CN114574507A

CN114574507A - Key gene for regulating biosynthesis of zeaxanthin palmitate and application thereof

Info

Publication number: CN114574507A
Application number: CN202210232587.3A
Authority: CN
Inventors: 刘宝龙; 宗渊; 樊光辉; 包雪梅; 李云; 曹东
Original assignee: Northwest Institute of Plateau Biology of CAS
Current assignee: Northwest Institute of Plateau Biology of CAS
Priority date: 2022-03-09
Filing date: 2022-03-09
Publication date: 2022-06-03
Anticipated expiration: 2042-03-09
Also published as: CN114574507B

Abstract

The invention provides a key gene LbPYP1 gene for regulating synthesis of zeaxanthin palmitate, and the sequence of the key gene LbPYP1 gene is shown in SEQ ID NO. 1. The LbPYP1 gene has an acyltransferase function, can promote the synthesis of carotenoid, can specifically regulate and control the palmitoylation of zeaxanthin in the medlar, convert the zeaxanthin dipalmitate into zeaxanthin dipalmitate (lycine), can also be expressed in tobacco, generates a carotenoid compound which is zeaxanthin monopalmitate and does not contain in wild type tobacco, and greatly improves the total carotenoid content of tobacco leaves. The LbPYP1 gene can be used for preparing transgenic plant varieties with high carotenoid content and high health care value, and has good application prospect.

Description

Key gene for regulating biosynthesis of zeaxanthin palmitate and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a key gene for regulating and controlling biosynthesis of zeaxanthin palmitate and application thereof.

Background

Lycium L belongs to Solanaceae (Solanaceae), and there are more than 80 species in the world, and there are 7 species and 2 varieties distributed in China. Wherein, the Lycium barbarum L has developed root system, strong cold resistance and drought resistance, wide ecological adaptability, and can be widely planted in Ningxia, Qinghai and other places in China. Medlar is a traditional and rare Chinese medicine in China, has wide application in clearing liver, improving eyesight and tonifying qi, and has high nutritive value, so that varieties such as Lycium ruthenicum Murr (Lycium ruthenicum Murr.) and Lycium xanthocarpum L.var.aurantianum K.F.ching) with the same plant phenotype and fruit type as Lycium ruthenicum have been widely paid attention by researchers for a long time except for Lycium erythropolis.

Research shows that the red medlar contains a large amount of carotenoid which can not be synthesized by human beings, and has high health care value; the carotenoid content of lycium ruthenicum is only 32% of that of lycium ruthenicum, while the carotenoid content of lycium ruthenicum is even only 1/10% of that of lycium ruthenicum. Among them, especially carotenoids formed by palmitoylation of zeaxanthin, such as zeaxanthin monopalmitate, zeaxanthin dipalmitate (lycine), etc., have many excellent effects. For example, the content of the lycium ruthenicum murr red pigment is most abundant in the lycium ruthenicum murr and accounts for more than 56-75% of the total amount of pigment substances, and researches prove that the lycium ruthenicum murr red pigment has a good liver protection effect. A plurality of reports show that the lycium erythrocin can improve liver injury, relieve hepatic fibrosis and intrahepatic oxidative stress, improve hepatic lipodystrophy and hepatitis, and has an inhibiting effect on the replication of hepatitis B virus.

The excellent health care effect of the zeaxanthin palmitate is benefited, the Chinese wolfberry variety with high zeaxanthin palmitate yield is cultivated, and the transgenic plant capable of producing the zeaxanthin palmitate has good market application value.

Disclosure of Invention

The invention aims to provide a key gene for regulating and controlling biosynthesis of zeaxanthin palmitate.

The invention provides a gene, the nucleotide sequence of which is shown as SEQ ID NO. 1.

The invention also provides a recombinant vector which comprises the nucleotide sequence shown in SEQ ID NO.1, and preferably, the recombinant vector is a pcambiac2300 vector which comprises the nucleotide sequence shown in SEQ ID NO. 1.

The invention provides a recombinant bacterium, which comprises the recombinant vector.

Further, the recombinant bacterium is a recombinant agrobacterium, preferably a recombinant agrobacterium LBA 4404.

The invention also provides a construction method of the transgenic plant for producing the carotenoid, namely the gene is transferred into the plant.

Further, the above-mentioned method for transferring into a plant is one of an Agrobacterium method, a particle gun method, an electroporation method, a PEG mediated method, a liposome method and a calcium phosphate-DNA coprecipitation method; preferably an Agrobacterium method.

