CN103172716A

CN103172716A - Heat-resistant plant gene and application thereof

Info

Publication number: CN103172716A
Application number: CN2011104430471A
Authority: CN
Inventors: 何玉科; 李晓荣; 孙传宝
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date: 2011-12-26
Filing date: 2011-12-26
Publication date: 2013-06-26
Anticipated expiration: 2031-12-26
Also published as: CN103172716B

Abstract

The invention relates to a heat-resistant plant gene and the application thereof. The invention discloses the heat-resistant gene capable of obviously improving the heat resistance of plants; and the heat-resistant gene can be applied to heat-resistant molecular breeding, so that the heat resistance of the plants is improved, and the plants with breed improvement can be obtained.

Description

The Genes For Plant Tolerance hot radical because of and the application

Technical field

The invention belongs to biotechnology and phytology field; More specifically, the present invention relates to a kind of Genes For Plant Tolerance hot radical because of and the application.

Background technology

The temperature adverse circumstance is to affect vegetables to produce and limit one of Main Factors of its areal distribution.Because " Greenhouse effect " increasingly sharpen, it is more and more frequent that hot weather occurs, the continuous high temperature in China Yangtze valley summer especially in recent years seriously restricts the g and D of food crop and fruits and vegetables class plant, and agriculture production faces a severe challenge.Within nearly 50 years, great paddy rice heat evil event 6 times occur in Yangtze River in China basin altogether.The last time occurs in 2003, and the full basin of conservative estimation injured area reaches 3 * 10 ⁷hectare, loss paddy reaches 5.18 * 10 ⁷ton ^[1].Late 1980s, south China citrus producing region once suffered large-scale high temperature upsurge 3 times, and to fruits and vegetables, production has caused huge loss.Environment stress can cause a series of biochemical reactions in plant materials: cell leakage increases, and the kytoplasm volumes of extravasation result increases; The aggravation of film lipid peroxidation degree, the MDA accumulation; Active o content increases.Plant materials interior startup antioxidase and the reaction of non-enzyme antioxidant generation responsiveness, with the damage that stops, reduces or reparation is caused by high temperature ^[2,3].As can be seen here, the plant under adverse circumstance is not that driven bearing is hurt, but adjusting initiatively adapts to.Just to the continuous adaptive process of this adverse circumstance, make plant in long-term evolutionary process, formed perfect with the degeneration-resistant system of complexity with the maladjustment environment.Therefore, Genes For Plant Tolerance heat engine reason is carried out to more deep research, be one of important channel of the new resistant variety of understanding plant and environmental concerns and cultivation, all significant in theory and application facet.

To Genes For Plant Tolerance, hot research has become a current important research topic.Be subject to the restriction of germ plasm resource, traditional breeding way is difficult in a short time the significantly heat impedance of the nonrefractory crop of improvement, so the heat impedance that realizes improving nonrefractory crop by the heat resistanceheat resistant gene of recombinant heat-proof species is the important directions of research now.Plant materials is subject to the poor environments such as high temperature while coercing, in body, the immunity system of self can be made emergency reaction in time, produce a series of emergency reaction, heat shock factor (Heat Shock factor wherein, HsF) be the main transcription factor in the stress-inducing process, expression by its downstream target gene of transcriptional activation, produce various enzymes, increased film fat saturation ratio, improved the content of soluble proteins and some protectiveness cellular components, the protection body protein exempts from damage or repairs the protein of wound in damaged condition, plant is shielded, thereby make plant obtain thermotolerance, improve the stress ability of organism and the survival rate in adverse circumstance ^[2,3,4,5].Together with being closely connected because heat shock factor and Genes For Plant Tolerance are hot, so the expression regulation of heat shock protein and downstream gene thereof is the physiological important research content of current molecular biology, protein biochemistry and plant stress-resistance.Regrettably, for its target gene, in plant materials, be that the Mechanism Study that how to start and carry out the heat resistanceheat resistant physiological responses it be unclear that.

Rapidly, especially the application of biochip technology on the crop molecular breeding is also more and more extensive in molecular biology research development in recent years ^[6,7].Its fast, responsive, efficiently, the expression of analyzing gene changes quantitatively, met the Genes For Plant Tolerance hot radical because carrying out the screening requirements of large flux.Therefore, this area is necessary take that gene engineering is as platform, and the gene that screening has heat resistance in plant, carry out plant species improvement, improves plant heat resistance property, and horn of plenty and balance China farm crop market provide heat resistanceheat resistant germ plasm resource.

Summary of the invention

The object of the present invention is to provide a class Genes For Plant Tolerance hot radical because of and the application.

In a first aspect of the present invention, provide a kind of HTT polypeptide ( heat induced ta-siR255 targets) or the purposes of the polynucleotide of this polypeptide of encoding, for improving plant heat resistance property.

In a preference, described HTT polypeptide is selected from:

(a) there is the polypeptide of aminoacid sequence shown in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19 or SEQ ID NO:21; Or

(b) process of aminoacid sequence shown in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQID NO:15, SEQ ID NO:17, SEQ ID NO:19 or SEQ ID NO:21 is one or more (as 1-50; Preferably 1-40; Preferably 1-30; Preferably 1-20; Preferably 1-10; 1-5 more preferably) replacement, disappearance or the interpolation of amino-acid residue form, and have the derivative polypeptide by (a) that improves the Heat Resistance of Plant sexual function;

(c) have 40% with aminoacid sequence shown in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQID NO:15, SEQ ID NO:17, SEQ ID NO:19 or SEQ ID NO:21 (preferably 50%; More preferably 60%; More preferably 70%; More preferably 80%; More preferably 90%; More preferably 95%; More preferably 98%) above homogeny, and there is the derivative polypeptide by (a) that improves the Heat Resistance of Plant sexual function.

In another preference, the polynucleotide of described coding HTT polypeptide are selected from: have SEQ ID NO:1, or SEQ ID NO:2, or SEQ ID NO:3, or SEQ ID NO:6, or SEQ ID NO:7, or SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:14, or SEQ ID NO:16, or the polynucleotide of nucleotide sequence shown in SEQ ID NO:18 or SEQ ID NO:20.

In another preference, described plant is selected from: cress; More preferably be selected from Brassica plants or mouse ear mustard; More preferably be selected from Chinese cabbage (Brassica.rapa) or Arabidopis thaliana (Arabidopsis thaliana).

In another aspect of this invention, provide a kind of polynucleotide, be selected from lower group:

(a) there are the polynucleotide of the nucleotide sequence shown in SEQ ID NO:23 or SEQ ID NO:24; Or

(b) Nucleotide process in 11-14 position in the nucleotide sequence shown in SEQ ID NO:23 is one or more (as 1-8; 1-6 preferably, better 1-5, as 2,3,4) replacement, disappearance or the interpolation of Nucleotide form, and there are the polynucleotide of the function that antagonism ta-siR255 is combined with the mRNA of the HTT polypeptide of encoding; Or

(c) Nucleotide process in 236-239 position in the nucleotide sequence shown in SEQ ID NO:24 is one or more (as 1-8; 1-6 preferably, better 1-5, as 2,3,4) replacement, disappearance or the interpolation of Nucleotide form, and there are the polynucleotide of the function that antagonism ta-siR255 is combined with the mRNA of the HTT polypeptide of encoding; Or

(d) with the nucleotide sequence of Nucleotide complementation described in above-mentioned (a), (b), (c).

