CN102181456B - Cotton flowering hormone GhFT and vector, construct, cell and polypeptide thereof - Google Patents

Abstract

The invention relates to cotton flowering locus T GhFT and a vector, a construction body, a cell and polypeptide thereof, in particular to cotton flowering locus T and application thereof. In the invention, the flowering locus T GhFT1 of upland cotton mainly cultivated in Xinjiang is cloned, and the adjustment effect of the gene on the flowering of plants is researched. The invention also relates to a vector, a host cell and a plant which comprise the gene. Due to the adoption of the gene, the flowering time of the plant can be advanced or the shape and the property of the plant can be improved.

Description

Cotton flowering hormone gene GhFT and carrier, construct, cell and polypeptide

Technical field

The present invention relates to cotton flowering hormone gene GhFT and carrier, construct, cell and polypeptide.This gene can be used for promoting the proterties of plant early blossoming or improvement plant.

Background technology

Blooming is the extremely important proterties of plant, and it affects the breeding time of farm crop and then affects yield and quality, therefore receives much concern all the time.Blooming is the important physiological phenomenon of polycarpeae, is that plant is by an important growth course of nourishing and growing and changing to reproductive growth.It is generally acknowledged at present blooming mainly by four kinds of approach of plant, comprise Photoperiod pathway, autonomous pathway, vernalization approach, Plant hormones regulators,gibberellins approach.Along with molecular biological development, clone many key genes of these approach in recent years, to the further research of its function, well resolved physiological Mechanism and the molecular mechanism of flowering of plant.Wherein these four approach mainly are the expression that has affected flowering hormone gene FT (Flowering locus T), thereby affect the expression of downstream gene, or promote or the inhibition flowering of plant.The FT gene is one of the important gene in the signal pathway of blooming, and to the research of FT gene and its proteins encoded function, research has had crucial breakthrough to flowering hormone to make people.The FT gene of Arabidopis thaliana only has 528bp, and the albumen of coding belongs to phosphotidylethanolabinding binding protein (phosphatidylethanolamine-Binding Protein, PEBP) gene family.PEBP albumen separates from the ox brain the earliest, gain the name because easily being combined with phosphatidylethanolamine, PEBP albumen has distribution at species such as Mammals, yeast, worm, fruit bat, fungi, bacterium and flowering plants, phosphatidylethanolamine is the main phosphatide in the plant biological film, plays an important role in signal transduction process.In Arabidopis thaliana, FT is the approach conformity gene of blooming, and specially plays the cone production effect on long under the condition.TFL1 in the Arabidopis thaliana (Terminal flower1) also is the PEBP family protein, and is similar with the FT albumen height, but TFL1 is the supressor of blooming.Research is found, wherein 83 amino acids are the critical sites that determine the FT/TFL1 function, FT albumen is tyrosine (Tyr) in this site, and TFLI is Histidine (His) in this site, and the amino acid whose change in this site is enough to the function of FT/TFL1 is reversed.

FT is the early stage activation target gene of photoperiod Circadian Gene CO (CONSTANS), by the expression of the direct transcriptional activation FT of the CO of photoperiodic induction.The CO genetic expression of Arabidopis thaliana is obvious diel rhythm (peak expression is at dusk) under the long day condition, promote simultaneously the expression of FT gene, and the expression that makes FT also presents obvious diel rhythm (peak expression also appears at dusk), the expression of FT impels the expression of the downstream flower_meristem_identity genes such as AP1, thereby causes that Arabidopis thaliana blooms; Under the short day condition, CO also presents obvious diel rhythm, and this moment, CO suppressed the expression of FT, thereby causes the Arabidopis thaliana delay of blooming.Show by molecular biological research means, FT albumen and FD protein-interacting, FD albumen is to contain alkaline leucine zipper protein (basic region-leucine zipper, b-ZIP) transcription factor of structural domain, FD is specifically expressing in apical meristem, the common expression that promotes downstream flowering gene AP1, LFY etc., thereby Accelerate bloom.