Further, the plant is tobacco.

Further, the carotenoid comprises zeaxanthin palmitate, preferably zeaxanthin palmitate comprises zeaxanthin monopalmitate and/or zeaxanthin dipalmitate.

The invention also provides the application of the gene, the recombinant vector or the recombinant bacterium in preparing plant varieties for producing the carotenoid; preferably, the carotenoid comprises zeaxanthin palmitate; more preferably, the zeaxanthin palmitate comprises zeaxanthin monopalmitate and/or zeaxanthin dipalmitate.

The invention also provides the application of the gene, the recombinant vector or the recombinant bacterium in preparing a reagent for promoting the synthesis of the carotenoid; preferably, the carotenoid comprises zeaxanthin palmitate; more preferably, the zeaxanthin palmitate comprises zeaxanthin monopalmitate and/or zeaxanthin dipalmitate.

The invention has the beneficial effects that: the invention discovers that a key gene LbPYP1 gene for regulating and controlling the synthesis of lycium ruthenicum pigment in the lycium ruthenicum, and an LbPYP1 gene has the function of acyltransferase, can promote the synthesis of carotenoid, can specifically regulate and control the palmitic acid of zeaxanthin in the lycium ruthenicum pigment to be converted into zeaxanthin dipalmitate (lycium ruthenicum pigment), and improves the liver-protecting and health-care value of the lycium ruthenicum pigment. In addition, the gene can also be expressed in tobacco to generate a carotenoid compound, namely zeaxanthin monopalmitate, which is not contained in wild tobacco, and the total carotenoid content of tobacco leaves is greatly improved. The novel gene, the recombinant vector and the recombinant bacterium thereof provided by the invention can be used for preparing transgenic plant varieties with high carotenoid content and high health care value, and have good application prospects.

The lycine red pigment is also called zeaxanthin dipalmitate, zeaxanthin dipalmitate or zeaxanthin dipalmitate.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 is a photograph of the transgenic tobacco in the differentiation stage (left) and in the rooting stage (right) of a part of the transgenic tobacco.

Detailed Description

The raw materials and equipment used in the invention are known products and are obtained by purchasing commercial products.

Example 1 determination of the Gene regulating the Synthesis of Lycorine of the invention

Analysis of transcriptome of differential expression genes of lycium ruthenicum and lycium ruthenicum shows that zeaxanthin in lycium ruthenicum fruits is the carotenoid compound with the highest content, and that lycium ruthenicum pigment is just zeaxanthin as a substrate. The zeaxanthin content is increased along with the development of the yellow Chinese wolfberry fruit, the lycine erythrophyll is increased along with the development of the red Chinese wolfberry fruit, and the zeaxanthin is changed from existence to nonexistence, so that the large accumulation of the lycine erythrophyll in the red Chinese wolfberry is further proved mainly due to the palmitic acid of the zeaxanthin.

Transcriptome analysis found a novel gene: LbPYP1, and it was identified as a key gene whose transcription leads to an increase in the conversion of zeaxanthin to zeaxanthin dipalmitate (lycine rubine). The statistical results of carotenoid structural gene expression screening are shown in table 1:

TABLE 1 LbPYP1 Gene screening and statistics on the expression of Lycium ruthenicum Murr and Lycium ruthenicum Murr

The sequence of the LbPYP1 gene is as follows:

