CN111440808A - Plant amino acid permease and application of coding gene thereof in regulating and controlling high temperature resistance of plants - Google Patents
Plant amino acid permease and application of coding gene thereof in regulating and controlling high temperature resistance of plants Download PDFInfo
- Publication number
- CN111440808A CN111440808A CN202010238220.3A CN202010238220A CN111440808A CN 111440808 A CN111440808 A CN 111440808A CN 202010238220 A CN202010238220 A CN 202010238220A CN 111440808 A CN111440808 A CN 111440808A
- Authority
- CN
- China
- Prior art keywords
- amino acid
- plant
- coding gene
- pollen
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physiology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to the technical field of plant biotechnology and genetic breeding, in particular to application of plant amino acid permease and a coding gene thereof in regulating and controlling high-temperature resistance of plants. The invention discloses a corn amino acid permease ZmAAPa gene participating in regulating and controlling the tolerance of corn pollen to high-temperature stress. The ZmAPa gene knockout can obviously improve the tolerance of the corn pollen to high-temperature stress. According to the invention, the corn material with ZmAAPa gene knockout is obtained through CRISPR/Cas9 technology and corn genetic transformation, the ZmAAPa gene knockout remarkably improves the germination rate of corn pollen under high-temperature stress conditions, and the normal development of the pollen and anther is not influenced.
Description
Technical Field
The invention relates to the technical field of plant biotechnology and genetic breeding, in particular to application of plant amino acid permease and a coding gene thereof in regulating and controlling high-temperature resistance of plants.
Background
The influence of global warming on ecological environment is becoming serious day by day, and research reports of inter-government Climate Change special committee (IPCC) of united nations indicate that global temperature is increased by about 4 ℃ compared with the end of the twentieth century, and the increase in temperature seriously affects crop growth and threatens food safety (L obell et al, 2011).
Studies have found that plants are more susceptible to high temperatures during the reproductive growth stage, and pollen, as a male gametophyte of a plant, is more susceptible to high temperatures than a female gametophyte (L izoso et al, 2018), and is generally subject to high temperature stress in an environment higher than the optimum temperature by 5 ℃.
Corn is an important food and feed crop and is widely grown around the world. Ear number per unit area, ear grain number and thousand grain weight are the three major factors that make up the corn yield (Cen et al, 1994). With the increase of the corn yield, the influence of the grain number per ear on the corn yield is more obvious. Pollen viability is one of the important factors affecting grain number per ear. Research shows that when the medium heat damage of more than 33 ℃ is encountered, 52.9 percent of yield can be reduced; when the heat damage is serious above 36 ℃, the production can be stopped. Temperature continuously higher than 35 ℃ affects pollen formation and pollen viability, and the damage degree is aggravated with temperature rise and prolonged duration (prune oligosperma, maize stress-resistant and disaster-reducing cultivation [ M ], 2010). Studies have shown that temperatures above 38 ℃ can prevent germination of maize pollen (Carberry et al, 1989; S-nchez et al, 2014).
Aiming at high temperature heat damage, the main measures adopted in the production currently comprise:
1. breeding and popularizing heat-resistant varieties: in order to adapt to different planting requirements, breeders cultivate a plurality of corn varieties, the heat resistance of different corn varieties has great difference, and the heat-resistant varieties can be bred to cope with high-temperature weather in summer.
2. Adjusting the seeding time, avoiding high-temperature weather: the seeding time is adjusted according to the weather, so that the high-temperature hot damage weather in summer is avoided in the silk-drawing powder-scattering period sensitive to high temperature.
3. And (3) reducing the planting density: the reasonable planting density can reduce the water and fertilizer competition among crops, make the crops grow more robust, improve the ventilation and light transmission conditions and enhance the stress resistance of the crops.
4. Strengthening field management: the field management measures such as straw returning, deep scarification, water storage and soil moisture preservation, soil fertility improvement, scientific fertilization and the like can improve field microclimate and enhance the high temperature resistance of plants.
5. Tolerance of pollen at high temperatures is increased by the exogenous application of plant hormones, and by expressing heat-shock proteins in pollen by transgenic methods (Burke and cohen, 2015), or by modulating microRNA expression (Ding et al, 2017).
However, the above methods all have some problems: the breeding of heat-resistant varieties requires a large amount of manpower, material resources and time, and the breeding is carried out by utilizing various identification modes from a plurality of varieties, and finally the heat-resistant varieties are selected for popularization and planting. Wang Anle et al identified and screened 816 parts of maize inbred lines and their resource materials from home and abroad by using the reduction degree of tassels of male flowers, the abortion degree of pollen and the elongation degree of filaments as indexes, and found that the existing high-temperature resistant materials are few (Wang Anle et al, 2003). Methods for enhancing plant tolerance through reasonable field management require the practitioner to have sophisticated field management experience and to be able to withstand high temperatures to a lesser extent. Since hormone regulation is involved in various aspects of plant growth and development, caution and reasonableness are required in spraying hormones. The stress resistance of crops is enhanced by a transgenic means is a common idea at present, and a plurality of researches show that the stress resistance of transgenic crops is obviously enhanced, but the safety of the transgenic corn is worthy of attention when the corn is used as an important grain crop, and a safety certificate can be obtained only after strict safety evaluation and intermediate experiment processes. Therefore, it is of great significance to develop an effective and easy-to-implement method for improving the high temperature resistance of plants.
Disclosure of Invention
In order to solve the technical problems in the prior art, the invention aims to provide the plant amino acid permease and the application of the coding gene thereof in regulating and controlling the high temperature resistance of plants.
In order to achieve the purpose, the technical scheme of the invention is as follows:
when the inventor of the invention researches the function of the amino acid permease ZmAAP by using the corn gene knockout mutant, ZmAAPA knockout materials with improved high temperature resistance are found, and the ZmAAP is possibly related to the high temperature resistance of corn. The nucleotide sequence of the coding region of the ZmAPa gene is shown as SEQ ID NO.2, and the coding region of the ZmAPa gene codes amino acid permease (the amino acid sequence is shown as SEQ ID NO. 1). ZmAAPa is an amino acid permease gene specifically expressed in maize anther and pollen. According to the invention, the amino acid permease ZmAAPa gene of the corn is knocked out by using the CRISPR/Cas9 technology, and the fact that the ZmAAPa knock-out can obviously improve the high temperature resistance of the corn such as pollen viability under the high temperature condition is proved.