All the time, is scientist explores such problem: the mRNA of FT gene flowering hormone? is or the albumen of FT genes encoding flowering hormone? in one's early years research is thought, the transcript of FT gene is after mRNA expresses in blade, can be by meristematic tissue promotion FD, AP1 and the LFY isogenic expression of long-distance transportation to the top, promote flowering of plant, therefore this viewpoint thinks that the mRNA of FT is flowering hormone.Studies show that afterwards that the green fluorescent protein that FT-GFP merges can promote flowering of plant by vascular bundle from the transport of blades to the apical meristem, thereby this viewpoint thinks that FT albumen is flowering hormone, and the strong proof of grafting experiment this point.The FT homologous gene Hd3a of paddy rice, the sFT gene coded protein of tomato also have same mobile phenomenon.Therefore the albumen of FT is that the evidence of viewpoint of flowering hormone is more abundant.

In other many plants, cloned the FT homologous gene at present, as: at least 35 kind of plant such as tobacco, soybean, barley, corn, wheat, petunia, tomato, willow, mandarin orange, grape, sand pear, Cauliflower, Chunlan, Arabic mustard, petunia, Yushan alpine rockcress, rape, Fructus Fici, plum blossom, winter squash, papaya, peach, oncidiumLuridum, Sunflower Receptacle, chrysanthemum, red autumnal leaves multitude, oranges and tangerines, the dried immature fruit of citron orange, potato, castor-oil plant, morning glory, Mao Huanzhu, rye grass, Chinese parasol tree, rose.Compare its aminoacid sequence, similarity reaches as high as more than 90%, the expression of transgenosis proof FT gene can promote the plant early flowering, shows that the structure and function of FT family gene exists the conservative property of height between different species, and this family gene is bloomed in regulation and control and played an important role.

In sum, the FT gene is mainly expressed in blade, accept suitable photoperiodic induction after, FT albumen moves to the top tissue from blade.Combination between the FD gene encoding production of FT albumen and top organizing specific expression forms a kind of protein complexes.The formation meeting Accelerate bloom of this complex body determines the expression of gene, thereby finally causes flowering of plant.Blooming is a very complicated physiological phenomenon, up to the present, although the FT gene has been carried out a large amount of research, but still exist a lot of problems to remain to be furtherd investigate.For example, is the plain gene FT albumen of blooming how to be transferred to shoot apical meristem from leaf intactly? and same plant materials contains a plurality of FT homologous genes in some plant, how to share out the work and help one another again between them? also having the FT gene promoter is inducible promoter or tissue-specific promoter, how does this promotor regulate and control FT genetic expression? if all these problems can be resolved, to not only help to understand in depth the molecular mechanism of FT Gene Handling flowering of plant, and have important theory directive significance to carrying out the ornamental plant florescence control by transgenic technology.So want to understand in depth the detailed functions of FT gene, also need to set about from more plants, clone more FT gene.

Cotton is one of important cash crop, but the relevant homogenic clone of the FT of cotton and functional study are not but reported.To the homogenic separation of cotton FT and functional analysis, for further studying the molecular mechanism of flowering of plant, flowering time by genetic engineering means regulation and control cotton, avoid after autumn low temperature the impact that cotton is caused of the area such as Xinjiang, have important theory directive significance to improving output of cotton and fibrous quality.

Summary of the invention

The objective of the invention is to clone the flowering hormone gene GhFT of cotton, and study it to promoting the function of flowering of plant aspect by molecular biological means, in the hope of in cotton, utilizing this gene to promote cotton prematurity, avoid the after autumn harm of low temperature, finally reach the purpose that improves output of cotton.