SEQ ID NNO.1：

ATGGGTGATCCAATGAAGATGGCGATGGTTAACATTGATTCCATGCTTCCTCCTGGACAAATTATTCAACGTCTCTCTGACAACCTCACTGGTTTGCTGGCACACCTCTCTGGCTTAGCTGATATCATACCGAAGGAAACTCTTCTCTGGAAGTTGAAGCTTCTTAGATCTGCTTCATCTTATTCAAATTCCCGCCTCCATGCTGTTAATGCTGAAGTACTTGTGATTGCTAGTGGCAAGGATAACATGCTTCCAAGTGGAGATGAAGCTCAGAGGCTTGCAAATTCATTAAGAAACTGCAAAGTACGATACTTCAAAGACAATGGGCATACTATTTTATTGG-AAGATGGTATTAATCTGCTAACCATCATCAAAAGTACTAGCAAATATCGTCGTTCGAAAAGGCACGATTATGTCATGGATTTTCTGCCTCCTAGTGAGTCAGAATTCAAGAACGCACTCAAGGACAATAGATGGTATCTCAATTTTACTAGTCCAGTTATGCTGTCCACAATGGAAAATGGGAAAATTGTAAGAGGTCTAGCAGGGGTCCCATGTGAAGGCCCTGTGTTGTTGGTCGGTTATCACATGCTTATGGGATTAGAAATTACCCCTCTTGTTTCAGAATATTTGAGGCAGAGGAAAATTTTACTTCGTGGTATAGCACATCCGACATTGTTTACTCAGATGACTGAGAGTCAAACTAATGAAAGCTCATTCACTGATGTGCTGAGACTATATGGAGCTACGCCTGTCAGTGCCAGCAACTTCTTTAAGTTGCTTGCAACAAAGTCACATGTTCTGCTGTATCCTGGTGGTGCCCGTGAGGCCTTACATCGTAAGGGAGAAGAGTACAAGGCGATTTGGCCTGATCAACCAGAATTCATCAGAATGGCTGCAAGGTTTGGTGCGACAATTGTGCCATTTGGGGTTGTAGGGGAAGATGATATAGCACAGTTAGTTCTCGACTATGACGACCTAAAAAATATTCCTATAGTGGGTGATCGGATAAGGCGTGATAACGAACAGGCAGCCAGGAGGGGTTTAGCAGTCAGGGCGGACATGGACGGGGAGGTTGCCAACCAAGCGCTGTATCTCCCGGGCCTTTTACCTAAGATACCCGGTCGTTTTTACTACTTGTTTGGAAAACCTATTCATACGAAGGGAAGGAAGGACCTGGTGAAAGACAGAGAGAAAGCAAGAGAATTGTACTTGCGGGTAAAATCTGAAGTTCAAAATAACATGAATTATTTGCTTAAGAAAAGAGAGGAGGATCCTTACCGAAGCGTCATTGATCGGACCGTGCATAAAGCATTTTCTGCAACGTTTAATGATGTCCCAACATTTGATTATTAA。

example 2 preparation of transgenic tobacco

Constructing a plant expression vector pcambiac2300 with a CaMV35S promoter in a homologous recombination mode, carrying out double enzyme digestion on primers F-SacI: GGgagctcATGGGTGATCCAATGAAGAT and R-XbaI: GGtctagaTTAATAATCAAATGTTGGGA, amplifying a target band, carrying out double enzyme digestion on the target band and the vector respectively, carrying out link transformation on fragments obtained after two gel recovery through T4 ligase to obtain DH5 alpha competence, selecting a positive colony and extracting a plasmid in a single spot manner to obtain the constructed expression vector pcambiac 2300: LbPYP1, after agrobacterium LBA4404 is transformed, the model plant tobacco Samsun is infected, and 18 transgenic positive tobacco plants are obtained through differentiation, screening, rooting and seedling hardening (figure 1).

The total carotenoid content in the wild tobacco leaves is measured to be 160.3ug/g, the total carotenoid content in the transgenic tobacco leaves is measured to be 207.05ug/g, and meanwhile, the zeaxanthin monopalmitate which is a carotenoid compound not contained in the wild tobacco is also detected in 18 transgenic tobaccos.

Namely, the LbPYP1 has the function of regulating and controlling the palmitic acid, can activate the synthesis of zeaxanthin monopalmitate, which is a carotenoid compound not contained in wild tobacco, in the tobacco, and can greatly improve the total carotenoid content of tobacco leaves and improve the health care value.

In conclusion, the invention provides a key gene LbPYP1 gene for regulating synthesis of lycium barbarum red pigment, and the LbPYP1 gene has acyltransferase functionality, can promote synthesis of carotenoid, can specifically regulate and control palmation of zeaxanthin in the lycium barbarum, and can be converted into zeaxanthin dipalmitate (lycium barbarum red pigment), so that the liver-protecting and health-care value of the lycium barbarum is improved. In addition, the gene can also be expressed in tobacco to generate a carotenoid compound, namely zeaxanthin monopalmitate, which is not contained in wild tobacco, and the total carotenoid content of tobacco leaves is greatly improved. The novel gene, the recombinant vector and the recombinant bacterium thereof provided by the invention can be used for preparing transgenic plant varieties with high carotenoid content and high health care value, and have good application prospects.