In another aspect of this invention, provide the purposes of described polynucleotide, for improving plant heat resistance property.

In a preference, described plant is selected from: cress; More preferably be selected from Brassica plants or mouse ear mustard; More preferably be selected from Chinese cabbage (Brassica.rapa) or Arabidopis thaliana (Arabidopsis thaliana).

In another aspect of this invention, provide a kind of method that improves plant heat resistance property, described method comprises: the expression or the activity that improve HTT polypeptide in plant; Or

Reduce expression or the activity of ta-siR255 in plant; Or

Improve the expression of the target gene of ta-siR255 in plant.

In a preference, described method comprises: the polynucleotide of the HTT polypeptide of encoding proceed in plant; Or

Described polynucleotide are proceeded in plant.

In another preference, described method comprises step:

(i) provide the Agrobacterium of carrying expression vector, polynucleotide or described polynucleotide that described expression vector contains coding HTT polypeptide;

(ii) vegetable cell, tissue or organ are contacted with the Agrobacterium in step (i), thereby make polynucleotide or the described polynucleotide of described coding HTT polypeptide proceed to plant.

In another preference, described method also comprises:

(iii) select the polynucleotide that proceeded to described coding HTT polypeptide or vegetable cell, tissue, the organ of described polynucleotide; And

(iv) by vegetable cell, tissue, neomorph in step (c) and select transgenic plant.

In another aspect of this invention, provide a kind of heat-resisting plant, it is the transgenic plant that prepared by preceding method.

In another aspect of this invention, provide the purposes of the polynucleotide of a kind of HTT polypeptide or this polypeptide of encoding, as the stable on heating molecular marked compound of plant identification.

Other side of the present invention, due to the disclosure of this paper, is apparent to those skilled in the art.

The accompanying drawing explanation

The expression analysis of Figure 1A-C, HTT1, HTT2, HTT3, At4G29760 and At1G51670.Wherein, ck means the wild-type plant.

The cluster relationship analysis of Fig. 1 D, HTT1, HTT2, HTT3, At4G29760 and At1G51670 and other candidate gene.

The sequence signature analysis of Fig. 2, HTT1, HTT2 and HTT3.

All there is the binding site of ta-siR255 on the mRNA of A, HTT1, HTT2 and HTT3.

The structure schematic diagram of B, MIM255 over-express vector.

All there are nnGAAnnTTCnnGAAnn and AGGGG motif on C, HTT1.1, HTT2 and HTT3 promotor.

The transgenic line heat treatment experiment of Fig. 3, HTT1, HTT2 and HTT3 overexpression.

Plant strain growth situation after the transgenic line thermal treatment of A-C overexpression, left figure separately means the plant-growth situation, the schematic diagram that right figure is the plant of each section post representative in left figure.

D-G, quantitative RT-PCR are analyzed mRNA adjoining tree and are crossed the accumulation volume in expressing plant.

Fig. 4 A, Ta-siR255 precursor TAS1a, TAS1b, the TAS1c response before and after thermal treatment.

Fig. 4 B, the Ta-siR255 response before and after thermal treatment.

Fig. 5 A, HTT1 and HTT2 cross plant survival rate after the thermal treatment of expression strain.

Fig. 5 B, HTT3 cross plant survival rate after the thermal treatment of expression strain.

Fig. 5 C, MIM255 cross three strain survival rates after the thermal treatment of expression strain.

The prediction of the homology of corresponding polypeptide and analysis in HTT polypeptide and Chinese cabbage in Fig. 6, Arabidopis thaliana.

Embodiment

The inventor is devoted to the screening of heat resistanceheat resistant gene, has finally determined that a class can obviously improve the heat resistanceheat resistant gene of plant heat resistance.These heat resistanceheat resistant genes can be applicable to the heat resistanceheat resistant molecular breeding, improve plant heat resistance property, obtain the plant of breed improvement.

In the present invention, for being applicable to plant of the present invention, have no particular limits, as long as it is applicable to carrying out the conversion operation of gene, as various farm crop, flower plant or forestry plant etc.Described plant is such as being (being not limited to): dicotyledons, monocotyledons or gymnosperm.More specifically, described plant includes, but is not limited to: wheat, barley, rye, paddy rice, corn, jowar, beet, apple, pears, Lee, peach, apricot, cherry, strawberry, rasp berry, blackberry, blueberry, beans, French beans, pea, soybean, rape, mustard, opium poppy, olea, Sunflower Receptacle, coconut, the Viscotrol C plant, cocoa beans, peanut, cucurbit, cucumber, watermelon, cotton, flax, hemp, jute, citrus, lemon, natsudaidai, spinach, the piemarker lettuce, asparagus, cabbage, Chinese cabbage, Plantula Brassicae chinensis, Radix Dauci Sativae, onion, potato, tomato, green pepper, avocado, cassia bark, camphor, tobacco leaf, nut, coffee, eggplant, sugarcane, tealeaves, pepper, grapevine, oyster fiber crops grass, banana, natural rubber tree and ornamental plant etc.

As a kind of optimal way, described " plant " includes but not limited to: Cruciferae, Gramineae, rosaceous plant.Such as, described " plant " includes but not limited to: Chinese cabbage, Plantula Brassicae chinensis that the Cruciferae rape belongs to; Cruciferae mouse ear mustard; Paddy rice gramineous, wheat, Chinese sorghum, corn; Comprise in addition tobacco, melon and fruit, vegetables, rape etc.More preferably, described " plant " is the plant that the Cruciferae rape belongs to or mouse ear mustard belongs to.

As used herein, " separation " refers to that material separates (if natural substance, primal environment is natural surroundings) from its primal environment.As the polynucleotide under the native state in active somatic cell and polypeptide do not have separation and purification, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, for separation and purification.

As used herein, " HTT polypeptide " refer to derive from Arabidopis thaliana or other plant there is higher homology (as homology higher than 40% with sequence SEQ IDNO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:15, SEQID NO:17, SEQ ID NO:19 or SEQ ID NO:21; Preferably higher than 50%; Preferably higher than 60%; More preferably higher than 70%; More preferably higher than 80%; More preferably higher than 90%; More preferably higher than 95%; More preferably higher than 98%) the general name of a class polypeptide.

As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... form ", " basically by ... form " and " by ... form "; " mainly by ... form ", " basically by ... form " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".

