CN103290014B - Adversity inducible expression gene promoter and application thereof - Google Patents

Abstract

The invention provides separated DNA (deoxyribonucleic acid) which can guide nucleic acid which is operably connected with the down stream of the DNA to perform inducible expression in the condition of adversity of plants. The invention also provides an expression cassette containing a promoter, an expression vector, and a method for transforming plants through the expression cassette. The invention also provides a method for expressing an allos nucleotide sequence in plants through an adversity inducible expression gene promoter sequence.

Description

The gene promoter of an adverse circumstance abduction delivering and application thereof

Technical field

The invention belongs to plant gene engineering technology field, be specifically related to isolation identification and the application of a plant adverse circumstance abduction delivering promotor.

Background technology

The speed of growth of plant, except having its intrinsic hereditary basis, is subject to the impact of many environmental factorss toward contact meeting, the disadvantageous plant adverse circumstance of some of them has often limited plant normal growth, thereby causes crop failure.Plant adverse circumstance refers to grows to the normal growth of plant the environmental factors that has disadvantageous effect.Research finds, plant produced to the adverse circumstance of material impact and mainly contains the abiotic stresses such as arid, low temperature, saline and alkaline, high temperature, and the biological adverse circumstance such as pathogenic agent infringement.Abiotic stress or biological adverse circumstance all can cause the decline of various Crop yield and qualities.Plant adverse circumstance is bottlenecks of agricultural development in many areas, and therefore, cultivating and promote anti-adversity is the effective way that ensures crop high and stable yields.Utilize the adversity gene of plant self, can cultivate degeneration-resistant new variety by conventional breeding and molecular mark method, but, the utilization of resistant gene between kind has certain limitation, and transgenic method can overcome above-mentioned limitation, for crop breeding for stress tolerance is opened up a new approach.

Plant gene regulation and control are mainly carried out on transcriptional level, are subject to the mutual coordination of multiple cis-acting elements and trans-acting factor.Promotor is important cis-acting elements, it is the most important factor in Factor of gene expression, it determines whether a gene expresses, when expresses and where express substantially, it is generally positioned at 5 ' flank region of functional gene, can combine with trans elements such as RNA polymerase and other albumen cofactors, thus the initial sum speed that controlling gene is transcribed.The different characteristics that drives genetic expression according to it, promotor is divided into constitutive promoter and specificity promoter.Constitutive promoter can all cells or tissue in, regardless of time and spatially startup transcribe; Specificity promoter can be divided into again tissue-specific promoter and inducible promoter.

Inducible promoter refers to that the gene of its control, under the stimulation of some specific physics, chemistry and bio signal (being referred to as " elicitor " or " inducible factor "), can increase transcriptional level significantly.It is characterized by, the gene of the type promotor control is not expressed or is only had low-down expression (also referred to as " background expression ") under the condition that there is no inducible factor, once but being subject to the induction of inducible factor, the expression amount of gene is rapidly and increase considerably.Inducible promoter has broad application prospects.Compared with other type promotor, inducible promoter has uniqueness a little: it can be as required under specific etap of plant, histoorgan or growing environment, the "on" and "off" of rapid induction genetic transcription.

Thereby exogenous DNA array is enabled in the expression in plant host by being connected to specific promotor, the selection of promotor type determines expression time and the position of gene.At present agricultural biological technical field widespread use be mainly the strong promoter of some composing types, such as CaMV 35S promoter and corn Ubiquitin-1 promotor (Battraw and Hall, 1990; Christensen et al. 1992), but in the time utilizing the crops such as these promotors induction goal gene rice transformations to the quality of Crop Improvement, tending to time (etap specificity) due to destination gene expression or space (tissue and organ specificity) can not control well and cause improved effect not obvious, or because these constitutive promoter inducible gene expression amounts are too high, growing of plant impacted, these are all the obstacles running into while utilizing at present composing type strong promoter combined function gene to carry out Crop Improvement quality.Therefore, utilize adverse circumstance inducible promoter or organizing specific type promotor to come that controlling gene is specific expressed more and more to come into one's own, the expression that utilizes adverse circumstance inducible promoter to control adversity gene more and more comes into one's own, the promotor of some Stress responses, as SalT promotor (Garcia etc., The epression of the salt-responsive gene salt from rie is regulated by hormonal and developmental cues, Planta.207:172-180, 1998) etc. also identified out and attempted applying in the degeneration-resistant improvement of some crops.

For this reason, the inventor, through studying for a long period of time, has found a new adverse circumstance inducible promoter, in plant genetic engineering transformation, has a good application prospect.

Summary of the invention

Content of the present invention has provided some embodiments of the present invention, and in multiple situation, has provided variation and the change of these embodiments.Content of the present invention is examples a lot of and different embodiments, and mentioned given embodiment example is also one or more representational features.Such embodiment can have or not have mentioned feature conventionally; Equally, these features also can be applied in other embodiments of the present invention.For fear of too much repetition, all possible combination of these features is not enumerated or mentioned to content of the present invention.

The invention provides the nucleotide sequence of a kind of plant adverse circumstance inducible promoter, and clone and apply the method for this promotor.In some embodiments, method comprises that (a) is operably connected to gene nucleotide series the promotor KT626P that comprises sequence SEQ ID No:1, to produce expression cassette; (b) generate the transgenic plant that comprise this expression cassette, expressing said gene Nucleotide in plant thus.In some embodiments, described " generation " comprise and regenerate transgenic plant by expression cassette transformed plant cells and from transformed transgenic plant cells.Concrete summary of the invention is as follows.

In first aspect, the invention provides the DNA of separation, it can instruct the nucleic acid that is operatively coupled on its downstream to be subject to abduction delivering under the condition of adverse circumstance plant.

In this article, the DNA of this separation also can be called as stress inducibility promoter, belongs to cis-acting elements.Under the driving of stress inducibility promoter, the expression of its downstream the gene that is operably connected with it often can increase substantially under adverse environmental factor.In the specific embodiment of the present invention, directly differentiate the expression of adverse circumstance evoked promoter of the present invention under various adverse circumstance treatment condition by the observable staining of naked eyes.