SEQUENCE LISTING

<110> institute of biological research on northwest plateau of Chinese academy of sciences

<120> key gene for regulating biosynthesis of zeaxanthin palmitate and application thereof

<130> GY417-2022P0114821CC

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1356

<212> DNA

<213> LbPYP1

<400> 1

atgggtgatc caatgaagat ggcgatggtt aacattgatt ccatgcttcc tcctggacaa 60

attattcaac gtctctctga caacctcact ggtttgctgg cacacctctc tggcttagct 120

gatatcatac cgaaggaaac tcttctctgg aagttgaagc ttcttagatc tgcttcatct 180

tattcaaatt cccgcctcca tgctgttaat gctgaagtac ttgtgattgc tagtggcaag 240

gataacatgc ttccaagtgg agatgaagct cagaggcttg caaattcatt aagaaactgc 300

aaagtacgat acttcaaaga caatgggcat actattttat tggaagatgg tattaatctg 360

ctaaccatca tcaaaagtac tagcaaatat cgtcgttcga aaaggcacga ttatgtcatg 420

gattttctgc ctcctagtga gtcagaattc aagaacgcac tcaaggacaa tagatggtat 480

ctcaatttta ctagtccagt tatgctgtcc acaatggaaa atgggaaaat tgtaagaggt 540

ctagcagggg tcccatgtga aggccctgtg ttgttggtcg gttatcacat gcttatggga 600

ttagaaatta cccctcttgt ttcagaatat ttgaggcaga ggaaaatttt acttcgtggt 660

atagcacatc cgacattgtt tactcagatg actgagagtc aaactaatga aagctcattc 720

actgatgtgc tgagactata tggagctacg cctgtcagtg ccagcaactt ctttaagttg 780

cttgcaacaa agtcacatgt tctgctgtat cctggtggtg cccgtgaggc cttacatcgt 840

aagggagaag agtacaaggc gatttggcct gatcaaccag aattcatcag aatggctgca 900

aggtttggtg cgacaattgt gccatttggg gttgtagggg aagatgatat agcacagtta 960

gttctcgact atgacgacct aaaaaatatt cctatagtgg gtgatcggat aaggcgtgat 1020

aacgaacagg cagccaggag gggtttagca gtcagggcgg acatggacgg ggaggttgcc 1080

aaccaagcgc tgtatctccc gggcctttta cctaagatac ccggtcgttt ttactacttg 1140

tttggaaaac ctattcatac gaagggaagg aaggacctgg tgaaagacag agagaaagca 1200

agagaattgt acttgcgggt aaaatctgaa gttcaaaata acatgaatta tttgcttaag 1260

aaaagagagg aggatcctta ccgaagcgtc attgatcgga ccgtgcataa agcattttct 1320

gcaacgttta atgatgtccc aacatttgat tattaa 1356

<210> 2

<211> 28

<212> DNA

<213> F-SacI

<400> 2

gggagctcat gggtgatcca atgaagat 28

<210> 3

<211> 28

<212> DNA

<213> R-XbaI

<400> 3

ggtctagatt aataatcaaa tgttggga 28

Claims

1. A gene is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.

2. A recombinant vector, which is characterized by comprising a nucleotide sequence shown as SEQ ID NO. 1; preferably, the recombinant vector is a recombinant pcambiac2300 vector comprising the nucleotide sequence shown in SEQ ID No. 1.

3. A recombinant bacterium comprising the recombinant vector according to claim 2.

4. The recombinant bacterium of claim 3, wherein the recombinant bacterium is a recombinant Agrobacterium, preferably a recombinant Agrobacterium LBA 4404.

5. A method for constructing a transgenic plant for producing carotenoids, which comprises transferring the gene of claim 1 into a plant.

6. The method of claim 5, wherein the plant is transferred by one of Agrobacterium method, particle gun method, electroporation method, PEG mediated method, liposome method and calcium phosphate-DNA coprecipitation method; preferably the Agrobacterium method.

7. The method of claim 5, wherein the plant is tobacco.

8. The method of claim 5, wherein the carotenoid comprises zeaxanthin palmitate.

9. Use of the gene of claim 1, the recombinant vector of claim 2, or the recombinant bacterium of claim 3 for producing a carotenoid-producing plant variety; preferably, the carotenoid comprises zeaxanthin palmitate.

10. Use of the gene of claim 1, the recombinant vector of claim 2, or the recombinant bacterium of claim 3 for the preparation of an agent for promoting carotenoid synthesis; preferably, the carotenoid comprises zeaxanthin palmitate.