Polypeptide of the present invention (albumen) can be recombinant polypeptide, natural polypeptides, synthetic polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology for example, to produce from protokaryon or eucaryon host (, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, can be maybe nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of HTT polypeptide.As used herein, term " fragment ", " derivative " refer to and basically keep biological function or the active polypeptide that polypeptide of the present invention is identical with " analogue ".Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferably conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, there is the polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that extends the polypeptide transformation period, polyoxyethylene glycol for example) merge formed polypeptide, or (iv) additional aminoacid sequence be fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying, or fusion rotein).Belong to the known scope of those skilled in the art according to these fragments of definition, derivative and the analogue of this paper.

The bioactive fragment of any HTT polypeptide can be applied in the present invention.Here, the implication of described bioactive fragment refers to as a peptide species, and it still can keep all or part of function of corresponding full-length polypeptide.Generally, described bioactive fragment at least keeps the activity of 40% full-length polypeptide.Under preferred condition, described active fragments can keep 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% activity of full-length polypeptide.

In the present invention, described " HTT polypeptide " refers to have the polypeptide of the SEQID NO:4, SEQ ID NO:5, SEQ ID NO:8 or the SEQ ID NO:11 sequence that improve the plant heat resistance property functionally active.This term also comprises having and described polypeptide identical function, variant form above-mentioned sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8,1-5) amino acid whose disappearance, insertion and/or replacement, and add one or several (being generally in 20, is preferably in 10, is more preferably in 5) amino acid at C-terminal and/or N-terminal.For example, in the art, when close or similar amino acid is replaced by performance, usually can not change the function of polypeptide.Again such as, add one or several amino acid at C-terminal and/or N-terminal and usually also can not change the function of polypeptide.This term also comprises active fragments and the reactive derivative of described polypeptide.

The variant form of polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, albumen that can be coded with the DNA of above-mentioned protein D NA hybridization under high or low rigor condition and polypeptide or the albumen that utilizes the antiserum(antisera) acquisition of anti-described albumen.

Any and described peptides homologous high and there is the polypeptide that improves the Heat Resistance of Plant sexual function and be also included within the present invention.

Invention also provides the analogue of described albumen or polypeptide.The difference of these analogues and native protein can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.These polypeptide comprise genetic variant natural or that induce.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and the analogue with that exist or the synthetic amino acid (as β, gamma-amino acid) of non-natural.Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide exemplified.

(usually the not changing primary structure) form of modification comprises: the chemically derived form of the polypeptide that body is interior or external is as acetylize or carboxylated.Modify and also comprise glycosylation.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " the conservative property variation polypeptide of polypeptide of the present invention " refers to compare with the aminoacid sequence of SEQ ID NO:4, SEQID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19 or SEQ ID NO:21, there are 50 at the most, preferably at the most 40, more preferably at the most 30, more preferably at the most 20, more preferably at the most 10, more preferably at the most 5,3 amino acid amino acid similar or close by character are replaced and form polypeptide at the most best.These conservative property variation polypeptide preferably carry out amino acid substitution according to table 1 and produce.

Table 1

Amino-acid residue	Representational replacement	The preferred replacement
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The invention still further relates to the polynucleotide sequence of code book invention polypeptide or its conservative property variation polypeptide, i.e. HTT gene or its homologous gene.Described polynucleotide can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.Described polynucleotide can with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, the varient of the identical or degeneracy of the sequence shown in SEQ ID NO:18 or SEQ ID NO:20.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise coding said polypeptide, can be also the polynucleotide that also comprise additional code and/or non-coding sequence.The polynucleotide of encoding mature polypeptide comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; The encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from the function of the polypeptide that changes in fact its coding.

The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " refers to: (1) at the hybridization than under low ionic strength and comparatively high temps and wash-out, as 0.2 * SSC, and 0.I%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding also has the function that improves plant heat resistance property.

A.lyrata (Arabidopsis.lyrata) belongs to for being all Cruciferae mouse ear mustard with Arabidopis thaliana, and Chinese cabbage (Brassica.rapa) belongs to the Cruciferae Btassica.The homology of corresponding polypeptide prediction and analyzing as Fig. 6 in HTT polypeptide and Chinese cabbage in Arabidopis thaliana, the polypeptide in visible two kind of plant sources is homologies highly, has same structural domain, the function of bringing into play in plant is also roughly the same.

Should understand, although plant heat resistanceheat resistant of the present invention (heat-resisting) gene is preferably available from cress, but the HTT gene height homology with the Arabidopis thaliana source available from other plant (as has more than 40%, preferably more than 50%, more than 60%, more preferably more than 70%, more preferably more than 80%, as 85%, 90%, 95%, even 98% sequence homogeny) the scope also considered in the present invention of other gene within.The Method and kit for of aligned sequences homogeny is also that this area is known, for example BLAST.

The Nucleotide full length sequence of polynucleotide of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually need to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplified is stitched together by proper order.

The present invention also relates to the carrier that comprises described polynucleotide, and the host cell produced through genetically engineered with described carrier or polypeptid coding sequence.

Polynucleotide sequence of the present invention can be inserted in recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral or other carriers.In a word, as long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is usually to contain replication orgin, promotor, marker gene and translation controlling elements.

Comprise above-mentioned suitable DNA sequence dna and the suitable carrier of promotor or control sequence, can be for transforming suitable host cell, with can marking protein.Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; The fungal cell is as yeast; Vegetable cell etc.

When described polynucleotide are expressed in higher eucaryotic cells, if will make to transcribe to be enhanced while in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs, act on promotor transcribing with enhancing gene usually.

Persons skilled in the art are all known the suitable carrier of How to choose, promotor, enhanser and host cell.

With the recombinant DNA transformed host cell, can carry out with routine techniques well known to those skilled in the art.Conversion of plant can be used the methods such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as spraying, Ye Panfa, Rice Young Embryo conversion method etc.Can use ordinary method regeneration plant for the vegetable cell, tissue or the organ that transform, thereby obtain the plant that heat-resisting proterties changes.

The invention provides the purposes of described polypeptide or its encoding gene, for improving the thermotolerance of plant.

The invention still further relates to a kind of method that improves plant, the method comprises the expression that improves HTT polypeptide in described plant.

After the purposes that obtains the described polypeptide of cicada, can adopt several different methods well known in the art to improve the expression of described polypeptide.The ceneme (such as expression vector or virus etc.) that will carry polynucleotide such as approach that can be known by those skilled in the art is delivered on target spot, and makes it the polypeptide of expression activity.

As one embodiment of the present invention, polynucleotide are cloned in suitable carrier by conventional method, the described recombinant vectors with foreign gene is imported in vegetable cell, make described vegetable cell express described polypeptide.Can, by by described vegetable cell regeneration plant, obtain the plant of the described polypeptide of overexpression.

Preferably, provide a kind of method for preparing transgenic plant, having comprised:

(1) the HTT gene of external source or its homologous gene are proceeded to vegetable cell, tissue, organ or tissue, obtain and be transformed into HTT gene or its homogenic vegetable cell, tissue, organ or seed; With

(2) what step (1) is obtained has proceeded to external source HTT gene or its homogenic vegetable cell, tissue, organ or seed regeneration plant plant.

