggcgcca tcgggttctg gccgctcacc gtctacttcc ccgtggagat gtacatccgg 1320

cagcgcggga taccgaggta cacgacgagg tgggtggcgc tgcagacgct cagcttcctc 1380

tgcttcctgg tgtcgctcgc ggcggcggtc gcgtccatcg agggggtcac ggagtcgctc 1440

aagaactacg tcccgttcaa gaccaagtca tga 1473

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgtgtacgac tccatgtaca tgg 23

<210> 5

<211> 87

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gttctgaccg gtttataaac tcgcttgctg catcagactt ggttttagag ctagaaatag 60

caagttaaaa taaggctagt ccgttat 87

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cttgcgtgta cgactccatg taca 24

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aaactgtaca tggagtcgta cacg 24

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aagacgcatg gcaggactaa ctgt 24

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctcaccgtgt cctacgtaca acagg 25

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcgtccgaga tttttcgcgt 20

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atgaggatca tggaatagga gtagg 25

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gtgggcctgt ggtgtttttc 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttgccggttg gacctgatac 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtgggcctgt ggtgtttttc 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cggtagggcc tgatatggtc 20

Claims (9)

1. A crop nitrogen utilization efficiency and grain yield synergistic improvement method is characterized in that: reducing and/or knocking out the amino acid sequence of SEQ ID NO: 1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3 or the homologous gene/equivalent gene thereof in the crop, so that the grain weight, the grain number per ear and the grain protein content of the crop are simultaneously improved.

2. The method of claim 1, wherein: simultaneously reducing/knocking out SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3 or the homologous gene/equivalent gene thereof in the crop, so that the grain weight, the grain number per ear and the grain protein content of the crop are simultaneously improved.

3. The method of claim 1, wherein: the crop is a gramineous crop.

4. The method of claim 1, wherein: the crop is wheat.

5. The method of claim 4, wherein: the method comprises the following steps:

A. location and naming: first SEQ ID NO: 1. SEQ ID NO: 2. SEQ ID NO: 3 are respectively named asTaAAP3-7A、TaAAP3-7BAndTaAAP3-7D，the three groups of genes are sequentially distributed on a wheat genome 7A, a wheat genome 7B and a wheat genome 7D;

B. designing a target: for wheat A, B, D genomeTaAAP3Analyzing the nucleotide sequence to obtain an optimal target;

C. sgRNA sequence design: designing a target site sequence for gene editing based on a CRISPR-GE analysis tool to construct an sgRNA sequence;

D. connecting: connecting the sgRNA sequence to a pTaU6-sgRNA vector, and connecting the Cas9 gene to a PJIT163 vector;

E. expressing: after the connection is completed, a constitutive promoter, namely a maize Ubiquitin promoter, is used for driving expression;

F. and (3) transformation: and (3) transforming the wheat callus by adopting a gene gun mediated transformation method through two linear minimum expression frames respectively containing Cas9 and sgRNA to obtain a transformed plant.

6. The method of claim 5, wherein: in step B, theTaAAP3-7A、TaAAP3-7BAndTaAAP3-7Dthe fifth exon of (a) is the target.

7. The method of claim 5, wherein: in the step C, the sequence of the sgRNA is shown in SEQ ID NO: 4, respectively.

8. The method of claim 7, wherein: the last three nucleotides of the sgRNA sequence are PAW sequences.

9. The method of claim 5, wherein: the following subsequent steps are also included after step F:

G. and (3) detection: carrying out transgenic line mutant type analysis by A, B, D genome specific primer PCR-RE detection and sequencing, and screening to obtain non-transgenic homozygous mutant with A, B, D genome mutationTaAAP3A gene editing knockout mutant.

Images