The cotton flowering hormone gene GhFT that the present invention relates to separate, it comprises one of nucleotide sequence of selecting from following group of nucleotide sequence:

(1) nucleotide sequence of cotton shown in the SEQ ID NO:1;

(2) nucleotide sequence of the cotton that under medium stringent condition, preferred high stringent hybridization condition, hybridizes with the complementary sequence of the nucleotide sequence of (1);

(3) have at least 70% with the cotton sequence of the nucleotide sequence of (1), the cotton nucleotide sequence of preferred at least 80%, more preferably at least 85%, more preferably at least 90%, especially at least 95% or 98% or 99% identity;

(4) from the protein of the nucleotide sequence coded same acid sequence of cotton of (1) but because of the degeneracy of genetic code different cotton nucleotide sequence on sequence;

The active fragments of any one cotton nucleotide sequence in (5) (1)-(4); Or

(6) with the cotton nucleotide sequence of any one nucleotide sequence complementation in (1)-(5).

The invention still further relates to isolated polypeptide (also claiming protein), it comprises the aminoacid sequence of selecting from following group of aminoacid sequence:

(1) aminoacid sequence shown in the SEQ ID NO:2,

(2) because the substituting of one or more (for example 1-25,1-20,1-15,1-10,1-5,1-3) amino-acid residue, disappearance and/or insert and the aminoacid sequence of the cotton different from the aminoacid sequence shown in the SEQ ID NO:2,

(3) have at least 70% with the aminoacid sequence shown in the SEQ ID NO:2, the cotton aminoacid sequence of preferred at least 80%, more preferably at least 85%, more preferably at least 90%, especially at least 95% or 98% identity,

(4) active fragments of (1) or (2) or (3) described aminoacid sequence, and

(5) aminoacid sequence of claim 1 or 2 polynucleotide molecule coding.

The present invention also provides the polynucleotide sequence shown in the cotton SEQ ID NO:1 of separation.

The invention still further relates to construct, it comprises polynucleotide of the present invention.

The invention still further relates to carrier, it comprises polynucleotide of the present invention.Described carrier can be cloning vector or the expression vector that is used for expressing described polynucleotide.

The invention still further relates to cell, it comprises polynucleotide of the present invention or construct of the present invention or carrier of the present invention.Described cell can be zooblast, vegetable cell or microorganism cells, Bacillus coli cells for example, preferred plant cell.Described cell can be a part that separate, that exsomatize, that cultivate or plant.

The invention still further relates to the plant that method of the present invention is produced.

The objective of the invention is the function by following measures analysis cotton flowering hormone gene GhFT, study the regulating effect that it is grown flowering of plant: the method that adopts homologous clone, from the cotton in Xinjiang main breed, pass through the method for RT-PCR (reverse transcription PCR), CDS (cDNA sequence, the open reading frame) sequence (HM631972) of flowering hormone gene GhFT of cotton has increased.Make up plant Overexpression vector: p35S::GhFT, p35S::GhFT-GFP, and the promoter vector of Arabidopis thaliana phloem-specific expression: pSUC2::GhFT-GFP; Change the regulating effect that the research transgenic plant bloom in the Arabidopis thaliana over to by agrobacterium-mediated transformation; By sxemiquantitative RT-PCR technology, research GhFT gene is at the expression of cotton different tissues etc.; Observe p35S::GhFT-GFP by confocal laser scanning microscope, the root-tip cells of pSUC2::GhFT-GFP transfer-gen plant, research GhFT-GFP merges Subcellular Localization and the expression of green fluorescent protein.

The present invention separates early No. 33 flowering hormone gene GhFT of the new land of the main cultivation Upland Cotton in Xinjiang first, and study the expression of this gene by molecular biological means, Subcellular Localization, study the regulating effect that it is grown flowering of plant by transformation mode plant Arabidopis thaliana, result of study shows that the GhFT gene can promote the Arabidopis thaliana early blossoming, has hinted that this gene has important utility value in the transgenic breeding of cotton.

Description of drawings

Fig. 1 shows evolutionary tree (phylogenic tree) analysis of GhFT gene and other FT gene.

Fig. 2 shows the typical consequence of the tissue expression of GhFT gene.

Fig. 3 shows the typical consequence that turns the p35S::GhFT study on the carrier, and 1 shows that overexpression GhFT makes the Arabidopis thaliana early flowering among the figure, and a left side is the non-transgenic plant, and the right side is transfer-gen plant, bar=1cm; 2 semi-quantitative RT-PCR analysis that show transfer-gen plant among the figure, 3 statisticses of showing transgenic plant and non-transgenic plant lotus throne leaf (rosette) among the figure.