As a kind of preferred example, described method comprises step:

(s1) provide the Agrobacterium of carrying expression vector, described expression vector contains HTT gene or its homologous gene;

(s2) vegetable cell, tissue, organ are contacted with the Agrobacterium in step (s1), thereby make HTT gene or its homologous gene proceed to vegetable cell, and be incorporated on the karyomit(e) of vegetable cell;

(s3) select and proceed to HTT gene or its homogenic vegetable cell, tissue, organ or seed; And

(s4) by the vegetable cell in step (s3), tissue, organ or seed regeneration plant.

Other method that increases HTT gene or the expression of its homologous gene is that this area is known.For example, thus can be by drive to strengthen HTT gene or its homogenic expression with strong promoter.Perhaps by enhanser (as paddy rice waxy gene First Intron, Actin gene First Intron etc.), strengthen HTT gene or its homogenic expression.The strong promoter that is applicable to the inventive method includes but not limited to: 35s promotor, the Ubi promotor of paddy rice, corn etc.

Can adopt any suitable conventional means, comprise that reagent, temperature, pressure condition etc. implement described method.

In addition, the invention still further relates to and utilize HTT gene or its homologous gene tracking mark as a kind of gene transformation plant offspring.The invention still further relates to and utilize HTT gene or its homologous gene as a kind of molecule marker, by detecting HTT gene or its homogenic expression in plant, the thermotolerance of plant identification, and can be used as the cue mark of true hybrid in the hybrid seeding process.

The inventor also finds under study for action, has the binding site of ta-siR255 (this siRNA is referring to document [10]) on the mRNA of HTT gene, and in plant, HTT gene or its homogenic expression also are subject to the regulation and control of ta-siR255.The combination of the mRNA of ta-siR255 and HTT gene causes the reduction of HTT genetic expression, affects the temperature capacity of plant.Therefore, suppressing the expression of ta-siR255 or the material of activity or the material that minimizing ta-siR255 is combined with the mRNA of HTT gene is useful for the thermotolerance that improves plant.

In plant, expression specificity and a kind of blocking-up, minimizing or antagonism ta-siR255 and the mRNA complementation of coding HTT polypeptide or the polynucleotide of combination, be also useful for the thermotolerance that improves plant.Cross and express blocking-up, minimizing or antagonism ta-siR255 and the mRNA complementation of coding HTT polypeptide or the polynucleotide of combination, can make endogenous ta-siR255 be combined with these polynucleotide competitively, thereby reduce the interference that endogenous ta-siR255 expresses HTT.Those skilled in the art based on known general knowledge should be understood that any can complementary with ta-siR255 (part be complementary or all complementary) or in conjunction with and can block, polynucleotide that minimizing or antagonism ta-siR255 are combined with the mRNA of the HTT polypeptide of encoding are all useful for the present invention.

As optimal way of the present invention, described blocking-up, minimizing or antagonism ta-siR255 are MIM255 with the mRNA complementation of coding HTT polypeptide or the polynucleotide of combination, and it has the nucleotide sequence shown in SEQ ID NO:23.MIM255 can be combined with endogenous ta-siR255 competitively, makes ta-siR255 not play shearing action, thereby has reduced the interference that ta-siR255 expresses HTT.Perhaps, described blocking-up, minimizing or antagonism ta-siR255 have the nucleotide sequence shown in SEQ ID NO:24 (nucleotide sequence that wherein includes MIM255) with the mRNA complementation of coding HTT polypeptide or the polynucleotide of combination.

On the polynucleotide basis with the nucleotide sequence shown in SEQ ID NO:23 or SEQ ID NO:24, through one or more (as individual as 1-8; Preferably 1-6, better 1-5, as 2,3,4) replacement, disappearance or the interpolation of Nucleotide and the polynucleotide that form are also included within the present invention, as long as it also has blocking-up, minimizing or antagonism ta-siR255 and the mRNA complementation of coding HTT polypeptide or the activity of combination.When these class polynucleotide of design, suitable Nucleotide replaces, lacks or add is technology well known in the art, and described technology is easy to be implemented and guarantee not change the biological activity (blocking-up, minimizing or antagonism ta-siR255 are combined with the mRNA of coding HTT polypeptide) of gained molecule.

Therefore, the present invention also provides a kind of method that improves plant heat resistance property, and described method comprises step:

(i) provide the Agrobacterium of carrying expression vector, described expression vector contains the polynucleotide of can antagonism ta-siR255 being combined with the mRNA of coding HTT polypeptide;

(ii) vegetable cell, tissue or organ are contacted with the Agrobacterium in step (i), thereby make described polynucleotide of can antagonism ta-siR255 being combined with the mRNA of coding HTT polypeptide proceed to plant.

(iii) select vegetable cell, tissue, the organ that has proceeded to described construction; And

(iv) by vegetable cell, tissue, neomorph in step (iii) and select transgenic plant.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only are not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, write molecular cloning experiment guide, Science Press, the condition described in 2002, or the condition of advising according to manufacturer usually as J. Pehanorm Brooker etc. according to normal condition.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Unless otherwise defined, the same meaning that all specialties of using in literary composition and scientific words and one skilled in the art are familiar.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.

I. materials and methods

The sequence explanation of some genes

In Arabidopis thaliana:

HTT1 (At4G29770) genome sequence is as SEQ ID NO:1;

HTT1.1 (At4G29770.1) open reading frame sequence is as SEQ ID NO:2;

HTT1.2 (At4G29770.2) open reading frame sequence is as SEQ ID NO:3;

HTT1.1 (AT4G29770) coding protein sequence is as SEQ ID NO:4;

HTT1.2 (AT4G29770) coding protein sequence is as SEQ ID NO:5;

HTT2 (At5G18040) genome sequence is as SEQ ID NO:6;

HTT2 (At5G18040) open reading frame sequence is as SEQ ID NO:7;

HTT2 (At5G18040) coding protein sequence is as SEQ ID NO:8;

HTT3 (At5G18065) genome sequence is as SEQ ID NO:9;

HTT3 (At5G18065) open reading frame sequence is as SEQ ID NO:10;

HTT3 (At5G18065) coding protein sequence is as SEQ ID NO:11;

The AT4G29760 open reading frame sequence is as SEQ ID NO:12;

The AT4G29760 coding protein sequence is as SEQ ID NO:13.

In Chinese cabbage, the HTT homologous gene has four, is respectively Bra039897, Bra011210, and Bra010277 and Bra010276:

The Bra039897 open reading frame sequence is as SEQ ID NO:14;

The Bra039897 protein sequence is as SEQ ID NO:15;

The Bra011210 open reading frame sequence is as SEQ ID NO:16;

The Bra011210 protein sequence is as SEQ ID NO:17;

The Bra010277 open reading frame sequence is as SEQ ID NO:18;

The Bra010277 protein sequence is as SEQ ID NO:19;

The Bra010276 open reading frame sequence is as SEQ ID NO:20;

The Bra010276 protein sequence is as SEQ ID NO:21.