" promotor " word refers to DNA regulating and controlling sequence herein, wherein conventionally contains a TATA box, this sequence can guide RNA polymerase II on suitable transcription initiation site the transcribing of initial specific coding sequence.Promotor also can contain other recognition sequences in addition, and they are usually located at the upstream or 5 ' of TATA box and hold, and are known as upstream promoter element, and these elements can affect transcription rate.Will be appreciated that when having differentiated after the nucleotide sequence of promoter region disclosed herein, separate and identify that other controlling element that is positioned at the specific promoter region upstream of differentiating herein has just belonged to prior art scope.Therefore, promoter region disclosed herein can comprise upstream controlling element in addition, as being responsible for the element of tissue specificity and temporal expression, element and the enhanser etc. of regulation and control constitutive expression.

In this article, term " is operably connected " and refers to a kind of mode of connection, and which makes to be connected to the transcribing and/or express by stress inducibility promoter of the present invention and open and begin and regulate and control of nucleic acid in downstream.Conventionally the nucleic acid, being operably connected is continuous.The nucleic acid in downstream can a small amount of Nucleotide in interval in the situation that keeping protein translation reading frame and be connected to the downstream of promotor, accepts its regulation and control.

In this article, term " separation " DNA refer to DNA from its natural environment (as, the genome of vegetable cell) in be separated, or by chemosynthesis or out recombinant expressed, and DNA not containing or substantially containing other nucleic acid, cell and the substratum of its source species.The DNA of separation of the present invention has shorter nucleotide sequence, and preferred sequence length is less than 2000 Nucleotide, is preferably less than 1500 Nucleotide, is more preferably less than 1200 Nucleotide.In the specific embodiment of the present invention, the DNA of separation of the present invention has the sequence shown in SEQ ID NO:1 in sequence table.

DNA also comprises the function equivalence body of the DNA with the sequence shown in SEQ ID NO:1, has the DNA of the series of variation of SEQ ID NO:1, and it still can instruct the nucleic acid abduction delivering under adverse environmental factor that is operatively coupled on its downstream.Series of variation be included under stringent condition can with the DNA sequence dna with the sequence DNA hybridization shown in SEQ ID NO:1." stringent condition " used herein is known, comprise such as containing 400mM NaCl, 40mM PIPES(pH6.4) and the hybridization solution of 1mM EDTA in 60 DEG C of hybridization 12-16 hour, then at 65 DEG C, wash 15-60 minute with the washings containing 0.1SDS and 0.1%SSC.

Series of variation also comprises the DNA sequence dna that has at least 90%, 95%, 96%, 97%, 98% or 99% sequence identity with sequence shown in SEQ ID NO:1.Wherein, the per-cent of sequence identity can obtain by known information biology algorithm, comprise Myers and Miller algorithm (Bioinformatics, 4 (1): 11-17, 1988), Needleman-Wunsch overall comparison method (J.Mol.Biol., 48 (3): 443-53, 1970), Smith-Waterman Local Alignment method (J.Mol.Biol., 147:195-197, 1981), Pearson and Lipman similarity searching method (PNAS, 85 (8): 2444-2448, 1988), algorithm (the Altschul etc. of Karlin and Altschul, J.Mol.Biol., 215 (3): 403-410, 1990, PNAS, 90:5873-5877,1993).This is familiar with to those skilled in the art.

Series of variation also comprises the fragment of the sequence shown in the SEQ ID NO:1 that can keep adverse circumstance evoked promoter characteristic, for example in SEQ ID NO:1 at least 150,200,300,500,800 until the DNA sequence dna of 999 continuous nucleotides.

Promotor nucleotide sequence in the present invention can be used for separating corresponding sequence from other biology, as other plant (unifacial leaf or dicotyledons etc.).According to the sequence homology between these corresponding sequence and the listed sequence of this paper, separate these corresponding sequence with differentiating as the technology such as PCR, hybridization.Therefore,, according to them and the respective segments that the sequence similarity between promoter sequence shown in the present (or its fragment) separates, be also included within embodiment.The promoter region of embodiment can separate from any plant, include, but is not limited to paddy rice, Btassica, corn, wheat, Chinese sorghum, two joint shepherd's purses belong to, sinapsis alba, Semen Ricini, sesame, cottonseed, Semen Lini, soybean, Arabidopsis, Phaseolus, peanut, clover, oat, Semen Brassicae campestris, barley, oat, rye (Rye), grain, chinese sorghum, triticale, einkorn, Si Peierte wheat (Spelt), emmer, flax, gramagrass (Gramma grass), friction standing grain, false chinese sorghum, fescue grass, perennial wheat straw, sugarcane, crowberry, papaya, banana, safflower, oil palm, muskmelon, apple, cucumber, the stem of noble dendrobium, gladiolus, chrysanthemum, Liliaceae, cotton, eucalyptus, Sunflower Receptacle, rape, beet, coffee, Chinese yam, ornamental plant and conifer etc.

In second aspect, the invention provides expression cassette, it comprises:

(a) DNA of first aspect present invention; With

(b) nucleic acid, it is operatively coupled on the downstream of the DNA of first aspect present invention.

" expression cassette " described in the present invention refers to by one or more genes and the element that regulates and controls its expression and formed, mainly contain three kinds of components: promoter sequence, open reading frame and terminator.Expression cassette is the integral part of DNA vector for cloning and transforming normally, and different expression cassettes, using under the prerequisite of correct regulating and controlling sequence, can be proceeded to different species, as bacterium, yeast, plant and mammalian cell etc.In the transformant of each achievement, expression cassette can produce corresponding object RNA and protein by the metabolism operating mechanism of modulate host cell, and cross expression or the expression inhibiting etc. that realize gene regulate and control result.