Specifically, the technical scheme of the invention is as follows:
in a first aspect, the present invention provides the use of a plant amino acid permease, a gene encoding the same, an inhibitor of the gene encoding the same, or a biomaterial comprising the gene encoding the same or an inhibitor of the gene encoding the same for regulating the tolerance of a plant to high temperature stress.
Preferably, the tolerance of the plant to high temperature stress is tolerance of pollen of the plant to high temperature stress.
In a second aspect, the invention provides the use of a plant amino acid permease, a gene encoding the same, an inhibitor of the gene encoding the same, or a biological material comprising the gene encoding the same or an inhibitor of the gene encoding the same, for regulating pollen viability of a plant under high temperature conditions.
The pollen viability may be expressed as the germination rate of the pollen.
In a third aspect, the invention provides the use of a plant amino acid permease, a gene encoding the same, a suppressor of the gene encoding the same, or a biological material comprising the gene encoding the same or the suppressor of the gene encoding the same, for regulating pollen formation in plants under high temperature conditions.
In a fourth aspect, the invention provides the use of a plant amino acid permease, a gene encoding the same, a suppressor of the gene encoding the same, or a biological material comprising the gene encoding the same or the suppressor of the gene encoding the same, in high temperature resistant genetic breeding of plants.
Preferably, in the above application, the tolerance of the plant to high temperature stress is improved, or the pollen viability or pollen formation of the plant under high temperature conditions is improved, by inactivating the plant amino acid permease or reducing the expression level and/or activity of the plant amino acid permease.
The invention proves that the corn amino acid permease ZmAAPa can transport arginine, aspartic acid, glutamic acid, proline, gamma-aminobutyric acid and citrulline through a gene function complementation experiment.
In a fifth aspect, the invention provides the use of a plant amino acid permease, a gene encoding the same, a suppressor of the gene encoding the same, or a biological material comprising the gene encoding the same or the suppressor of the gene encoding the same for regulating the transport ability of a plant to an amino acid.
Preferably, the amino acid is one or more selected from arginine (Arg), aspartic acid (Asp), glutamic acid (Glu), proline (Pro), gamma-aminobutyric acid (GABA), citrulline (Cit).
Specifically, the expression level and/or activity of the plant amino acid permease is improved, so that the transport capacity of the plant to the amino acid is improved.
In the invention, the plant amino acid permease has an amino acid sequence shown as SEQ ID NO.1, or is an amino acid permease family homologous protein of a protein with the amino acid sequence shown as SEQ ID NO.1 in plants except corn.
Specifically, the plant amino acid permease has any one of the following amino acid sequences:
(1) an amino acid sequence shown as SEQ ID NO. 1;
(2) the amino acid sequence of the homologous protein of the plant amino acid permease family obtained by replacing, inserting or deleting one or more amino acids in the amino acid sequence shown as SEQ ID NO. 1;
(3) an amino acid sequence which has at least 80 percent of homology with the amino acid sequence shown as SEQ ID NO.1 and is a homologous protein of a plant amino acid permease family; preferably, the homology is at least 90%; more preferably 95%.
The amino acid sequence shown as SEQ ID NO.1 is the amino acid sequence of the corn amino acid permease ZmAAPA, and the amino acid permease family protein which is homologous with the corn amino acid permease ZmAAPA in other plants except the corn can be obtained by the technicians in the field through homologous alignment according to the amino acid sequence shown as SEQ ID NO. 1.
The nucleotide sequence of the coding region of the corn amino acid permease ZmAAPa gene is shown in SEQ ID NO. 2. Considering the degeneracy of the codon, all nucleotide sequences capable of encoding the maize amino acid permease ZmAAPa are within the scope of the present invention.
In the present invention, the inhibitor of the gene encoding the plant amino acid permease includes a nucleic acid, a protein, a compound or a composition capable of reducing the expression level and/or activity of the plant amino acid permease.
Preferably, the nucleic acid is a gRNA or interfering RNA.
As an embodiment of the invention, the binding target sequence of the gRNA is shown in SEQ ID NO.3 and SEQ ID NO. 4.
In the present invention, the biological material is an expression cassette, a vector or a host cell.
In a sixth aspect, the invention provides a gRNA for knocking out a ZmAAPa gene of a corn amino acid permease, wherein a binding target sequence of the gRNA is shown as SEQ ID No.3 and SEQ ID No. 4.
In a seventh aspect, the present invention provides a method for breeding a high temperature resistant plant, comprising: the expression level and/or activity of the amino acid permease of the plant is reduced by a method of gene editing, crossing, backcrossing, selfing or asexual propagation. The amino acid permease has an amino acid sequence shown as SEQ ID NO.1, or is an amino acid permease family homologous protein of a protein with the amino acid sequence shown as SEQ ID NO.1 in the plant.
Preferably, the CRISPR/Cas9 technology is utilized to knock out the plant amino acid permease, and the high-temperature resistant plant is bred.
According to the invention, a CRISPR/Cas9 technology is utilized, SEQ ID NO.3 and SEQ ID NO.4 are taken as knockout targets, a knockout strain of a ZmAAPA gene of a corn amino acid permease is obtained, and a ZmAAPA gene knockout corn material with the CRISPR/Cas9 background removed is obtained through progeny separation.
As an embodiment of the invention, the preparation method of the ZmAAPa gene knockout corn material comprises the following steps:
(1) taking sequences shown as SEQ ID NO.3 and SEQ ID NO.4 as knockout targets, and constructing a CRISPR/Cas9 gene knockout vector;
(2) transforming the CRISPR/Cas9 gene knockout vector constructed in the step (1) into agrobacterium to construct recombinant agrobacterium;
(3) infecting the young maize embryo by the recombinant agrobacterium obtained in the step (2), and screening to obtain a ZmAPa gene knockout maize plant.