Fig. 4 shows the typical consequence that turns the p35S::GhFT-GFP study on the carrier, and a left side is the non-transgenic plant, and the right side is transfer-gen plant, bar=2cm.

Fig. 5 shows the typical consequence turn the pSUC2::GhFT-GFP study on the carrier, and 1 is transfer-gen plant as non-transgenic plant, the right side, bar=2cm; 2 are transfer-gen plant root-tip cells GFP observation (green fluorescent protein mainly concentrates on phloem), bar=20 μ m.

Fig. 6 shows the GhFT-GFP fusion rotein in the Subcellular Localization typical consequence of Arabidopis thaliana root-tip cells, and left figure is that the root-tip cells GFP picture of p35S::GFP transfer-gen plant, right figure are the root-tip cells GFP of p35S::GhFT-GFP transfer-gen plant and the picture that the bright field merges (merge).

Embodiment

Below in conjunction with specific embodiment, the present invention is described in detail.

Embodiment one: the cloning and analysis of GhFT gene C DS

According to the aminoacid sequence that is encoded into florigen gene FT (Flowering locus T) of having delivered in the environmental Arabidopis thaliana of Columbia (Col), accession number is AAF03926.1, in GenBanK (www.ncbi.nlm.nih.gov), download this sequence, take this sequence as probe (query), select the ESTs database of cotton, move the tBlastx program, search the homology ESTs sequence of a cotton, accession number is UFL_438_68 (ES826802).

According to the nucleotide sequence of this est sequence, design primer: Kpn I-GhFT-F: GGGGTACCATGCCTAGAGACAGAGATCCTTTGGT sees SEQ ID NO:3; XbaI-GhFT-R: GCTCTAGATCATGTCCTACGGCCACCGGATCCACT sees SEQ ID NO:4 (underscore partly is Kpn I and Xba I restriction enzyme site).Take the new land of the Upland Cotton in Xinjiang early the cDNA of 33 blades as template, increase by RT-PCR, the output that will increase is connected to pGEMT-easy (promega), make up pGEMT::GhFT, by transforming intestinal bacteria DH 5 α, select positive colony order-checking (seeing SEQ ID NO:1), analyze sequencing result and show it is the GhFT homologous sequence of cotton really, aminoacid sequence (seeing SEQ ID NO:2) has 79.3% similarity with the AtFT (AAF03936.1) of Arabidopis thaliana, and comprises (the extraction of total RNA of complete open reading frame, the method of reverse transcription and pcr amplification is with embodiment two).

The evolutionary tree of FT gene makes up: but the FT homologous gene that passes through overexpression or ectopic expression proof Accelerate bloom that present document has been reported has 17 at least, relates to 13 species.Download these genes from GenBank (http://www.ncbi.nlm.nih.gov) database, compare the aminoacid sequence of its coding, similarity is very high, reaches as high as more than 90%.Utilize MEGA 4.1 (Molecular Evolutionary Genetics Analysis, version 4.1) software carries out the phylogenetic analysis of all known FT, the protein sequence comparison utilizes Clustal W program to carry out, evolutionary tree utilizes the Neighbor-Joining method to make up, and wherein carries out 1000 Bootstrap and analyzes so that the result of branch is more reliable.Phylogenetic analysis the results are shown in Figure 1.Phylogenetic analysis has very clearly shown the Phylogenetic of FT gene; if the AtFT of Arabidopis thaliana; the GmFT5a of soybean; the InFT albumen of morning glory is the words of the outgroup of FT family protein; the FT homologous gene is evolved according to unifacial leaf, dicotyledons respectively subsequently; the MdFT1 sibship of the GhFTL1 of cotton and apple is nearest, and relatively its amino acid sequence similarity can reach 89.6%.Ectopic expression MdFT1 can significantly promote early blossoming in Arabidopis thaliana, willow, and overexpression also can accelerate induced flowering in apple.Phyletic evolution infers that the GhFTL1 gene plays an important role in cotton blooms approach.