RNA interfering:

The ta-siR255 sequence is as SEQ ID NO:22.

The sequence of MIM255 is as SEQ ID NO:23.This sequence is as the complementary sequence of ta-siR255, than ta-siR255 many 3 bases, this can reach the effect of competitive binding effectively.

The total RNA of plant tissue extracts

Adopt TaKaRa RNAiso Reagent extraction agent box to extract the total RNA of plant tissue.Step:

A) material is fully ground in liquid nitrogen, add in sample with the amount of 100mg material 1ml extraction buffer, fully mix standing 10 minutes of room temperature.

B) 13000rpm is centrifugal 5 minutes, and supernatant is proceeded in new centrifuge tube, adds 200 μ l chloroforms, fully mixes, and room temperature makes its layering in standing 10 minutes.

C) 13000rpm is centrifugal 5 minutes, carefully draws supernatant in new centrifuge tube.

D) add the equal-volume Virahol, mix rear room temperature standing 10 minutes.

E) 13000rpm is centrifugal 5 minutes, with 1ml 75% ethanol, washes once after abandoning supernatant.

F) 7800rpm is centrifugal 5 minutes, abandons low-speed centrifugal after supernatant, with the rifle head, sucks residual liquid, and room temperature is dried, and until RNA, just after drying, adds the appropriate water without RNase, after within 65 ℃, 10 minutes, fully dissolving, is stored in-70 ℃.

Quantitation RT-PCR primer

HTT1：

HTT1-RT-S：5’＞GAAGCGTTGAAGCTGGGTATG＜3’；(SEQ ID NO：25)

HTT1-RT-A：5’＞GTCGTCACCATTAAGCGGGAG＜3’(SEQ ID NO：26)；

HTT1.1：

HTT1.1-S：5’＞AACTACGCTGAGGGGGAAATAAG＜3’(SEQ ID NO：27)；

HTT1.1-A：5’＞ACTAAGGAGGTTTCCGACAGTGT＜3’(SEQ ID NO：28)；

HTT1.2：

HTT1.2-S：5’＞GCAACGAAAATTGACAAAAACGG＜3’(SEQ ID NO：29)；

HTT1.2-A：5’＞ACTAAGGAGGTTTCCGACAGTGT＜3’(SEQ ID NO：30)；

HTT2：

HTT2-RT-S：5’＞TGGATAATGCTGGGAAGGAAG＜3’(SEQ ID NO：31)；

HTT2-RT-A：5’＞CTGGACAAACATACGGCTCAA＜3’(SEQ ID NO：32)；

HTT3：

HTT3-RT-S：5’＞GACTAAGAGTTTGGATGAAGCGT＜3’(SEQ ID NO：33)；

HTT3-RT-A：5’＞TTAGTTGACAGATAAGCGTGGG＜3’(SEQ ID NO：34)；

ACTIN：

Forward: 5 '>TGGCATCAYACTTTCTACAA<3 ' (SEQ ID NO:35);

Oppositely: 5 '>CCACCACTDAGCACAATGTT<3 ' (SEQ ID NO:36).

TAS1a：

Forward: 5 '>AGTAAACATGAGCGCCGTCAA<3 ' (SEQ ID NO:37);

Oppositely: 5 '>TGGCTGGTGACAAATAGACAGG<3 ' (SEQ ID NO:38).

TAS1b：

Forward: 5 '>AGTAAACATGAGCGCCGTCAA<3 ' (SEQ ID NO:39);

Oppositely: 5 '>CAAAGTTGTCTCCTCCTGAAA<3 ' (SEQ ID NO:40).

TAS1c：

Forward: 5 '>TCCTTCCCGTCCTCTTCTTTG<3 ' (SEQ ID NO:41);

Oppositely: 5 '>GATGCTTCTTCGCTACACCTC<3 ' (SEQ ID NO:42).

The Northern hybridization probe

Ta-siR255：5’＞TACGCTATGTTGGACTTAGAA(biotin)＜3’(SEQ ID NO：43)。

U6：5’＞TCATCCTTGCGCAGGGGCCA(biotin)＜3’(SEQ ID NO：44)。

Real Time RT-PCR

Reagent:

AMV ThermoScript II (TAKARA); RNase inhibitor (TAKARA); DNase I (RNase free) (TAKARA); SYBR green Kit (TAKARA).

Step:

A) extract respectively total RNA of the Arabidopsis leaf of different heat treatment, with DNase I (RNase free), process phenol chloroform extracting afterwards in 30 minutes, precipitation, dry up, without the water dissolution of RNase.

B) survey OD260 and electrophoresis quantitatively after, get the total RNA of 1 μ g, the by specification operation, 42 ℃ of reactions 1 hour, 94 ℃ 5 minutes so that the ThermoScript II inactivation.

C) the SYBR green Kit of TAKARA is used in reaction.Program is 94 ℃ of 2min, 94 ℃ of 15sec, annealing 15sec, 72 ℃ of 30sec, 40 circulations.Add 10 μ l after 10 times of cDNA dilutions, using the primer of ACTIN as internal reference.

PCR system (25 μ l):

SYBR green Kit 12.5μl；

5 ' primer 0.5 μ l;

3 ' primer 0.5 μ l;

cDNA 10μl；

ddH ₂O 1.5μl。

Build over-express vector PCR primer

HTT1.1：

HTT1.1-S：5’＞C TCTAGAGATGGAGTCATTGTTAGAATGTT＜3’(SEO IDNO：45)；

HTT1.1-A：

5’＞CGCCATGGC GTCGACGTTGATAGAAAAACGTGGGATACAG＜3’(SEQ ID NO：46)；

HTT1.2：

HTT1.2-S：5’＞CGG GGTACCCGATGTTGTTGTTTAAGCCTTCA＜3’(SEQ ID NO：47)；

HTT1.2-A：5’＞CGC GGATCCTTAGTTGATAGAAAAACGTGGGATAC＜3’(SEQ ID NO：48)；

HTT2：

HTT2-S：5’＞CGG GGTACCATGAATATGATTCAGCGATTC＜3’(SEO IDNO：49)；

HTT2-A：5’＞AA CTGCAGTTAGTTGATAGATAAGCGTGGGAT＜3’(SEOID NO：50)；

HTT3：

HTT3-S：5’＞CG GGATCCTATGGATATGAATCAGCTATTCATGC＜3’(SEQID NO：51)；

HTT3-A：

5’＞CATGCCATGGT GTCGACCTTGAAAGCACATTCAAGGC＜3’(SEQ IDNO：52)；

Mutant IPS1：

MIM255-S：

5’＞AATACGCTATGTGCTAGGACTTAGAAAGCTTCGGTTCCCCTCG＜3’(SEQ ID NO：53)；

MIM255-A：

5’＞CTTTCTAAGTCCTAGCACATAGCGTATTTCTAGAGGGAGATAA＜3’(SEQ ID NO：54)；

IPS1-S：5’＞GT GGATCCAAGAAAAATGGCCATCCCCTAGC＜3’(SEQ IDNO：55)；

IPS1-A：5’＞ACGC GTCGACGAGGAATTCACTATAAAGAGAATCG＜3’(SEQ ID NO：56)。

The 35S over-express vector builds

What the heat resistanceheat resistant transgenic line was used herein is that genomic fragment is cloned from the total DNA of arabidopsis gene group by the method for PCR.Concrete construction process is as follows:

Adopt the HTT1.1 primer: the two ends at primer have added respectively Xba1, and the Sal1 restriction endonuclease sites, after being cloned into the gDNA fragment of HTT1.1, is used Xba1, after the Sal1 double digestion, is connected in expression vector pCAMBIA1301 (purchased from CAMBIA).