DNA that expression cassette of the present invention comprises first aspect present invention on 5 '-3 ' transcriptional orientation, be operatively coupled on the nucleic acid in the downstream of the DNA of first aspect present invention, the optional terminator of transcribing and translating (as, Transcription Termination element or polyadenylation signal).Expression cassette of the present invention can also comprise, copies required replication orgin (for example, from pBR322 or P15A ori ORI district) in bacterium, and edaphic bacillus T-DNA shifts needed element (for example, the left margin of T-DNA and/or right margin).Other compositions that expression cassette of the present invention can comprise comprise, enhanser, intron, multiple clone site, operator gene, repressor binding site, transcription factor binding site point etc.Exemplary enhanser comprises from the stunt enhancer element of promotor of I gene, TMV Ω element and yeast of CaMV 35S promoter, octopine synthase gene, rice Actin muscle I gene, corn alcohol dehydrogenase gene, corn.Also can adopt virus leader sequence to be used as having the foresight of enhanser effectiveness, as leader sequence from tobacco mosaic virus (TMV) (TMV), corn chlorisis mottle virus (MCMV) and alfalfa mosaic virus (AMV) etc.Exemplary plant introne comprises from the intron of Adh 1, bronze 1, Actin muscle 1, Actin muscle 2 and sucrose synthase intron.

In this article, be operatively coupled on polynucleotide, the antisense sequences of polynucleotide, the encoding fusion protein of the nucleic acid encoding heterologous protein in the downstream of the DNA of first aspect present invention, the polynucleotide of coding dsRNA sequence, etc.The nucleic acid that preferably can give the useful proterties of plant, described proterties comprises:

(a) raising of the coded protein output of described nucleic acid;

(b) raising of homologous gene expression product content in the antisense RNA inhibition conversion of plant that described nucleic acid is transcribed;

(c) raising of resistance (comprising drought resistance, winter hardiness, high thermal resistance and salt tolerance);

(d) raising of anti-plant pest ability;

(e) improvement of nutritional quality, comprises giving of the raising of the natural nutrient composition content having in plant and nutritive ingredient that plant non-natural has; With

(f) raising of plant biomass, the especially raising of plant economy position output.

Correspondingly, be operatively coupled on the gene that the nucleic acid in the downstream of the DNA of first aspect present invention can proteins encoded, as insect-resistant gene, bacterial disease resistant gene, fungal disease resistant gene, virus disease resistant gene, nematode disease resistance gene, herbicide resistance gene, affect the gene of grain ingredient or quality, nutrien utilization gene, mycotoxins reduces gene, male sterility gene, selectable marker gene, can selection markers thing gene, negative selectable marker gene, positive selectable marker gene, affect the gene of plant agronomy feature (as productive rate), tolerance to environmental stress gene (for example, give arid, heat, cold, freezing, cross wet, the resistance of salt stress or oxidative stress or the gene of patience), improve starch property or quantity, oil product quantity or quality, the gene of amino acid or protein composition, etc..In addition, the nucleic acid that is operatively coupled on the downstream of the DNA of first aspect present invention also can encode dsRNA, sense-rna, siRNA, miRNA, the gene polynucleotide sequence of itself and its homology (as, need to lower the plant promoter of expressing, the biological survival of phytoparasite body, grow or breed necessary plant gene) complementary and cause the downward of these polynucleotide gene expression products.

Expression cassette of the present invention can be inserted into plasmid, clay, yeast artificial chromosome, bacterial artificial chromosome or other are applicable to being transformed in any carrier in host cell.Preferred host cell is bacterial cell, for example, in particular for cloning or store polynucleotide or the bacterial cell for transformed plant cells, intestinal bacteria, Agrobacterium tumefaciems and Agrobacterium rhizogenes.In the time that host cell is vegetable cell, expression cassette or carrier can be inserted in the genome of the vegetable cell being converted.Insertion can be location or random insertion.Preferably, be inserted through such as homologous recombination and realize.In addition, expression cassette or carrier can remain on outside karyomit(e).Expression cassette of the present invention or carrier can be present in core, chloroplast(id), plastosome and/or the plastid of vegetable cell.Preferably, expression cassette of the present invention or carrier are inserted in the chromosomal DNA of plant nucleolus.

In the third aspect, the invention provides the expression vector of the described expression cassette that contains second aspect present invention.

In embodiments of the invention, DNA construct contains operability and is connected in the promotor on gene coded sequence or nucleotide fragments, this promotor contains full sequence disclosed by the invention or partial sequence, and can in vegetable cell, drive said gene encoding sequence or nucleotide fragments to express.Embodiment of the present invention also provide expression vector, and stablize the plant or the vegetable cell that comprise above-mentioned DNA construct in genome." operability connection " instigates the mode of connection of heterologous nucleotide sequence under promotor effect, thereby also refers to two nucleotide sequences to couple together the encoding sequence of each DNA fragmentation is remained in suitable reading frame." heterologous nucleotide sequence " refers to the sequence not being connected with promoter sequence operability described herein under native state, can be homology for plant host, or allos.

In fourth aspect, the invention provides the genetically modified plant, plant seed, plant tissue or the vegetable cell that transform with the expression cassette of second aspect present invention.

The specific embodiment of the present invention the effective application attestation by representational monocotyledons the plant use range of adverse circumstance evoked promoter of the present invention, therefore adverse circumstance evoked promoter of the present invention can be used for transforming any plant species, for example, from the plant with subordinate: Medicago, tomato belongs to, Btassica, Cucumis, Solanum, Juglans, Gossypium, Malus, Vitis, antirrhinum, Populus, Fragaria, Arabidopsis, Picea, Capsicum, Chenopodium, Chrysanthemum, ipomoea, Pinus, Pisum, Oryza, Zea, Triticum, triticale belongs to, Secale, lolium, Hordeum, Glycine, Pseudotsuga, Bryophyllum, Beta, Helianthus, Nicotiana, Cucurbita, rose, Fragaria, Lotus, donkey food grass belongs to, Clover, Trigonella, Vigna, tangerine belongs to, linum, Geranium, cassava, Trigonella, Rhaphanus, sinapsis alba belongs to, Atropa, Datura, poison tobacco, Nicotiana, green winter Solanum, Digitalis, Cichorium, Lactuca, Brome, Asparagus, antirrhinum, hemerocallis, Narcissus, Pelargonium, millet belongs to, Pennisetum, Ranunculus, Senecio, loudspeaker tongue belongs to, blue English Pittosporum, Phaseolus, Avena and allium, preferred plant comprises corn, paddy rice, wheat, barley, Chinese sorghum, soybean, rape, cotton, tomato, potato, sugarcane, beet, tobacco or Arabidopis thaliana, be more preferably paddy rice.