The HaFT1 (ADF32946.1) of Sunflower Receptacle (Helianthus annuus), HaFT2 (ADF32947.1), HaFT4 (ADF32946.1); The CmoFTL1 (ABR20498.1) of pumpkin (Cucurbita moschata), CmoFTL2 (ABR20499.1); The SP3D (AAO31792.1) of tomato (Solanum lycopersicum); The PtFT (ABD52003) of trembling poplar tree (Populus tremula); The PdFT2 (AAS00056.1) of eastern cottonwood (Populus deltoides); The MdFT1 (BAD0834) of apple (Malus x domestica); The GhFTL1 (ADK95113.1) of upland cotton (Gossypium hirsutum); The CiFT (BAA77836.1) of oranges and tangerines (Citrus unshiu); The GmFT2a (BAJ33491.1) of soybean (Glycine max); GmFT5a (BAJ33494.1); The Hd3a (BAB61028) of paddy rice (Oryza sativa), RFT1 (BAB78480.1); The HvFT (ABV59389.1) of barley (Hordeum vulgare); The TaFT (AAW23034.1) of wheat (Triticum aestivum); The InFT (ABW73563.1) of morning glory (Ipomoea nil); The AtFT (AAF03936) of Arabidopis thaliana (Arabidopsis thaliana).

Embodiment two: the tissue expression analysis of GhFT gene

(1) experimental technique

Collect respectively new land early 33 root, hypocotyl, flower, true leaf, fiber and ovule material through liquid nitrogen flash freezer, adopt the CTAB method to extract total RNA, concrete grammar is as follows: in time change over to after 1) each organization material liquid nitrogen of cotton fully grinds at 30 minutes CTAB Extraction buffer (2%CTAB of 65 ℃ of water-bath preheatings, 2% polyvinylpyrrolidone PVP, 100mmol/L Tris-HCl, 25mmol/L EDTA, 2.0mol/L NaCl, 2% mercaptoethanol) in, fully 65 ℃ of water-bath 10min behind the mixing vibrate 2～3 times during this period; 2) 4 ℃, 12000rpm/min, 10min; 3) slowly draw supernatant, add isopyknic phenol: chloroform: primary isoamyl alcohol=extracting in 25: 24: 1 once, room temperature is placed 5min behind the thermal agitation; 4) 4 ℃, 12000rpm/min, 10min; 5) slowly draw supernatant, add isopyknic chloroform extracting twice, each fully vibration, and room temperature is placed 5min; 6) 4 ℃, 12000rpm/min, 10min; 7) get supernatant, add LiCl and the isopyknic Virahol of the 8mol/L of 1/3 volume, behind the mixing, place 2h for-20 ℃ gently; 8) 4 ℃, 12000rpm/min, 20min abandons supernatant, adds twice of the washing with alcohol of 500 μ l 75%; 9) after the simple drying, use the water dissolution without RNase.The total RNA that gets each tissue becomes cDNA through reverse transcription, and the preparation of cDNA template is according to the explanation (promega, USA) of ThermoScript II.With primer: GhFT-F:GCAGACCACCTCTTGACCAAAGCAAG, see SEQ ID NO:5; GhFT-R:TAAGTAGCTGTGCGTATTCGTCATA sees SEQ ID NO:6, carries out sxemiquantitative RT-PCR, confidential reference items ubiquitin7 25 circulations of increasing, 28 circulations of GhFT gene amplification.During PCR, in the reaction system of 25 μ l, add cDNA template 1 μ l, each 5nmol of forward and reverse primer, 2.5 μ l, 10 * PCR damping fluid (giving birth to the worker, Shanghai), each 0.2mmol/L of dNTP, 1.5mmol/L MgCl ₂, 1U Taq archaeal dna polymerase (giving birth to the worker, Shanghai), ddH ₂The O polishing.The PCR response procedures is: 94 ℃ of 30sec behind 94 ℃ of 3min, and 60 ℃ of 45sec, 72 ℃ of 1min, circulation 28,72 ℃ are extended 10min again.Annealing temperature depends on primer.The PCR product detects at 1% sepharose.