In the present invention, the plant is a monocotyledon or a dicotyledon. Preferably, the plant is maize, rice or wheat. More preferably corn.
The invention has the beneficial effects that: the invention discovers that the ZmAAPa gene of the corn amino acid permease negatively regulates the tolerance of plant pollen to high temperature, the activity of the pollen of the corn under the high-temperature condition can be obviously improved by knocking out the ZmAAPa gene, and the pollen and anther of the ZmAAPa gene knock-out plant develop normally. Based on the method, the invention provides a method for improving the high-temperature resistance of corn by knocking out an amino acid permease ZmAAPa gene.
The ZmAAPA gene of the corn is knocked out by using a CRISPR/Cas9 technology, and the transferred Cas9 protein gene, gRNA and the like are removed through progeny separation, so that the high-temperature-resistant corn plant only with the ZmAAPA gene sequence subjected to frame shift mutation and without introducing any other exogenous sequence is obtained.
The invention proves that the ZmAAPa gene has the functions of transferring arginine, aspartic acid, glutamic acid, proline, gamma-aminobutyric acid and citrulline through a gene function complementation experiment.
The new functions of the ZmAAPa gene related to high temperature tolerance provided by the invention provide new gene targets and resources for breeding new varieties of high temperature resistant plants, and have important significance for agricultural production. Compared with the traditional breeding mode, the breeding period is obviously shortened and the breeding efficiency is improved.
Drawings
FIG. 1 is a strategy diagram of construction of CRISPR/Cas9 knock-out vector of ZmAAPa gene in example 1.
FIG. 2 shows the test results of Bar test paper in regenerated plants of T0 generation maize in example 3, ck-is wild maize, and 1-15 are regenerated maize plants.
FIG. 3 is the target site sequence analysis of ZmAAPA knockout maize material of example 3, wherein WT is wild-type maize and Allole 1-6 are 6 ZmAAPA knockout maize materials, respectively.
Fig. 4 is a phenotypic observation of anther development 11, 12 stages for wild type and ZmAAPa knockout corn material in example 4, WT for wild type corn and CRISPR-ZmAAPa for ZmAAPa knockout corn material.
FIG. 5 is the pollen morphology and staining observations of example 4, including scanning electron microscopy for wild type (A-C) and ZmAAPa knockout corn material (D-F) pollen morphology; i is2-KI staining for wild type and (G) ZmAAPa knockout maize material (H) pollen development; alexander staining for wild type and (I) ZmAAPa knockout of pollen viability in maize material (J); WT is wild type maize, ZmAAPa is ZmAAPa knock-out maize material.
FIG. 6 is the measurement of in vitro germination rate of pollen in example 5 at different temperatures, wherein A is the temperature above 35 ℃ when the material is taken; the air temperature of the material B is 30-35 ℃, the air temperature of the material C is lower than 30 ℃, WT is wild corn, and ZmAAPa is ZmAAPA knockout corn material.
FIG. 7 shows the strategy for constructing the pDR195-ZmAAPa vector of example 6.
FIG. 8 is the analysis result of the amino acid transport function of ZmAAPa in yeast mutant in example 6; wherein 23344c represents the positive control pDR-23344c, 22 Δ 8AA represents the negative control pDR-22 Δ 8AA, and ZmAAPa-22 Δ 8AA represents ZmAAPa-pDR-22 Δ 8 AA.
Detailed Description
Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 construction of CRISPR/Cas9 knockout vector pBUE-ZmAAPa
In order to realize the knockout of an amino acid permease ZmAAPA gene (an amino acid sequence of a coding protein is shown as SEQ ID NO.1, and a nucleotide sequence is shown as SEQ ID NO. 2) in corn, a knockout vector pBUE-ZmAAPA for knocking out the ZmAAPA gene by using a CRISPR/Cas9 technology is constructed in the embodiment (the construction strategy is shown as figure 1).
The sequence with NGG target site in ZmAAPa gene is first screened out by CRISPR-P L ANT (http:// www.genome.arizona.edu/CRISPR/CRISSPRsearch. html) website, and then off-target condition is evaluated by Cas-OFFinder (http:// www.rgenome.net/Cas-off /) website.
Designing primers MT1T2-A-F0/R0 and MT1T2-A-BsF/BsR according to the target site sequence, carrying out four-primer amplification by taking pCBC-MT1T2(Xing et al, 2014) diluted by 100 times as a template, carrying out amplification by taking the concentration of the primer MT1T2-A-F0/R0 in an amplification reaction system as 0.5. mu.M and the concentration of the primer MT1T2-A-BsF/BsR as 10. mu.M, carrying out amplification conditions of pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30sec, annealing at 50 ℃ for 30sec, extension at 72 ℃ for 1min, amplification for 10 cycles, denaturation at 95 ℃ for 30sec, annealing at 58 ℃ for 30sec, extension at 72 ℃ for 1min, amplification for 30min, final extension for 10. the amplified target segment comprises two sgRNAs, the size of which is 964 bp., carrying out enzyme digestion by pBbSa using pBaI enzyme and pBaI 411(Xing vector), connecting EH with EH) after being subjected to a ZsA, carrying out transformation, and constructing a transformation by using a conventional method for transforming Agrobacterium tumefaciens, and connecting the target segment by using a ZmAaDH 2, and constructing a vector for correct transformation, and using a conventional method for constructing a transformant for the target cell transformation.