Adopt respectively HTT1.2, HTT2, the HTT3 primer, pass through respectively Kpn1/BamH1; Kpn1/Pst1; The BamH1/Sal1 double digestion is connected in expression vector pCAMBIA1301.

Mutant IPS1 (SEQ ID NO:24, contain the MIM255 sequence, cross expression in plant materials after, can be combined with endogenous ta-siR255, thereby reduce the interference that ta-siR255 expresses HTT, improve the expression amount of HTT in plant materials) build: utilize IPS1-S, MIM255-A and MIM255-S, after two pairs of primers of IPS1-A are cloned respectively 5 ' and 3 ' end of MIM255 precursor, then, by IPS1-S, IPS1-A be take 5 ' and 3 ' end fragment as template clone full length fragment.Due to IPS1-S, the two ends of IPS1-A primer have added respectively the BamH1/Sal1 restriction endonuclease sites, so, after using the BamH1/Sal1 double digestion, be connected in expression vector pCAMBIA1301 and get final product.

C) utilize the freeze thawing method for transformation that transgene carrier is imported in Agrobacterium GV3101 (purchased from Invitrogen), and PCR identify.

Preparation and the conversion of freeze-thaw method Agrobacterium competent cell

A) cultivate the mono-bacterium colony of picking Agrobacterium GV3101 the fresh flat board of 48 hours from 28 ℃, forward in 20ml LB liquid nutrient medium (rif 50mg/l, GM 50mg/l), in 28 ℃ of 250rpm shaking culture spend the night (can not be too dense).

B) ice bath is after 20 minutes, by the centrifuge tube of bacterium liquid packing 5ml (every pipe 4ml), and ice bath 10 minutes.

C) 4000rpm (5-10 ℃) is centrifugal 10 minutes, abandons bacterium liquid.

D) every pipe adds the 20mM CaCl of the abundant precooling of 1ml ₂with resuspended thalline.Ice bath 10 minutes.

E) 4000rpm (5-10 ℃) is centrifugal 10 minutes, abandons supernatant.

F) every pipe adds 300 μ l 20mM CaCl ₂(depending on cell concentration), be in charge of after merging in the centrifuge tube of 1.5ml.

G) every pipe adds 1 μ l plasmid or all connection products, ice bath 5 minutes, then put into liquid nitrogen 4-5 minute.

H) put 5 minutes for 37 ℃, every pipe adds 400 μ l LB cultivations within 2 hours, to make bacteria resuscitation based on 28 ℃ of incubations, and expresses corresponding antibiotics resistance gene.

I) respectively get 200 μ l volume coated plates, room temperature is placed a little while, in 28 ℃ of cultivations.

Flower-dipping method arabidopsis thaliana transformation and screening

Reagent:

Transform damping fluid (1L): macroelement (50 *): 10ml; Trace element (1000 *): 0.5ml; CaCl ₂(100 *): 5ml; Molysite (200 *): 2.5ml; Organic (100 *): 10ml; Sucrose: 50g; 6-BA (1mg/ml): 10 μ l; Silwet L-77:400 μ l (vacuum filtration is used 200 μ l); Be adjusted to pH5.8 with KOH, constant volume 1L.

Screening culture medium flat board: 3% sucrose MS ₀solid medium (pH5.8) adds kantlex (Kan) to 50mg/l (for the screening of Nossen background Arabidopis thaliana).

Step:

A) after the Arabidopis thaliana bolting, stem is high approximately can be transformed 5 centimetres the time, if plant setting percentage to be transformed is low, will after plant is pinched 4 days, carry out.

B) before transforming, flower and the angle of having pollinated are really got rid of.And the soil water suction is spent the night.

C) Agrobacterium of overnight incubation is diluted at 1: 100 in large bottle substratum, cultivate after 24 hours for 28 ℃, centrifugal 20 minutes of 4 ℃ of 5000rpm, abandon supernatant, Agrobacterium is precipitated in the conversion damping fluid of the two volumes that is suspended in original bacteria liquid, made OD600 in 0.8 left and right.

D) over-ground part of Arabidopis thaliana immerses in bacterium liquid 30 seconds fully, and taking-up keeps flat, and covers preservative film and newspaper, under dark, spends the night, and moves into that phytotron is normal vertically to be cultivated next day.After sowing dry 2 weeks.

E) seed is laid in the Ms0 solid plate containing 50mg/l Kan after aseptic sterilization, through 4 ℃ of vernalization, moves on to two days later group training chamber, blocks that resistance seedling and moves on to continued growth in soil.

F) get blade extraction genomic dna and detect and obtain positive seedling through PCR, then screening obtains genetically modified pure lines through two generations, for further analysis.

The Chinese cabbage transgenic method

The vacuum filtration method transforms Chinese cabbage: the Agrobacterium that inoculation contains destination carrier, in liquid YEP substratum (it is 7 that beef extract 5g/L regulates the pH value for peptone 10g/L, yeast extract 10g/L), 28 ℃, secretly is cultured to proper concn.4 ℃, 5000rpm, collect thalline in centrifugal 15 minutes.Add conversion damping fluid (MS in bacterial sediment ₀add appropriate silwet77), with glass stick, precipitation is broken up, shake up that to be placed on vacuum tank to be transformed.The Chinese cabbage inflorescence of bolting is immersed to bacterium liquid, build vacuum container cover, vacuum pump is bled 5 minutes, exits 2 minutes.Plant lucifuge after suction filtration is spent the night.Every other day overcover is taken away, looked afterwards the degree of blooming and pollinated.The seed of results is containing corresponding antibiotic MS ₀carry out resistance screening on substratum.Positive plant can be used for further phenotype analytical.