(2) experimental result

Show that the GhFT gene all has expression, expression higher (Fig. 2) in true leaf and ovule in the root (Root) of cotton, hypocotyl (Hypocotyle), flower (Flower), true leaf (Leaf), fiber (Fibre) and ovule (Ovule).

Embodiment three: gene transformation

By the genetic transformation in Arabidopis thaliana, study the regulating effect of cotton GhFT gene pairs flowering of plant.

1, experimental technique

(1) Vector construction

The p35S::GhFT carrier: the correct plasmid pGEM T::GhFT that checks order cuts through Kpn I and Xba I enzyme, reclaims fragment and is connected on the plasmid pCAMBIA2300 of same double digestion carrier construction: p35S::GhFT.

The p35S::GhFT-GFP carrier: at first utilize the primer 5 ' contain respectively BamH I and Xba I restriction enzyme site- GGGGTACCATGCCTAGAGACAGAGATCCTTTGGT-3 ' (seeing SEQ ID NO:7) and 5 '- TCTAGATGTCCTACGGCCACCGGATCCACT-3 ' (seeing SEQ ID NO:8) (underscore partly is respectively BamH I and Xba I restriction enzyme site), take the CDS district of pGEM T::GhFT plasmid DNA as template amplification GhFT gene, be connected to carrier pGEM Teasy (promega), the plasmid order-checking is correctly by BamH I and Xba I double digestion, reclaim Insert Fragment and be connected on the existing binary vector p35S::GFP in the laboratory of same double digestion, build the p35S::GhFT-GFP carrier.

The pSUC2::GhFT-GFP carrier: at first utilize the primer 5 ' contain respectively EcoR I and Kpn I restriction enzyme site- GAATTCGAAAACGGAGAAACAAATAACAA-3 ' (seeing SEQ ID NO:9) and 5 '- GGTACCTATCCGAAGAGGAGAACAGTGAA-3 ' (seeing SEQ ID NO:10) (underscore partly is respectively EcoR I and KpnI restriction enzyme site), take the promotor 1700bp sequence of the ecotypic genomic dna of Col as template amplification Arabidopis thaliana phloem-specific expression gene SUC2, the PCR product is connected on the carrier pGEM T easy (promega), the plasmid order-checking is correctly by EcoR I and Kpn I double digestion, reclaim Insert Fragment and be connected on the binary vector p35S::GhFT-GFP of same double digestion carrier, build the pSUC2::GhFT-GFP carrier.

(2) genetic transformation of Arabidopis thaliana:

The cultivation of Arabidopis thaliana: the Col seed through the 20%Bleach sterilising treatment, after 4 ℃ of lower vernalization 3-4 days, seed is sowed on 1/2 MS substratum equably, its composition contains 1% Glucose, 2.2g/L Murashige﹠amp; Skoog MEDIUM (Duchefa Biochemie, Netherland), 0.05% MES (Amersham, America), 0.8%Agar, pH 5.8.After cultivating a week, be placed into 25 ℃, between the illumination cultivation of 16hr illumination/8hr dark in, in 2-3 sheet leaf period, be transplanted in the basin alms bowl that contains vermiculite and Nutrition Soil (1: 1), be placed into afterwards in the culturing room of 16hr illumination/8hr dark and cultivate.

Agrobacterium is infected the preparation of liquid: carrier p35S::GhFT, p35S::GhFT-GFP and pSUC2::GhFT-GFP transform respectively Agrobacterium GV3101, clone after the conversion identifies through PCR, selecting positive mono-clonal is inoculated in the LB substratum that 20ml contains 50 μ g/ml Rifampins and 50 μ g/ml kantlex, 28 ℃, the 200rpm shaking culture is to OD ₆₀₀Be about 1.0, the centrifugal 10min of 4000rpm collects thalline, thalline is resuspended in 2ml contains 5% sucrose, in the solution of 0.02%silwet-77, is used for genetic transformation.