The sequences of MT1T2-A-F0/R0 and MT1T2-A-BsF/Bsr are as follows (5 '-3'):
MT1T2-A-F0:GTGGACGTTGGTAGCGCGGAGGGTTTTAGAGCTAGAAATAGC；
MT1T2-A-R0：CCGAACGCCGAGTAGCCCAGGCGCTTCTTGGTGCC；
MT1T2-A-BsF：AATAATGGTCTCAGGCGTGGACGTTGGTAGCGCGGAGG；
MT1T2-A-BsR：ATTATTGGTCTCTAAACCCGAACGCCGAGTAGCCCAGG。
example 2 genetic transformation of maize immature embryos
The pBUE-ZmAAPa vector constructed in example 1 was used to transform maize embryos by Agrobacterium infection, and maize inbred line 178 was used as transformation receptor, and 12 days after pollination of the 178 inbred line was stripped. Selecting embryo with diameter of 1.5-2.0mm, light yellow color and good state, and culturing with Agrobacterium liquid (OD)600About 0.80) for 30min, the infected young embryo grows on a co-culture medium for 3 days under the dark condition of 28 ℃, then is transferred to a recovery medium for culture for 7 days, and then is transferred to a screening medium containing Basta, three rounds of screening are carried out, the concentration of Basta in the first round is 3 mg/L, the concentration of Basta in the second round is 5 mg/L, and the concentration of Basta in the third round is 8 mg/L, the screened callus is transferred to a high sucrose culture medium, after one week of dark condition of 28 ℃, the callus is transferred to a differentiation medium containing 3 mg/L Basta for illumination culture, the light cycle is 16h/8h, when the seedling differentiated from the callus grows to 3-4cm, the seedling is cut off from the callus and is transferred to a rooting medium, and when the young seedling grows outAfter the roots with a certain length are planted, the seedlings are moved to a greenhouse for hardening, and the seedlings can be moved to soil in the greenhouse for growing after the seedlings survive. And (4) carrying out self-pollination after the transgenic plant is subjected to emasculation and silking, and harvesting mature seeds. The medium formulation for each stage of corn transformation is shown in table 1.
TABLE 1 corn transformation stage Medium formulation
Example 3 detection of ZmAAPa knockout corn material
Detection of marker gene expression, namely, detecting the protein level expression of glufosinate-phosphinothricin resistance gene by using Bar test paper (purchased from Enviro L ogix, USA). A few transgenic plant leaves are quick-frozen by liquid nitrogen, ground into powder, added with a few buffer solutions (purchased from Enviro L ogix, USA) and put into the test paper, and the result can be displayed within 1-2min, if one strip is displayed, the result is negative, and if two strips are displayed, the Bar protein is successfully expressed (figure 2).
Two sgRNA target site cleavage analysis for ZmAAPa: 5'-CACCCAGAACACGGGCTCCTAC-3' and 5'-CGAAGTCCACCAGCCAGTAGGG-3', extracting a Bar test strip to detect positive corn plant genome DNA, amplifying a section of sequence including two sgRNA target sites on a target gene ZmAAPa through PCR, wherein the size of a target strip is 491bp, sequencing a PCR product, comparing the obtained product with DNAMAN software to obtain 6 sgRNA target site mutated materials (figure 3), and terminating translation at amino acids 262, 261, 242, 261 and 261 of ZmAAPa respectively to cause the loss of ZmAAPa protein function so as to successfully obtain the ZmAAPa gene knockout corn material.
Example 4 anther and pollen phenotype observations
The anther of the ZmAAPa gene knockout corn material and the anther of the wild type corn obtained in example 3 at different periods are taken and fixed in an FAA solution, the solution is vacuumized until the anther sinks to the bottom of the fixing solution, and then paraffin sections are prepared through a series of steps of dehydration, transparence, wax immersion, embedding, blocking, slicing, spreading, dewaxing and dyeing, the development of the anther is observed under an optical microscope, and the anther development of the ZmAAPa gene knockout corn material is found to be similar to the wild type without obvious abnormality (fig. 4), which indicates that the normal development of the corn anther is not influenced by the ZmAAPa gene knockout.
And (3) observing the pollen form by a scanning electron microscope: taking ZmAAPa gene knockout corn material and wild type mature anther, releasing pollen into glutaraldehyde stationary liquid, vacuumizing to enable the pollen to be placed at the bottom of the stationary liquid, fixing for 2 hours at room temperature, placing the material at 4 ℃ for storage, or sequentially placing the material in 50%, 60%, 70%, 80%, 90% and 100% ethanol for dehydration for 15min each time, performing carbon dioxide temporary drying on the dehydrated sample, spraying gold, and observing the sample by using a scanning electron microscope (S-3400N). The outer wall of the pollen, pollen shape and germination pores were observed to be similar to the wild type (A, B, C, D, E and F of FIG. 5).
By means of I2-development of pollen by KI staining: placing a fresh anther to be pollen-dispersed on a glass slide, mashing the anther with forceps, releasing pollen, and dripping 1-2 drops of the anther I2KI staining, coverslipping and viewing under a microscope. And observing 2-3 pieces of pollen with 5 visual fields for each piece, and counting the dyeing rate of the pollen, wherein the dyed bluish black pollen grains contain starch and have normal activity and the yellow brown pollen grains with dysplasia. ZmAAPa knockout material pollen was found to develop normally (G, H of figure 5).
And 3, Alexander staining for observing pollen viability: placing fresh anther to be powdered on a glass slide, mashing the anther by using tweezers, releasing pollen, dropwise adding Alexander dye solution, reacting for 10min in dark and dark places, observing under a microscope, and finding that the pollen of the ZmAAPa knockout corn material is similar to a wild type, the cell wall is dyed green, and the cytoplasm is dyed dark purple (I, J in figure 5).
Example 5 determination of in vitro pollen germination Rate at different temperatures
Collecting mature pollen of corn, recording temperature of the material, and collecting pollenGermination medium (containing 0.11g CaCl per 100m L medium) was prepared in advance2、0.00068g KH2PO4、0.01gH3PO40.01g of yeast powder, 10g of sucrose, 6g of PEG and 1g of agarose), uniformly scattering pollen on a germination culture medium, wrapping the pollen with tinfoil paper in the dark, respectively placing the pollen in an incubator at 28 ℃, 37 ℃ and 45 ℃ for in-vitro germination, and observing and counting the germination rates of wild type and ZmAPa knockout materials by using a microscope after 2 hours of germination. The method comprises the following steps of taking 6 strains each time, wherein each strain is not less than 3 strains, and the number of the pollens counted by each strain is more than 1000.