Transgenosis heat resistanceheat resistant phenotype analytical

Select respectively and turn HTT1, HTT2, the HTT3 gene overexpression is sowed at MS respectively for strain and wild-type with the Arabidopis thaliana T3 that turns MIM255 ₀on substratum, under 22 ℃ of illumination conditions, cultivate 7 days.Under the long consistent condition of wild-type and transgenic line, culture dish was placed under 44 ℃ of conditions to heat shock after 1 hour, take out to be placed under 22 ℃ of illumination conditions and cultivate again 7 days, now can be observed transgenic line and can normally survive after heat shock than wild-type, show that it has remarkable heat impedance.The transgenosis heat resistanceheat resistant phenotype of Chinese cabbage also adopts this survival test to be analyzed.

II. embodiment

Embodiment 1, quantitative RT-PCR detect the expression of candidate's heat resistanceheat resistant gene after thermal treatment

The quantitative RT-PCR experimental result is consistent with chip data, and after thermal treatment, HTT1, HTT2 and HTT3 all are increased significantly (Fig. 1) before expressing and processing.Wherein, the expression amount of HTT2 (At5G18040) the approximately 10 times of left and right of having risen after 0.5 hour in thermal treatment, continue to rise slowly afterwards, and within this test treatment time, its highest multiple finally reached is about processes front 18 times (Figure 1A); The expression amount of HTT3 (At5G18065) has improved approximately 23 times of left and right in 0.5 hour in processing, and keeps rising, and the highest multiple that can reach in the treatment time is 40 times of left and right (Figure 1A); What is interesting is most HTT1, in Arabidopis thaliana, the inventor has detected two transcripts altogether, respectively called after HTT1.1 (At4G29770.1) and HTT1.2 (At4G29770.2).Generally speaking, the expression amount of HTT1 shows as sharply and raises in thermal treatment in 0.5 hour, has reached 80 times of left and right before processing, and still continues afterwards to raise.In treatment time, its highest multiple that can reach is 280 times of left and right (Figure 1B).Wherein the expression of HTT1.1 and HTT1.2 occurs similarly to change, and just, under same treatment time point, the expression amount of HTT1.1 exceeds doubly left and right of 20-80 than HTT1.2; In addition, the inventor has also detected At4G29760 and the expression pattern (Fig. 1 C) of At1G51670 before and after thermal treatment, result shows that At4G29760 shows as the trend raise gradually after processing, and in the treatment time, its highest multiple that can reach is 8 times of left and right.Downward trend appears in 0.5-3 hour after thermal treatment in the expression of At1G51670, raises until process front 5 times of left and right gradually again afterwards.

To sum up, these five response that the gene mRNA level shows thermal treatment, especially HTT1, HTT2 and HTT3, disclosing them invariably and the plant heat resistanceheat resistant exists close relationship.

The inventor has cloned respectively HTT1, HTT2 and HTT3, and its sequence is analyzed.Result shows:

(1) HTT1, HTT2 and HTT3 approach (Fig. 1 D) on sibship very much, between the prompting three, may have the redundancy on function.

(2) all have the binding site (Fig. 2 A) of ta-siR255 on their mRNA, this discovery shows that there are the post-transcriptional level regulation and control in the genetic expression of HTT1, HTT2 and HTT3.

(3) promoter sequence the analysis showed that, all has nnGAAnnTTCnnGAAnn and AGGGG motif (Fig. 2 C) on HTT1.1, HTT2 and HTT3 promotor, and this two classes motif is considered to HSF binding motif in plant materials ^[8,9].

All these sequence signatures are inventor's better utilised genetic engineering means undoubtedly, by the expression of various aspect regulation and control HTT1, HTT2 and HTT3, and may thereby hot the providing of Genes For Plant Tolerance is provided.

The heat resistanceheat resistant gene transgenic plant phenotype of embodiment 2, Arabidopis thaliana

The inventor has built respectively a plurality of transgene carriers arabidopsis thaliana transformation, has obtained the transgenic line of a plurality of HTT1, HTT2 and HTT3 overexpression, and these transgenic lines have been carried out to heat treatment experiment.Result is as follows:

HTT1 and HTT2 cross the expression strain, and than wild-type contrast and hsfA1a/1b double-mutant (referring to reference [11]), (HsfA1A/1B is heat shock factor, they can activate the expression of HTT1, HTT2 and HTT3) all occur that heat resistanceheat resistant phenotype (Fig. 3 A), quantitative RT-PCR the analysis showed that the accumulation volume of its mRNA in excessively expressing the Arabidopis thaliana plant is apparently higher than contrast (Fig. 3 D and 3E).

In Arabidopis thaliana, HTT3 crosses the heat resistanceheat resistant of expression strain and the analysis showed that, in 7 all mistake expression strains, have 2 strains that obvious heat resistanceheat resistant phenotype (Fig. 3 B) is arranged, similarly, in these two strains, the inventor has also detected a large amount accumulation (Fig. 3 F) of mRNA.

The inventor imports Agrobacterium GV3101 by the pCAMBIA1301 recombinant vectors that contains HTT1.2, HTT2, HTT3 of aforementioned structure, transform Chinese cabbage, obtained the transgenic line of a plurality of HTT1, HTT2 and HTT3 overexpression, and these transgenic lines have been heat-treated to experiment.

Transgenosis Chinese cabbage heat resistanceheat resistant experimental result: transgenosis Chinese cabbage T2 is carried out to 44 ℃ of heat shocks after 1 hour for positive seedling, cultivate 7 days under 22 ℃ of illumination conditions, turn as seen HTT1, HTT2, the Chinese cabbage survival rate of seedling of HTT3 overexpression is far away higher than the wild-type adjoining tree, high more than 50%.

It is hot that the expression of embodiment 3, regulation and control HTT1, HTT2 and HTT3 improves Genes For Plant Tolerance

The inventor intends regulating and controlling by post-transcriptional level the expression of HTT1, HTT2 and HTT3, and then it is hot to improve Genes For Plant Tolerance.

For this reason, the inventor has built MIM255 over-express vector (Fig. 2 B) and has proceeded to Arabidopis thaliana.In 4 strains that obtain, there are 3 strains to show obvious heat resistanceheat resistant phenotype (Fig. 3 C).What answer in contrast is the excess accumulation (Fig. 3 G) of its mRNA.

The inventor has also measured Ta-siR255 precursor TAS1a, TAS1b, the TAS1c response before and after thermal treatment, and result is as Fig. 4 A; And measured the response of Ta-siR255 before and after thermal treatment, result is as Fig. 4 B.Remarkable up-regulated, after thermal treatment, occurs in visible Ta-siR255 precursor; But, the time that Ta-siR255 response thermal treatment is raised obviously lags behind the time of its target gene thermal response, this phenomenon hint target gene expresses after thermal treatment that sharply to increase may be due to due to the temporary transient releasing of the shearing effect of Ta-siR255, prolongation along with heat treatment time, Ta-siR255 also can raise, and this expression that has yet guaranteed the HTT gene can be not out of control.