The genetic transformation of Arabidopis thaliana: when cultivating Arabidopis thaliana to the high 5-10cm of stem, go its terminal inflorescence, stimulate the axillary inflorescence growth.After 7-9 days, namely can be used for transforming.Cut off all before the conversion and really press from both sides, and water sufficient moisture.Using the pipettor of 200 μ l that ready agrobacterium liquid is dropped in takes.Transform good Arabidopis thaliana and cover moisturizing with preservative film, remove preservative film after 24 hours.Re-treatment is 1-2 time after a week.Transform good plant and make its normal growth through same growth conditions, yield positive results, the seed of results is T ₀Generation.

The screening of transgenic positive plant; T ₀After sterilization and vernalization treatment, sowing is on the 1/2MS of the kantlex that contains 50 μ g/ml substratum for seed.Through 25 ℃, after about 1 week of growth, the non-transgenic plant is dead gradually in the culturing room of 16hr illumination/8hr dark, and transfer-gen plant still presents green, root is long, positive plant is transplanted to 25 ℃, cultivates in the culturing room of 16hr illumination/8hr dark, the seed of individual plant results is T ₁Generation.

The homozygotic screening of transfer-gen plant: with T ₁After sterilization and vernalization treatment, sowing is on the 1/2MS of the kantlex that contains 50 μ g/ml substratum for seed.Add up the ratio that separates of green seedling and albefaction after 1 week, select and separate than planting down near 3: 1 strain, seed individual plant results are T ₂Generation.T ₂Through same method screening, containing the homozygote that is that can all grow on the 1/2MS substratum of kantlex for seed, the seed of planting the results of going down is T ₃In generation, be the homozygote seed.

2, experimental result

The p35S::GhFT carrier is changed in the Arabidopis thaliana, and early blossoming phenotype (among Fig. 3 shown in 1) obviously appears in transfer-gen plant, and by RT-PCR the analysis showed that the GhFT gene really in transgenic arabidopsis expression amount improved (among Fig. 3 shown in 2).The lotus throne leaf of statistics transfer-gen plant also obviously is less than (among Fig. 3 shown in 3) of wild-type, shows the flowering time that the GhFT gene of clone's cotton can regulating plant.

P35S::GhFT-GFP carrier transfer-gen plant (shown in Figure 4) also can significantly promote the Arabidopis thaliana early blossoming, and can obviously detect the expression (shown in Figure 6) of green fluorescent protein GFP by laser co-focusing, the carrier pSUC2::GhFT-GFP that makes up with the promotor of Arabidopis thaliana phloem-specific expression, change in the Arabidopis thaliana, the phloem of transfer-gen plant can detect the expression of GFP, transfer-gen plant can show early blossoming (among Fig. 5 shown in 1) equally, and transfer-gen plant detects green fluorescent protein GFP (among Fig. 5 shown in 2) at phloem.

Embodiment four: the GhFT gene is at the Subcellular Localization of Arabidopis thaliana root-tip cells

1, experimental technique

Vector construction and gene transformation method are as mentioned above;

GFP observes: to the seed of the transfer-gen plant p35S::GhFT-GFP that isozygotys that screens, after sterilization, be seeded on 1/2MS (composition the is the same) substratum, the seedling that grew 7 days, be placed on the slide glass, at laser confocal microscope (Zeiss, LSM510) the lower root cell of observing excites GFP fluorescence with 488nm.

2, experimental result

P35S::GhFT-GFP transfer-gen plant root-tip cells observed show that the GFP green fluorescent protein not only in nucleus, also has (Fig. 6) on tenuigenin, show that GhFT albumen is the albumen of a nucleus and tenuigenin location.

Should be understood that, for those of ordinary skills, can be improved according to the above description or conversion, and all these improvement and conversion all should belong to the protection domain of claims of the present invention.

Claims (1)

1. be used for the primer pair of amplification cotton flowering hormone gene GhFT, primer is SEQ ID NO:3 and SEQ ID NO:4 to sequence.

Images