The statistical result shows that: when the air temperature reaches above 35 ℃ during material taking, the wild corn 178 pollen can hardly germinate and part of the pollen is cracked at different germination temperatures, which shows that the wild pollen activity is almost completely lost at the environment temperature of 35 ℃. ZmAAPa knockout material has pollen germination rates of 53.80% and 24.57%, respectively, at 28 ℃, 37 ℃, does not germinate at 45 ℃, is partially disrupted, but the disruption ratio (13.72%) is lower than wild type (53.97%) (a of fig. 6); when the materials are taken, the in vitro germination is carried out at the temperature of 30-35 ℃ and the germination rate of the ZmAAPa knockout material is 69.61 percent and is 27.02 percent higher than that of the wild type material; at 37 ℃ the wild type pollen failed to germinate while the ZmAAPa knock-out material still maintained a 25% germination rate, both failed to germinate and both had partial pollen breakage at 45 ℃, but the breakage rate of the ZmAAPa knock-out material pollen was 20.23% lower than the wild type (23.92%) (B of fig. 6); when the material is taken, when the temperature is lower than 30 ℃, the wild type pollen and the knockout material pollen can normally germinate at the temperature of 28 ℃, and the germination rate of the knockout material is 84.86 percent and is higher than that of the wild type pollen (53.97 percent); however, at 37 ℃, ZmAAPa knockout material and wild pollen do not germinate, and the probable reason is presumably that the temperature of material taking is too different from the germination temperature, so that the pollen cannot adapt in a short time. Pollen breakage occurred in both germination at 37 ℃ and 45 ℃, but the knockout material breakage rate (24.13%) was lower than that of the wild type (34.49%) (C of fig. 6).
The results show that the germination rate of ZmAAPa knockout material pollen is obviously higher than that of a wild type in high-temperature stressed weather, the high-temperature tolerance is improved, the yield loss of the corn in high-temperature heat damage is reduced, and the ZmAAPa knockout material pollen has important significance for agricultural production.
Example 6 cloning of ZmAAPa Gene and analysis of amino acid transport function
Primers ZmAAPA-F: 5'-GTATAGCGGAGAGGTTGATG-3' and ZmAAPA-R: 5'-GAGCTACATATGGGACCGT-3' are designed according to the cDNA sequence of ZmAAPA gene (GRMZM2G331283) in database maizeGDB (www.maizegdb.org), maize inbred line 178 is used as a material, mature anther total RNA is extracted, RT-PCR amplification is carried out, reaction conditions are 95 ℃,30sec, 58 ℃,30sec, 72 ℃,30sec, 30 cycles, amplification products are connected with T vector pMD-19T, escherichia coli DH5 α is transformed, and recombinant plasmid is obtained, and sequencing results show that the total length of the cloned ZmAAPA coding sequence is 1410bp (shown as SEQ ID NO. 2) and a protein containing 469 amino acid residues (shown as SEQ ID NO. 1) is coded.
To determine the amino acid transport function of ZmAAPa, functional complementation experiments were performed in yeast mutants. First, a pDR195-ZmAAPa vector was constructed, the vector construction strategy is shown in FIG. 7, and a primer XhoI-A2-F with XhoI and BamH I cleavage sites was designed based on the multiple cloning site of the yeast expression vector pDR195(Fischer et al, 2002): 5'-CCCTCGAGATGCGTGACGGA-3' and BamHI-A2-R: 5'-CGGGATCCTCACGACCTGGT-3', amplifying the ZmAAPa gene with the above two enzyme cutting sites by PCR, recovering the target fragment with the size of about 1.4kb and connecting the target fragment with the pMD-19T vector, selecting positive single clone to sequence, carrying out enzyme cutting by using Xho I and BamH I after the sequencing is correct, recovering the target fragment, and connecting the target fragment to the enzyme cutting site which is the same as the pDR 195. The expression vector constructed by PCR and enzyme digestion identification is correct.
Saccharomyces cerevisiae mutant (Saccharomyces cerevisiae mutant)22 Δ 8AA is unable to take up translocated arginine, aspartic acid, glutamic acid, proline, gamma-aminobutyric acid and citrulline (Fischer et al, 2002). The successfully constructed pDR195-ZmAAPa vector is transformed into a yeast mutant strain 22 delta 8AA by a heat shock method and named as ZmAAPa-pDR-22 delta 8AA, the vector pDR195 plasmid is transformed into a yeast strain 23344c and named as pDR-23344c as a positive control, and the vector pDR195 is transformed into 22 delta 8AA and named as pDR-22 delta 8AA as a negative control.
The transformed yeast strain is coated on YNB solid screening culture medium and cultured for 3d at 30 ℃, and the culture medium is (NH)4)2SO4Is the only nitrogen source, and sucrose is the only carbon source. Positive monoclonals were picked for gradient dilution (10)0,10-1,10-2,10-3,10-4) At 1mM or 3mM (NH), respectively4)2SO4And 1mM or 3mM of six different amino acids (Arg, Asp, Cit, GABA, Glu and Pro) as the sole nitrogen source, and cultured at 30 ℃ for 3 days. The growth was observed at 1mM or 3mM (NH)4)2SO4The positive and negative control and transformant samples grew well on the medium with the only nitrogen source, indicating that the positive and negative control and transformant can all use the nitrogen source (NH) in the medium4)2SO4(ii) a Positive clones grew well and clones transformed with pDR195-ZmAAPa grew more vigorously than negative clones on medium with 1mM or 3mM of six different amino acids as the sole nitrogen source (FIG. 8). The results show that ZmAAPa has the function of amino acid transport, can transport arginine, aspartic acid, glutamic acid, proline, gamma-aminobutyric acid and citrulline, and is a broad-spectrum amino acid transporter.