" plant " herein comprises whole strain plant, plant tissue organ (as leaf, root, stem etc.), seed, vegetable cell, and their offspring.In embodiment, the part plant of transgenic plant is understood to include transgenic plant or its offspring's vegetable cell, protoplastis, tissue, callus, embryo, and flower, stem, fruit, ovule, leaf or the root etc. that grow from transgenic plant or its offspring.

Here " vegetable cell " used includes but not limited to seed suspension culture, plumule, meristematic tissue region, callus, leaf, root, bud, gamete, pollen, sporophyte and sporule.The floristics that can be used for method disclosed herein comprises all higher plants that transform, and comprises monocotyledons and dicotyledons.

Aspect the 5th, the invention provides the production method of the plant of fourth aspect present invention, it comprises:

(1) expression cassette of structure second aspect present invention;

(2) expression cassette step (1) being obtained imports vegetable cell;

(3) transgenic plant that regenerate; With

(4) select transgenic plant, wherein the DNA of first aspect present invention can instruct the nucleic acid that is operatively coupled on its downstream under adverse environmental factor, to be induced to express; And

(5) plant that optionally, propagation step (4) obtains is to obtain offspring.

The transgenic plant of invention are used plant biotechnology field method for transformation preparation known to the skilled.Any method can be used to recombinant expression vector to be transformed in vegetable cell, to produce transgenic plant of the present invention.Method for transformation can comprise directly and method for transformation indirectly.Suitable direct method comprises the DNA absorption of polyoxyethylene glycol induction, liposome-mediated conversion, the importing of use particle gun, electroporation and microinjection, etc.In the specific embodiment of the present invention, the present invention has used the transformation technology based on edaphic bacillus (can be referring to (1985) Science 225:1229 such as Horsch RB; White FF, Vectors for Gene Transfer in Higher Plants, Transgenic Plants, the 1st volume, Engineering and Utilization, Academic Press, 1993, pp.15-38; The .Techniques for Gene Transfer such as Jenes B, Transgenic Plants, the 1st volume, Engineering and Utilization, Academic Press, 1993, pp.128-143, etc.).Edaphic bacillus bacterial strain (for example Agrobacterium tumefaciems or Agrobacterium rhizogenes) comprises plasmid (Ti or Ri plasmid) and T-DNA element, described plasmid and element are with being transferred to plant after edaphic bacillus transfection, and T-DNA is integrated in the genome of vegetable cell.T-DNA can be positioned on Ri-plasmid or Ti-plasmid, or is included in independently in so-called binary vector.During agrobacterium-mediated method for transformation is for example described in.The agrobacterium-mediated the most applicable dicotyledons of conversion, but be also applicable to monocotyledons.During edaphic bacillus is for example described in to the conversion of plant.Conversion can cause instantaneous or stable conversion and expression.Although nucleotide sequence of the present invention can be inserted into any plant and the vegetable cell that fall into these broad variety, it is particularly useful for crop plants cell.

Aspect the 6th, the present invention also provides the method for giving plant trait, and it comprises

(1) selection can be given the nucleic acid of plant trait:

(2) expression cassette of the nucleic acid construct second aspect present invention that use step (1) obtains;

(3) expression cassette step (2) being obtained imports vegetable cell;

(4) transgenic plant that regenerate; With

(5) select the transgenic plant of having given plant trait; And

(6) optionally, breed the plant of step (5) acquisition to obtain offspring,

Wherein, described proterties is selected from following group:

(a) raising of the coded protein output of described nucleic acid;

(b) raising of homologous gene expression product content in the antisense RNA inhibition conversion of plant that described nucleic acid is transcribed;

(c) raising of resistance (comprising drought resistance, winter hardiness, high thermal resistance and salt tolerance);

(d) raising of anti-plant pest ability;

(e) improvement of nutritional quality, comprises giving of the raising of the natural nutrient composition content having in plant and nutritive ingredient that plant non-natural has; With

(f) raising of plant biomass, the especially raising of plant economy position output.

Herein, " selection " can be that field or greenhouse are selected, and can be also to use the heredity of genetic marker to select.In this article, " propagation " can sexual propagation, can be also vegetative propagation.In sexual propagation, obviously can carry out extra hybridization step, and select the offspring who has inherited transgenosis proterties.

Therefore, any goal gene operability can be connected on the promoter sequence in embodiment, and express in plant materials, preferably in the plant of standing adverse circumstance induction processing, express.

According to RNA perturbation technique (RNA interference, RNAi), operability is connected in the heterologous nucleotide sequence in KT620P adverse circumstance abduction delivering promotor disclosed herein, can be the antisense sequences of some target gene." antisense base sequences " refer to one section with the double stranded rna molecule of target gene nucleotide sequence complementation.After importing in vegetable cell, antisense dna sequence transcribe the normal expression that can stop target gene DNA sequence dna.The rna transcription product of antisense base sequences coding can be transcribed with target gene the endogenous mRNA complementation of generation, and can be hybrid with it, and thus, the synthetic of the native protein of target gene coding is just restricted, thereby obtains corresponding phenotype.

For the ease of understanding, below will be described in detail the present invention by specific embodiment.It needs to be noted, these descriptions are only exemplary descriptions, do not form limitation of the scope of the invention.According to the discussion of this specification sheets, many variations of the present invention, change are all apparent concerning one of ordinary skill in the art.