Embodiment 4, be heat-treated to the quantitative statistics result of motility rate

The surviving rate statistics that the T3 of all acquisitions generation isozygotys after the thermal treatment of transgenic arabidopsis strain is as Fig. 5.From Fig. 5 A, after HTT1 and HTT2 cross the thermal treatment of expression strain, the plant survival rate is all more than 90%.From Fig. 5 B, after HTT3 crosses the thermal treatment of expression strain, the plant survival rate is about 90%.From Fig. 5 C, after MIM255 crosses the thermal treatment of expression strain, three strain survival rates are more than 85%, and indivedual strain survival rates are about 12%, correspondingly be that the expression amount of MIM255 in this strain is also relatively low.In addition, the survival rate of thermal treatment wild-type plant (CK) is only 5% left and right.

To sum up, Arabidopis thaliana HTT1, HTT2 and HTT3 are very effective heat resistanceheat resistant genes.Reasonably utilize their diversified control methods, improve the heat impedance of plant by genetically engineered, improving the viability of plant under the heat stress adverse environmental factor has boundless application prospect.

All documents of mentioning in the present invention are all quoted as a reference in this application, just as each piece of document quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Reference:

[1] Tian little Hai, Luo Haiwei, Zhou Heng is many, Wu Chenyang. rice in China heat evil research history, progress and prospect. Chinese agronomy circular .2009,25 (22): 166-168.

[2] Zeng Qingping, Guo Yong. plant Stress response and system induction of resistance. the chemical .1997 of life, 17 (3): 31-33.

[3] Song Hongyuan, thunder is for army building, Li Chengqiong. and vegetable hot is coerced reaction and heat tolerance and evaluation. China's Vegetable .1998, (1): 48-50.

[4] Ma Dehua, Pang Jinan, Huo Zhenrong etc. the resistance research of cucumber to the differing temps adverse circumstance. Scientia Agricultura Sinica 1999,32 (5): 28-35.

[5] Yao Yuangan, Shi Xuehui, Yang Jianguo. the relation of capsicum thermotolerance and leaf membrane permeability and several biochemical substances content. the journal .2000 of Agricultural University Of Hunan, 26 (2): 97-99.

[6] Li Tongxiang, Wang Jinke. gene chip and plant gene Differential expression analysis. plant research .2002.22 (3): 310-313.

[7]Seki M.Narusaka M.Abe H.Monitoring the expression pattern of 1300Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray.Plant cell.2001.13(1)：61-72.

[8]Ayako N，Ryota N，Hideki H，Hitoshi T，Takanori M，Masahiro T，Miho I，Masaru OT，Kazuya Y，Yukinori Y and Shigeru S.HsfA1d and HsfA1e Involved in the Transcriptional Regulation of HsfA2 Function as Key Regulators for the Hsf Signaling Network in Response to Environmental Stress.Plant Cell Physiol.2011.52(5)：933-945.

[9]Sakurai H，Enoki Y.Novel aspects of heat shock factors：DNA recognition，chromatin modulation and gene expression.FEBS J.2010.277(20)：4140-9.

[10]Angela P，Manabu Y，Gang W，Heidi L.A，R.Scott P.SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis.Genes Dev.2004.(18)：2368-2379.

[11]Lohmann C，Eggers-Schumacher G，Wunderlich M，

F.Twodifferent heat shock transcription factors regulate immediate early expression of stress genes in Arabidopsis.Mol Genet Genomics.2004.271(1)：11-21。

Claims

1. the purposes of the polynucleotide of a HTT polypeptide or this polypeptide of encoding, for improving plant heat resistance property.

2. purposes as claimed in claim 1, is characterized in that, described HTT polypeptide is selected from:

(b) aminoacid sequence shown in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQID NO:15, SEQ ID NO:17, SEQ ID NO:19 or SEQ ID NO:21 is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and there is the derivative polypeptide by (a) that improves the Heat Resistance of Plant sexual function;

(c) there is 40% above homogeny with aminoacid sequence shown in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQID NO:15, SEQ ID NO:17, SEQ ID NO:19 or SEQ ID NO:21, and there is the derivative polypeptide by (a) of raising Heat Resistance of Plant sexual function.

3. purposes as claimed in claim 1, it is characterized in that, the polynucleotide of described coding HTT polypeptide are selected from: have SEQ ID NO:1, or SEQ ID NO:2, or SEQ ID NO:3, or SEQ ID NO:6, or SEQ ID NO:7, or SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:14, or SEQ ID NO:16, or the polynucleotide of nucleotide sequence shown in SEQ ID NO:18 or SEQ ID NO:20.

4. purposes as claimed in claim 1, is characterized in that, described plant is selected from: cress; More preferably be selected from Brassica plants or mouse ear mustard; More preferably be selected from Chinese cabbage (Brassica.rapa) or Arabidopis thaliana (Arabidopsis thaliana).

5. polynucleotide are selected from lower group:

(b) 11-14 position Nucleotide in the nucleotide sequence shown in SEQ ID NO:23 is formed through replacement, disappearance or the interpolation of one or more Nucleotide, and there are the polynucleotide of the function that antagonism ta-siR255 is combined with the mRNA of the HTT polypeptide of encoding; Or

(c) 236-239 position Nucleotide in the nucleotide sequence shown in SEQ ID NO:24 is formed through replacement, disappearance or the interpolation of one or more Nucleotide, and there are the polynucleotide of the function that antagonism ta-siR255 is combined with the mRNA of the HTT polypeptide of encoding; Or

6. the purposes of polynucleotide as claimed in claim 5, is characterized in that, for improving plant heat resistance property.

7. purposes as claimed in claim 6, is characterized in that, described plant is selected from: cress; More preferably be selected from Brassica plants or mouse ear mustard; More preferably be selected from Chinese cabbage (Brassica.rapa) or Arabidopis thaliana (Arabidopsis thaliana).

8. a method that improves plant heat resistance property, described method comprises: the expression or the activity that improve HTT polypeptide in plant; Or

Reduce expression or the activity of ta-siR255 in plant; Or

Improve the expression of the target gene of ta-siR255 in plant.

9. method as claimed in claim 8, is characterized in that, described method comprises: the polynucleotide of the HTT polypeptide of encoding proceed in plant; Or

Polynucleotide claimed in claim 5 are proceeded in plant.

10. method as claimed in claim 9, is characterized in that, described method comprises step:

(i) provide the Agrobacterium of carrying expression vector, polynucleotide or polynucleotide claimed in claim 5 that described expression vector contains coding HTT polypeptide;

(ii) vegetable cell, tissue or organ are contacted with the Agrobacterium in step (i), thereby make polynucleotide or the polynucleotide claimed in claim 5 of described coding HTT polypeptide proceed to plant.

11. method as claimed in claim 8, is characterized in that, described plant is selected from: cress; More preferably be selected from Brassica plants or mouse ear mustard; More preferably be selected from Chinese cabbage (Brassica.rapa) or Arabidopis thaliana (Arabidopsis thaliana).

12. the purposes of the polynucleotide of a HTT polypeptide or this polypeptide of encoding, as the stable on heating molecular marked compound of plant identification.