Reference documents:
Barnabás,B.,Jager,K.,Fehér,A.(2008).The effect of drought and heatstress on reproductive processes in cereals.Plant Cell Environ 31,11-38.
Burke,J.J.,Chen,J.P.(2015).Enhancement of reproductive heat tolerancein plants.PLoS One 10,e0122933.
Carberry,P.S.,Muchow,R.C.,McCown,R.L.(1989).Testing the CERES-maizesimulation model in a semi-arid tropical environment.Field Crop Res.20,297-315.
Ding,Y.H.,Ma,Y.Z.,Liu,N.,Xu,J.,Hu,Q.,Li,Y.Y.,Wu,Y.L.,Xie,S.,Zhu,L.F.,Min,L.,Zhang,X.L.(2017).microRNAs involved in auxin signaling modulatemalesterility under high-temperature stress in cotton(Gossypium hirsutum).Plant J.91,977-994.
Fischer,W.N.,Loo,D.,D.F.,Koch,W.,Ludewig,U.,Boorer,K.J.,Tegeder,M.,Rentsch,D.,Wright,E.M.,and Frommer,W.B.(2002).Low and high affinity aminoacid H+-cotransporters for cellular import of neutral and charged aminoacids.Plant J.29,717-731.
Huang,X.,Wei,Z.(2005).Successful Agrobacterium-mediated genetictransformation of maize elite inbred lines.Plant Cell Tiss Organ Cult 83,187-200.
Lizaso,J.I.,Ruiz-Ramosa,M.,Rodrígueza,L.,Gabaldon-Lealb,C.,Oliveirac,J.A.,Loriteb,I.J.,Sáncheza D,Garcíad E,Rodrígueza,A.,(2018).Impact of hightemperatures in maize:Phenology and yield components.Field Crop Res.216,129-140.
Lobell,D.B.,Schlenker,W.,Costa-Roberts,J.(2011).Climate trends andglobal crop production since 1980.Science 333,616-620.
Sánchez,B.,Rasmussen,A.,Porter,J.R.(2014).Temperatures and the growthand development of maize and rice:a review.Global Change Biol.20,408-417.
Xing,H.L.,Dong,L.,Wang,Z.P.,et al.(2014)A CRISPR/Cas9toolkit formultiplex genome editing in plants.BMC Plant Biology 14,327.
cen Xiuyang (1994), a study of the analysis of factors affecting the number of corn kernels. Cultivating and cultivating: (54),54-56.
Wang Anle, Chen Chao Hui, Zhao De Lao (2003), high temperature resistant characteristic identification and screening of maize inbred material. Shanxi agricultural science: 31(4),15-17.
Although the invention has been described in detail hereinabove by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that many modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> university of agriculture in China
<120> application of plant amino acid permease and coding gene thereof in regulating and controlling high temperature resistance of plants
<130>KHP201111283.9
<160>14
<170>SIPOSequenceListing 1.0
<210>1
<211>469
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>1
Met Arg Asp Gly Gly Gly Ala Met Asp Val Asp Met Gln Ala Arg Gly
1 5 10 15
Gly Gly Ala Ser His Gly Gly Glu Leu Asp Asp Asp Gly Lys Glu Lys
20 25 30
Arg Thr Gly Thr Val Trp Thr Ala Ser Ala His Ile Ile Thr Ala Val
35 40 45
Ile Gly Ser Gly Val Leu Ser Leu Ala Trp Ala Met Ala Gln Leu Gly
50 55 60
Trp Val Ala Gly Pro Val Ile Leu Leu Leu Phe Ala Ala Ile Thr Tyr
65 7075 80
Tyr Thr Ser Cys Leu Leu Thr Asp Cys Tyr Arg Phe Gly Asp Pro Val
85 90 95
Thr Gly Lys Arg Asn Tyr Thr Tyr Thr Glu Ala Val Glu Ser Tyr Leu
100 105 110
Gly Gly Arg Tyr Val Trp Phe Cys Gly Phe Cys Gln Tyr Ala Asn Met
115 120 125
Phe Gly Thr Gly Ile Gly Tyr Thr Ile Thr Ala Ser Ala Ser Ala Ala
130 135 140
Ala Ile Leu Lys Ser Asn Cys Phe His Trp His Gly His Asp Ala Asp
145 150 155 160
Cys Thr Gln Asn Thr Gly Ser Tyr Ile Val Gly Phe Gly Val Val Gln
165 170 175
Val Ile Phe Ser Gln Leu Ser Asn Phe His Glu Leu Trp Trp Leu Ser
180 185 190
Val Leu Ala Ala Ala Met Ser Phe Cys Tyr Ser Thr Ile Ala Val Gly
195 200 205
Leu Ala Leu Gly Gln Thr Ile Ser Gly Pro Thr Gly Lys Thr Thr Leu
210 215 220
Tyr Gly Thr Gln Val Gly Val Asp Val Gly Ser Ala Glu Glu Lys Ile
225 230 235240
Trp Leu Thr Phe Gln Ala Leu Gly Asn Ile Ala Phe Ala Tyr Ser Tyr
245 250 255
Thr Ile Val Leu Ile Glu Ile Gln Asp Thr Leu Arg Ser Pro Pro Ala
260 265 270
Glu Asn Lys Thr Met Arg Gln Ala Ser Val Leu Gly Val Ala Thr Thr
275 280 285
Thr Ala Phe Tyr Met Leu Cys Gly Cys Leu Gly Tyr Ser Ala Phe Gly
290 295 300
Asn Ala Ala Pro Gly Asp Ile Leu Ser Gly Phe Tyr Glu Pro Tyr Trp
305 310 315 320
Leu Val Asp Phe Ala Asn Val Cys Ile Val Ile His Leu Val Gly Gly
325 330 335
Phe Gln Val Phe Leu Gln Pro Leu Phe Ala Ala Val Glu Ala Asp Val
340 345 350
Ala Ala Arg Trp Pro Ala Cys Ser Ala Arg Glu Arg Arg Gly Gly Val
355 360 365
Asp Val Phe Arg Leu Leu Trp Arg Thr Ala Phe Val Ala Leu Ile Thr
370 375 380
Leu Cys Ala Val Leu Leu Pro Phe Phe Asn Ser Ile Leu Gly Ile Leu
385 390 395400
Gly Ser Ile Gly Phe Trp Pro Leu Thr Val Phe Phe Pro Val Glu Met
405 410 415
Tyr Ile Arg Gln Gln Gln Ile Pro Arg Phe Ser Ala Thr Trp Leu Ala
420 425 430
Leu Gln Ala Leu Ser Ile Phe Cys Phe Val Ile Thr Val Ala Ala Gly
435 440 445
Ala Ala Ser Val Gln Gly Val Arg Asp Ser Leu Lys Thr Tyr Val Pro
450 455 460
Phe Gln Thr Arg Ser
465
<210>2
<211>1410