Brief description of the drawings

Fig. 1 is the adverse circumstance abduction delivering spectrum of KT626::GUS gene.Wherein the sequence of gus gene is as shown in SEQ ID No:2, and length is 1812bp.KT626::GUS is gUSthe amplified production of gene; ACTIN is paddy rice reference gene aCTINamplified production; CK is normal growth contrast; D1 is that arid is while processing to the micro-volume of blade; D2 is that arid is processed while partly volume to blade; D3 is that arid is processed while full volume to blade; S1 is that salt is while processing to the micro-volume of blade; S2 is that salt is processed while partly volume to blade; S3 is that salt is processed while full volume to blade.

Fig. 2 is the T-DNA district collection of illustrative plates of expression vector pHPG.LB and RB are respectively left margin and the right margin of T-DNA; Hpt represents hygromycin gene; Pnos represents the promotor of no gene; Tnos represents the terminator of no gene; GUS represents gus protein gene; T35s represents the terminator of 35s gene; HindIII and BamHI represent respectively the restriction enzyme site of restriction enzyme HindIII and BamHI; Inducible promoter is the adverse circumstance abduction delivering promotor of institute of the present invention isolation identification.

Fig. 3 is the histoorgan GUS dyeing of KT626P transgenic paddy rice.A is Seedling Stage paddy rice GUS dyeing; B is the GUS dyeing after treatment of Seedling Stage rice drought; C is the GUS dyeing after treatment of flower Drought and salt; D is the GUS dyeing after treatment of Seedling Stage paddy rice salt.

Fig. 4 is the histoorgan GUS dyeing that KT626P transgenic paddy rice becomes seedling stage.A: the GUS dyeing of the histoorgan of normal paddy rice seedling; B: arid is processed the histoorgan GUS dyeing of rear paddy rice seedling.

Fig. 5 is that KT666 (KT626P::AtDREB) arid is processed.A: arid is processed the growth conditions of front seedling; B: arid is processed the growth conditions of rear seedling; C: the growth conditions of normal growth seedling after a week; D: arid survival rate statistics after treatment.

Fig. 6 is the processing of KT666 (KT626P::AtDREB) salt.A: salt is processed the growth conditions of front seedling; B: salt is processed the growth conditions of rear seedling; C: the growth conditions of normal growth seedling after a week; D: salt survival rate statistics after treatment.

Embodiment

In following embodiment, method therefor is ordinary method if no special instructions, the primer is synthetic by Shanghai Ying Jun biotech company, order-checking is completed by Beijing Hua Da gene, endonuclease in PCR test kit, vector construction process is purchased from precious biotechnology company limited, pEASY-T1 connects test kit purchased from Beijing Quan Shijin biotech company, T4 DNA ligase is purchased from Promega company, and the method that the equal reference reagent box of method provides is carried out.Carrier pHPG used in experiment is by this experimental reconstruction gained, and basic framework comes from the pCAMBIA1303 of CAMBIA company.

The adverse circumstance expression pattern analysis of the gus gene that 1.KT626P drives

Choosing in the paddy rice of two leaf phases spends 11 materials to carry out adverse circumstance processing.Material and sample that wherein arid is processed were collected with the next stage: phase 1(D1): leaf is slightly rolled up, relative water content (RWC) is at 90%-95%; Phase 2(D2): Ye Banjuan, relative water content (RWC) is at 80%-85%; Phase 3(D3): leaf is rolled up completely, and relative water content is at 70%-75%.D1, D2 and D3 represent the three phases that arid is processed.To each treatment stage, sample three parts.Sample complete, sample is stored in-80 DEG C with liquid nitrogen freezing immediately.The material of the high salt processing of 200mM and sample also divide and carry out Collection and preservation above three periods.

Extract respectively total RNA of above each Drought and salt processing in period material, obtain cDNA by reverse transcription, concrete reaction is: the total RNA that gets approximately 2 μ g, add 1 μ L10 × DNase buffer, the DNase of 1 μ L, mend DEPC treated water to 10 μ L system, mix, after 37 DEG C of incubation 30min, add the RQ DNase stop solution of 1 μ L, 65 DEG C of incubation 10min with termination reaction after, add 2 μ L Oligo (dT) 18 primer (0.1 μ g/ μ L), 4 μ L 5 × First-strand buffer, 1 μ L Ribonuclease inhibitor (40U/ μ L), 2 μ L 4 × dNTP (each 10mM), 1 μ L MMLV Reverse Transcriptase (200U/ μ L), carefully mix, 37 DEG C are incubated 1 hour.Then process 5 minutes for 70 DEG C, cooled on ice, centrifugal collection obtains corresponding reverse transcription product cDNA.The cDNA obtaining is all diluted to 10 times, as the amplification template of RT-PCR.

Wherein, the RT-PCR of gus gene detection primer is:

Primer 1:5'TAATGTTCTGCGACGCTCAC 3'

Primer 2: 5'CGGCGAAATTCCATACCTG 3'

The RT-PCR amplified fragments of gus gene is 317bp.The sequence of primer 1 is as shown in SEQ ID No:3, and the sequence of primer 2 is as shown in SEQ ID No:4.

The RT-PCR primer of Actin gene:

Primer 3:5 '-TGTTCCTGCCATGTATGT-3 '

Primer 4:5 '-ATGTCCCTCACAATTTCC-3 '

The RT-PCR amplified fragments of ACTIN gene is 252bp.The sequence of primer 3 is as shown in SEQ ID No:5, and the sequence of primer 4 is as shown in SEQ ID No:6.

Above primer is respectively to pass through above-mentioned arid and 200mM salt rice seedling cDNA after treatment as template, negative control template be normal growth in spend 11 seedling cDNA, detect these genes and process the expression variation in processing with arid at salt, PCR detection system and program are: 10 × buffer, 2 μ l; 10mM dNTP, 0.4 μ l; 10 μ M primers F, 0.4 μ l; 10 μ M primer R, 0.4 μ l; Taq polymerase, 0.4 μ l; CDNA, 1 μ l; ddH ₂o, 15.4 μ l.