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atgcgtgacg gaggaggcgc catggacgtc gacatgcaag cccgcggtgg cggtgctagc 60
catggcggcg aacttgacga cgacggcaag gagaagagga cagggacggt gtggacggcg 120
tcggcgcaca tcatcacggc ggtgatcggg tccggcgtgc tgtcgctggc gtgggcgatg 180
gcccagctgg gctgggtggc cgggcctgtg atcctgctgc tcttcgcggc catcacctac 240
tacacctcct gcctcctcac cgactgctac cgcttcggcg accctgtcac cgggaagcgc 300
aactacacct acactgaggc cgtcgagtcc tacctaggcg gcaggtatgt ctggttctgc 360
ggcttctgcc agtacgccaa catgttcggc accggcatcg gctacaccat cacggcttct 420
gccagcgctg cggctatcct caagtccaac tgcttccact ggcacgggca cgacgccgac 480
tgcacccaga acacgggctc ctacatcgtc ggcttcggcg tggtgcaggt catcttcagc 540
cagctctcaa acttccacga gctctggtgg ctctccgtgc tcgcggccgc catgtccttc 600
tgctactcca ccatcgccgt cgggctcgcc ctcggccaga ccatctcagg tcccacgggc 660
aagacgacgc tctacggcac gcaggtcggg gtggacgttg gtagcgcgga ggagaagata 720
tggctgacgt tccaggctct cggcaacatc gcgtttgcct actcctacac cattgttctc 780
attgaaatcc aggacacgct gcgatctccg ccggccgaga acaagacgat gcggcaggcg 840
tcggtcctgg gcgtggcgac gaccacggcg ttctacatgc tgtgcggctg cctgggctac 900
tcggcgttcg gcaacgcggc gccgggtgac atcctgtcgg gcttctacga gccctactgg 960
ctggtggact tcgccaacgt ctgcatcgtg atccacctcg tgggcggctt ccaggtgttc 1020
ctgcagccgc tgttcgccgc ggtcgaggcc gacgtggcgg cgcgctggcc ggcctgctcc 1080
gcgcgggagc gccgcggcgg cgtcgacgtg ttccgcctgc tgtggcgcac cgcgttcgtc 1140
gcgctcatca ccctgtgcgc cgtcctgctg cccttcttca acagcatcct gggaatcctc 1200
ggcagcatcg gcttctggcc gctcaccgtc ttcttccccg tcgagatgta catccgccag 1260
cagcagatcc cgcggttcag cgccacgtgg ctggcgctgc aggccctcag catcttctgc 1320
ttcgtcatca ccgtcgcggc cggggctgcc tcggtacagg gcgtgcgcga ctcgctcaaa 1380
acctacgtgc ccttccagac caggtcgtga 1410
<210>3
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tggacgttgg tagcgcggag g 21
<210>4
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cctgggctac tcggcgttcg g 21
<210>5
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
gtggacgttg gtagcgcgga gggttttaga gctagaaata gc 42
<210>6
<211>35
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ccgaacgccg agtagcccag gcgcttcttg gtgcc 35
<210>7
<211>38
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
aataatggtc tcaggcgtgg acgttggtag cgcggagg 38
<210>8
<211>38
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
attattggtc tctaaacccg aacgccgagt agcccagg 38
<210>9
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
cacccagaac acgggctcct ac 22
<210>10
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
cgaagtccac cagccagtag gg 22
<210>11
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
<210>12
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
gagctacata tgggaccgt 19
<210>13
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
<210>14
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
cgggatcctc acgacctggt 20
Claims (10)
1. The application of plant amino acid permease, coding gene thereof, inhibitor of coding gene thereof or biological material containing coding gene thereof or inhibitor of coding gene thereof in regulating and controlling the tolerance of plants to high-temperature stress.
2. The application of plant amino acid permease, its coding gene inhibitor or biological material containing its coding gene or its coding gene inhibitor in regulating and controlling pollen activity of plant under high-temp.
3. The application of plant amino acid permease, its coding gene inhibitor or biological material containing its coding gene or its coding gene inhibitor in regulating and controlling the formation of pollen in plant at high temperature.
4. The application of plant amino acid permease, its coding gene inhibitor or biological material containing its coding gene or its coding gene inhibitor in high-temp.
5. The use according to any one of claims 1 to 4, wherein the tolerance of the plant to high temperature stress is increased, or the pollen viability or pollen formation of the plant under high temperature conditions is increased, by inactivating the plant amino acid permease or reducing the expression level and/or activity of the plant amino acid permease.
6. The application of plant amino acid permease, coding gene thereof, inhibitor of coding gene thereof or biological material containing coding gene thereof or inhibitor of coding gene thereof in regulating and controlling the transport capacity of plants to amino acid;
preferably, the amino acid is one or more selected from the group consisting of arginine, aspartic acid, glutamic acid, proline, γ -aminobutyric acid and citrulline.
7. The use according to any one of claims 1 to 6, wherein the plant amino acid permease has the amino acid sequence shown as SEQ ID No.1, or is an amino acid permease family homologous protein of a protein having the amino acid sequence shown as SEQ ID No.1 in plants other than maize.