PCR reaction conditions is: denaturation: 95 DEG C, and 5 minutes; Sex change: 94 DEG C, 30 seconds, annealing: 55 DEG C, 30 seconds, extend: 72 DEG C, 30 seconds, 28 circulations; 72 DEG C, 10 minutes.

After reaction finishes, PCR product is carried out to 1.5% agarose gel electrophoresis detection, PCR detected result is shown in Fig. 1, wherein: D represents arid processing; S represents salt processing; Numeral 1,2 and 3 after letter refers to that respectively arid is processed and three degree of salt processing. kT626::GUSrefer to the amplified production of gus gene; actinrefer to the amplified production of paddy rice actin gene.Visible, the gus gene of KT626P promoters driven is arid and high salt inducibility in rice seedling.

2.KT626P the separation of promotor and qualification

The required primer of design cloning promoter KT626P:

Primer 5:5'-CGaagcttGAGGGCACTTTAATTTTTCAT-3'

Primer 6:5'-CGggatccATTGCCAGCGAGTTCGCGCG-3'

Primer 5(sequence is as shown in SEQ ID No:7) in the sequence aagctt restriction enzyme site that is HindIII, primer 6(sequence is as shown in SEQ ID No:8) in the sequence ggatcc restriction enzyme site that is BamHI.

Utilize forward and reverse primer (wherein the sequence with underscore part is promoter sequence) of promotor, extract paddy rice (in spend 11) genomic dna that test kit (TIANGEN Biotech (Beijing) Co., Ltd.) extracts as template using plant genome DNA, increase, reaction conditions is: 95 DEG C of denaturations 5 minutes; 94 DEG C of sex change 30 seconds; Anneal 30 seconds for 55 DEG C; 72 DEG C are extended 1 minute; 30 circulations; 72 DEG C are extended 10 minutes.After reaction finishes, PCR product detects and reclaims through 1% agarose gel electrophoresis, and product is connected into pEASY-T1, and screening positive clone also carries out sequence verification, and result shows: institute's extension increasing sequence is the KT626P promoter sequence of expection.

3. construction of expression vector

Sequence verification is inserted to plasmid HindIII and the BamHI double digestion of KT626P promoter sequence, be connected into the same carrier pHPG with HindIII and BamHI double digestion, the positive bacterium colony of picking colony PCR result checks order, after sequence verification is correct, extract corresponding positive colony plasmid, called after pHPG-KT626P.

Bacterium colony PCR detects required primer:

Primer 7:5'-TCTCCGCTCATGACGATAAT-3'

Primer 8:5'-GACGTAACATGGTGAAGGGG-3'

Primer 7(sequence is as shown in SEQ ID No:9) and primer 8(sequence as shown in SEQ ID No:10) be primer on pHPG carrier, be positioned at cloned promoter fragment both sides, amplified fragments is about the length of promotor, taking bacterium liquid as template, augmentation detection, PCR reaction conditions is: 95 DEG C of denaturations 5 minutes; 94 DEG C of sex change 30 seconds; Anneal 30 seconds for 55 DEG C; 72 DEG C are extended 1 minute; 34 circulations; 72 DEG C are extended 10 minutes.

The collection of illustrative plates in the T-DNA district of constructed expression vector as shown in Figure 2, wherein: LB and RB are respectively left margin and the right margin of T-DNA; Hpt represents hygromycin gene; Pnos represents the promotor of no gene; Tnos represents the terminator of no gene; GUS represents gus protein gene; T35S represents the terminator of 35S gene; HindIII and BamHI represent respectively the restriction enzyme site of inscribe HindIII and BamHI; Adverse circumstance evoked promoter is promotor of the present invention.

4. Agrobacterium cotransformation

Utilize heat shock method that plasmid pHPG-KT626P is proceeded to Agrobacterium AGL0 bacterial strain, utilize agrobacterium-mediated transformation to carry out cotransformation to paddy rice, utilize Agrobacterium inflorescence infestation method arabidopsis thaliana transformation plant simultaneously.

5. promoter function qualification

Transfer-gen plant is carried out, after arid and the processing of 200mM salt, carrying out the active detection of GUS, the material of processing is placed in to the EP pipe that contains GUS dyeing damping fluid, be put in 37 DEG C of incubators and be incubated overnight, then decolouring preservation in dehydrated alcohol under room temperature condition.

Seedling is carried out after 200mM NaCl processing, and the histoorgans such as clip blade, stem and root dye, result as shown in Figure 3 and Figure 4, the seedling coloration result that wherein CK is normal processing, salt is salt coloration result after treatment.From figure, can know and find out, after supersalt is processed, the dye levels of blade and stem is obviously deepened.

Seedling is placed in to air and carries out after arid processing, the histoorgans such as clip blade, stem and root dye, and result as shown in Figure 3 C, after arid is processed, the dye levels of blade and stem is deepened, the seedling coloration result that wherein CK is normal processing, and drought is the seedling coloration result that arid is processed.

6. KT666 (KT626P::AtDREB1A) transgenosis T1 is for the Drought Stress Tolerance Analysis of A of plant

Results KT666 T1, for transgenic paddy rice seed, chooses 5 systems and carries out drought stress.Its sprouting of 3 angels is cultivated in water seed soaking, then carry out resistance screening with 50mg/L Totomycin, simultaneously spend 11 to compare to turn in the paddy rice of empty carrier, screen after 5 days, adjoining tree is all dead, statistics transfer-gen plant resistance seedling and dead seedling number, the resistance of analyzing transfer-gen plant separates ratio, select the strain that ratio is about 3: 1 that separates of resistance seedling and non-resistant seedling, result has shown to obtain the T1 transgenic line of the KT666 with unit point insertion, in the time that seedling grows to 8cm left and right, seedling is transferred in triangular flask from culture dish, every bottle of 10 strains, three repetitions.While being cultured to tri-leaf period (the 3rd leaf unfolded completely), carrying out acute arid and process.Before drought sieve, shoot root portion is cleaned, select the consistent seedling (Fig. 5 A) of growth conditions (thickness, plant height), root water is blotted with thieving paper, put into dry new triangular flask.Every bottle is recorded arid initial time in detail, screening to contrast stem stalk part ninety percent dry or more than.About about 9 hours (depending on the phenotype) of drought sieve process, then rehydration, the nutritive medium in triangular flask is changed once for 2 days, to keep the fresh state of nutritive medium.Arid seedling growth conditions after treatment as shown in Figure 5 B, normally cultivate a Zhou Houmiao and return to form as shown in Figure 5 C by rehydration.Finally add up the seedling survival rate of each strain, as shown in the column diagram of Fig. 5 D, the survival rate of CK is 16.7%, and turn KT626::AtDREB gene strain survival rate all 70% and more than, survival rate is far above contrast.

This description of test KT666 has the effect that strengthens rice drought tolerance, and KT626P has the effect of adverse circumstance induction.

7. KT666 (KT626P::AtDREB1A) transgenosis T1 is for the Salt Tolerance Analysis of plant

Results KT666 T1, for transgenic paddy rice seed, chooses 5 systems and carries out salt stress.Its sprouting of 3 angels is cultivated in water seed soaking, then carry out resistance screening with 50mg/L Totomycin, simultaneously spend 11 to compare to turn in the paddy rice of empty carrier, screen after 5 days, adjoining tree is all dead, statistics transfer-gen plant resistance seedling and dead seedling number, the resistance of analyzing transfer-gen plant separates ratio, select the strain that ratio is about 3: 1 that separates of resistance seedling and non-resistant seedling, result has shown to obtain the T1 transgenic line of the KT666 with unit point insertion, in the time that seedling grows to 8cm left and right, seedling is transferred in triangular flask from culture dish, every bottle of 15 strains, three repetitions.Be cultured to tri-leaf period (the 3rd leaf unfolded completely), its growth conditions is as Fig. 6 A.Use the Hoagland solution that contains 200mM NaCl instead and carry out salt sieve, about approximately 3 days, there is blade tip jaundice whiting in contrast, when blade is sagging or partly volume is rolled up even entirely (Fig. 6 B), washes away salts solution, normally cultivates.Within every 1.5 days during this time, change a salts solution.Rehydration is changed one time of nutrition liquid for second day again, to remove remaining salinity.Nutritive medium in triangular flask is changed once for 2 days, to keep the fresh state of nutritive medium.Take a picture (Fig. 6 C) after one week, statistics survives seedling number, calculates salt tolerant seedling ratio, result as Fig. 6 D(X-coordinate be different transgenic line numberings, ordinate zou is salt tolerant seedling per-cent).Experimental result shows, T1 for transgenic rice plant to the tolerance of salt apparently higher than transgenic rice plant not, after salt is processed, KT668 transgenic paddy rice T1 can continued growth after for the plant renewal cultivation of positive strain, turn empty carrier in spend the yellow leaf, curling, withered of 11 contrasts (CK) plant, cane can not be upright, after renewal cultivation very fast dead (Fig. 6 C).

This description of test KT666P has the effect that strengthens Salt Resistance of Rice, and KT626P has the effect of adverse circumstance induction.

SEQUENCE LISTING

<110> Beijing Weiming Kaituo Crops Design Center Ltd

Gene promoter and the application thereof of an adverse circumstance abduction delivering of <120>

<130>

<150> 201210219368.8

<151> 2012-06-28

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 1000

<212> DNA

<213> paddy rice (Oryza sativa L.ssp.japonica)

<400> 1

gagggcactt taatttttca tcctcaccac taatatttct cgtgatacgg tttggcttat 60

tttagaaaaa aaaaattatc tccatttcaa aataagttaa tcaagaatat atcaaattcc 120

gtattagatt aatttattct gaaacggata ggacgaatgg agtagtaagt ctaaaatttt 180

aatctgacca tggcttatag aagaaagagg tgccaagtag gcccgtacgt ggaattgtac 240

atagccttaa ctgcaagacg taaaggaaaa acatataaaa aaacagaaaa tatcaagcac 300

gcgtcatcac cagcaagtga cggtagcagt gttcttcaaa caaaccgagt taaactcctc 360

tgctagttaa aggcgagaca gctacttagg aaaaggagga taaaaacata aaatggaatt 420

tcaaaaggga aagggaaaag gaaatgaaac tagacccagt cctccgcacg agtccactgg 480

attaagcgcc tccctcccac gccacggcta caccaaaatt tgcccccact ctaactctcg 540

tgttgattgc agcgaattta gatttgagaa gagccagtca ggcagtccca ccacgccacg 600

agaaatttct acgcccatgt cagcggtgac gacgcgcgcg cgtgcttctc catatataca 660

ccgcgcgcgt gcactcacac ctctcctcac cactttcacc accaaaaaaa tcgaccaaac 720

cacgtagtat tacgcagttc gcacactata ctccgatccg gcctctccaa cccagcttag 780

cttttctgct cccagctgcc agctacgttg caaccccacc accggaaagc tacaccgtgc 840

gtttcatata agcagcgccc agtcgagcga gctcgaccgg caatagcaat agcgccaaga 900

catacagaga agccacagac gtcgaggcag ctagcgcgcg ggggaggaca ggacactgca 960

gcaagttggc cggtgataag cgcgcgaact cgctggcaat 1000

<210> 2

<211> 1812

<212> DNA

<213> intestinal bacteria (Escherchia coli)

<400> 2

atgttacgtc ctgtagaaac cccaacccgt gaaatcaaaa aactcgacgg cctgtgggca 60

ttcagtctgg atcgcgaaaa ctgtggaatt gatcagcgtt ggtgggaaag cgcgttacaa 120

gaaagccggg caattgctgt gccaggcagt tttaacgatc agttcgccga tgcagatttt 180

cgtaattatg cgggcaacgt ctggtatcag cgcgaagtct ttataccgaa aggttgggca 240

ggccagcgta tcgtgctgcg tttcgatgcg gtcactcatt acggcaaagt gtgggtcaat 300

aatcaggaag tgatggagca tcagggcggc tatacgccat ttgaagccga tgtcacgccg 360

tatgttattg ccgggaaaag tgtacgtatc accgtttgcg tgaacaacga actgaactgg 420

cagactatcc cgccgggaat ggtgattacc gacgaaaacg gcaagaaaaa gcagtcttac 480

ttccatgatt tctttaacta tgccggaatc catcgcagcg taatgctcta caccacgccg 540

aacacctggg tggacgatat caccgtggtg acgcatgtcg cgcaagactg taaccacgcg 600

tctgttgact ggcaggtggt ggccaatggt gatgtcagcg ttgaactgcg tgatgcggat 660

caacaggtgg ttgcaactgg acaaggcact agcgggactt tgcaagtggt gaatccgcac 720

ctctggcaac cgggtgaagg ttatctctat gaactgtgcg tcacagccaa aagccagaca 780

gagtgtgata tctacccgct tcgcgtcggc atccggtcag tggcagtgaa gggcgaacag 840

ttcctgatta accacaaacc gttctacttt actggctttg gtcgtcatga agatgcggac 900

ttgcgtggca aaggattcga taacgtgctg atggtgcacg accacgcatt aatggactgg 960

attggggcca actcctaccg tacctcgcat tacccttacg ctgaagagat gctcgactgg 1020

gcagatgaac atggcatcgt ggtgattgat gaaactgctg ctgtcggctt taacctctct 1080

ttaggcattg gtttcgaagc gggcaacaag ccgaaagaac tgtacagcga agaggcagtc 1140

aacggggaaa ctcagcaagc gcacttacag gcgattaaag agctgatagc gcgtgacaaa 1200

aaccacccaa gcgtggtgat gtggagtatt gccaacgaac cggatacccg tccgcaaggt 1260

gcacgggaat atttcgcgcc actggcggaa gcaacgcgta aactcgaccc gacgcgtccg 1320

atcacctgcg tcaatgtaat gttctgcgac gctcacaccg ataccatcag cgatctcttt 1380

gatgtgctgt gcctgaaccg ttattacgga tggtatgtcc aaagcggcga tttggaaacg 1440

gcagagaagg tactggaaaa agaacttctg gcctggcagg agaaactgca tcagccgatt 1500

atcatcaccg aatacggcgt ggatacgtta gccgggctgc actcaatgta caccgacatg 1560

tggagtgaag agtatcagtg tgcatggctg gatatgtatc accgcgtctt tgatcgcgtc 1620

agcgccgtcg tcggtgaaca ggtatggaat ttcgccgatt ttgcgacctc gcaaggcata 1680

ttgcgcgttg gcggtaacaa gaaagggatc ttcactcgcg accgcaaacc gaagtcggcg 1740

gcttttctgc tgcaaaaacg ctggactggc atgaacttcg gtgaaaaacc gcagcaggga 1800

ggcaaacaat ga 1812

<210> 3

<211> 20

<212> DNA

<213> artificial sequence

<400> 3

taatgttctg cgacgctcac 20

<210> 4

<211> 19

<212> DNA

<213> artificial sequence

<400> 4

cggcgaaatt ccatacctg 19

<210> 5

<211> 18

<212> DNA

<213> artificial sequence

<400> 5

tgttcctgcc atgtatgt 18

<210> 6

<211> 18

<212> DNA

<213> artificial sequence

<400> 6

atgtccctca caatttcc 18

<210> 7

<211> 29

<212> DNA

<213> artificial sequence

<400> 7

cgaagcttga gggcacttta atttttcat 29

<210> 8

<211> 28

<212> DNA

<213> artificial sequence

<400> 8

cgggatccat tgccagcgag ttcgcgcg 28

<210> 9

<211> 20

<212> DNA

<213> artificial sequence

<400> 9

tctccgctca tgacgataat 20

<210> 10

<211> 20

<212> DNA

<213> artificial sequence

<400> 10

gacgtaacat ggtgaagggg 20

Claims (6)

1. a DNA for separation, it can instruct the nucleic acid that is operatively coupled on its downstream in paddy rice, to be subject to salt stress or drought stress abduction delivering, and the sequence of the DNA of described separation is as shown in SEQ ID NO:1.

2. an expression cassette, it comprises:

(a) DNA claimed in claim 1; With

(b) nucleic acid, it is operatively coupled on the downstream of DNA claimed in claim 1.

3. expression cassette claimed in claim 2, wherein said nucleic acid can be given the proterties of paddy rice anti contravariance, and described degeneration-resistant proterties refers to salt tolerance or drought resistance.

4. the production method of the transgenic paddy rice transforming with the expression cassette described in claim 2 or 3, it comprises:

(1) expression cassette described in structure claim 2 or 3;

(2) expression cassette Introduced into Rice cell step (1) being obtained;

(3) transgenic paddy rice of regenerating; With

(4) select transgenic paddy rice; Or

(5) paddy rice that propagation step (4) obtains is to obtain offspring.

5. the method for giving rice stress-tolerance shape, it comprises:

(1) selection can be given the nucleic acid of rice stress-tolerance shape;

(2) expression cassette described in the nucleic acid construct claim 2 or 3 that use step (1) obtains;

(3) expression cassette Introduced into Rice cell step (2) being obtained;

(4) transgenic paddy rice of regenerating; With

(5) select the transgenic paddy rice of having given rice stress-tolerance shape; Or

(6) paddy rice that propagation step (5) obtains is to obtain offspring, and described stress tolerance refers to salt tolerance or drought resistance.

6. one kind is subject to the method for salt stress or drought stress abduction delivering heterologous nucleotide sequence in paddy rice, described method comprises in paddy rice and imports particular expression box, described particular expression box contains promotor and operability and is connected in the object heterologous nucleotide sequence of described promotor, and the nucleotide sequence of wherein said promotor is as shown in SEQ ID NO:1.