8. The use according to any one of claims 1 to 7, wherein the inhibitor of a gene encoding a plant amino acid permease comprises a nucleic acid, protein, compound or composition capable of reducing the expression level and/or activity of the plant amino acid permease;
preferably, the nucleic acid is a gRNA or interfering RNA.
9. The use according to any one of claims 1 to 8, wherein the biological material is an expression cassette, a vector or a host cell.
10. A breeding method of high-temperature resistant plants is characterized by comprising the following steps: reducing the expression level and/or activity of the amino acid permease of the plant by a method of gene editing, crossing, backcrossing, selfing or asexual propagation;
the amino acid permease has an amino acid sequence shown as SEQ ID NO.1, or is an amino acid permease family homologous protein of a protein with an amino acid sequence shown as SEQ ID NO.1 in the plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010238220.3A CN111440808B (en) | 2020-03-30 | 2020-03-30 | Plant amino acid permease and application of coding gene thereof in regulating and controlling high temperature resistance of plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010238220.3A CN111440808B (en) | 2020-03-30 | 2020-03-30 | Plant amino acid permease and application of coding gene thereof in regulating and controlling high temperature resistance of plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111440808A true CN111440808A (en) | 2020-07-24 |
| CN111440808B CN111440808B (en) | 2021-09-14 |
Family
ID=71651168
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010238220.3A Active CN111440808B (en) | 2020-03-30 | 2020-03-30 | Plant amino acid permease and application of coding gene thereof in regulating and controlling high temperature resistance of plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111440808B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL2027897A (en) * | 2020-11-27 | 2021-07-13 | Univ Henan Agricultural | Use of gmaap protein and gmaap gene in breeding soybeans |
| CN113403331A (en) * | 2021-06-30 | 2021-09-17 | 中国烟草总公司郑州烟草研究院 | Application of tobacco NtAAP6 gene in tobacco |
| CN114990151A (en) * | 2022-04-18 | 2022-09-02 | 河北省农林科学院粮油作物研究所 | Crop nitrogen utilization efficiency and grain yield cooperative improvement method based on gene editing technology |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517837A (en) * | 2018-10-18 | 2019-03-26 | 深圳市作物分子设计育种研究院 | A kind of rice alpha-amylase and its encoding gene and application |
-
2020
- 2020-03-30 CN CN202010238220.3A patent/CN111440808B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517837A (en) * | 2018-10-18 | 2019-03-26 | 深圳市作物分子设计育种研究院 | A kind of rice alpha-amylase and its encoding gene and application |
Non-Patent Citations (2)
| Title |
|---|
| CAROL SODERLUND ET AL.: "Sequencing,mapping,and analysis of 27455 maize full-length cDNAs", 《PLOS ONE》 * |
| 李慧杰等: "转AAP1基因玉米游离氨基酸与可溶性蛋白质含量变化关系的研究", 《玉米科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL2027897A (en) * | 2020-11-27 | 2021-07-13 | Univ Henan Agricultural | Use of gmaap protein and gmaap gene in breeding soybeans |
| CN113403331A (en) * | 2021-06-30 | 2021-09-17 | 中国烟草总公司郑州烟草研究院 | Application of tobacco NtAAP6 gene in tobacco |
| CN114990151A (en) * | 2022-04-18 | 2022-09-02 | 河北省农林科学院粮油作物研究所 | Crop nitrogen utilization efficiency and grain yield cooperative improvement method based on gene editing technology |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111440808B (en) | 2021-09-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111440808B (en) | Plant amino acid permease and application of coding gene thereof in regulating and controlling high temperature resistance of plants | |
| CN108841841B (en) | Cloning of tomato transcription factor SlbZIP6 and application thereof in high temperature stress resistance | |
| CN107475210B (en) | Rice bacterial leaf blight resistance related gene OsABA2 and application thereof | |
| CN110467658B (en) | Cucumber CsGL2-LIKE gene and application thereof in regulation and control of male flower partial abortion | |
| WO2014154141A1 (en) | Mechanized seed production method using female-sterile hybrid rice plants | |
| CN107090464B (en) | Insect-resistant herbicide-resistant corn transformation event and creation method and detection method thereof | |
| CN107177610B (en) | Arabidopsis thaliana MPK gene for regulating seed size and method for increasing seed size | |
| CN107840872A (en) | Albumen and the application of wax plum CpWOX13 genes and its coding | |
| CN113455378A (en) | Breeding method of corn haploid induction line and application thereof | |
| CN109112140A (en) | Application of the OsSN28 gene in control rice high temperature resistant | |
| JP2020501549A (en) | Complex traits using tissue technology | |
| CN114752622A (en) | Application of polypeptide receptor PSKR1 gene in improving high-temperature stress resistance of tomato plants and/or tomato pollen | |
| US11840693B2 (en) | Restorer plants | |
| CN113755510B (en) | Encoding soybean FtsH metalloprotease gene GmFtsH25 and application thereof | |
| CN115873865A (en) | Application of soybean GmFAH1 gene in improving soybean drought resistance | |
| CN114736280A (en) | Application of ZmROA1 protein in regulation and control of plant tolerance | |
| CN114525300A (en) | Application of polynucleotide and protein and haploid inducing line thereof | |
| US11312967B2 (en) | Restorer plants | |
| CN116622725B (en) | Hybrid tulip tree LhMFT2 gene and application | |
| CN104673803A (en) | Application of gene methylation in gene expression regulation | |
| CN113403321B (en) | Application of OsAKR4C10 in creating non-transgenic glyphosate-resistant rice germplasm resources | |
| CN114836439B (en) | Rape BnaBPA03 gene and application and method for regulating rape plant type | |
| CN116121298B (en) | Application of inhibiting expression of HSRP1 gene in improving heat resistance of plants | |
| CN116042645B (en) | Application of corn ZmHPL gene in improving green keeping performance and photosynthesis of crops | |
| US20230348931A1 (en) | Cytoplasmic Male-Sterile Rudbeckia Plants and a Method of Production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |