CN112175952B - Biological stress inducible promoter PBBI7 and application thereof - Google Patents

Abstract

The invention relates to the technical field of plant genetic engineering, and discloses a biological stress inducible promoter and application thereof. The biological stress inducible promoter PBBI7 can significantly improve the expression level of downstream genes under different biological stress hazard conditions, and has good application value in rice stress-resistant genetic engineering breeding.

Description

Biological stress inducible promoter PBBI7 and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a biological stress inducible promoter PBBI7 and application thereof.

Background

During the growth process of plants, the plants are damaged by various plant diseases and insect pests such as white leaf blight bacteria, brown planthopper, chilo suppressalis and other biological adversities. The resistance of plants is improved by using resistance gene resources, and the method is a fundamental way for preventing plant diseases and insect pests and protecting the environment. The introduction of resistance genes into plants by transgenic technology is one of the main approaches to improve the disease and insect resistance of crops. However, the current genetic engineering systems have some defects, and it is important that the promoters used in the transformation vectors are mostly constitutive overexpression promoters, such as a maize Ubiquitin promoter and a CaMV35S promoter. The method not only brings metabolic burden to the plant body, but also causes the plant to express a large amount of foreign protein or mRNA when the disease and insect resistant reaction is not needed to occur, thereby causing waste; serious disturbance of physiology and metabolism of the plant body can be caused, so that the plant body can generate variation or die.

It is necessary to control the expression of a target gene using a specifically inducible promoter. A promoter is a DNA fragment which functions to regulate gene expression. The promoter exists in both prokaryotes and eukaryotes, and is a DNA sequence which plays a role in regulating and controlling the time, space and expression quantity of gene transcription. Promoters differ in structure between prokaryotes and eukaryotes. Eukaryotes have three RNA polymerases, each with a different promoter for its recognition. RNA polymerase II is responsible for transcription of protein genes and partial snRNA genes, with the most complex structure. Sequences of hundreds of eukaryotic promoters recognized by polymerase II have been compared and some common structures have been found. For example, 1) a cap site, i.e., a transcription initiation site, is mostly A flanked by a number of pyrimidine nucleotides, wherein A is the transcription initiation site. 2) The TATA box, also called Hogness box or Goldberg-Hogness box, has the following consistent sequence: TATAAAA or TATATAT, and on both sides thereof consists of a sequence rich in G and C base pairs. The TATA box determines the choice of the transcription initiation site, which is the site where RNA polymerase binds to the DNA strand. 3) CAAT box, the consistent sequence of which is GGC (T) CAATCT. The CAAT box may control the frequency of transcription initiation, and deletion or mutation of the base of the box may cause a drastic decrease in transcription efficiency. 4) Enhancers (enhancers), also known as far upstream sequences, are generally located at positions above-100 bp and act to enhance transcription both dependent and independent of the TATA box. In addition, different promoters have different cis (cis) regulatory elements, which are binding sites for trans (trans) regulatory factors or transcription regulatory proteins. Different trans-regulatory factors/transcription regulatory proteins are specifically combined with cis-regulatory elements to specifically regulate and control the expression time, space or expression quantity of genes.

Specific promoters are generally classified into two types, one is a specific promoter subjected to inducible expression and called an inducible promoter, and the other is a promoter subjected to tissue-specific expression and called a tissue-specific promoter. The inducible promoter responds to external substances, such as insect pests, pathogens, chemical substances or stress, and starts corresponding gene expression in plants. Tissue-specific promoters drive the expression of genes in specific tissues. The specific promoter can avoid the damage of the plant caused by the over-expression of the gene. Therefore, the promoter for inducing expression by using the biological stress of the rice source is used for driving the expression of the resistance gene, and is one of the best choices for improving the disease and insect resistance of the rice.

Disclosure of Invention

The invention clones a DNA fragment of a rice gene Os01g03390 promoter PBBI7, performs functional verification on a biological stress-induced expression promoter PBBI7 segment which is separated and cloned in rice, and regulates and controls the expression of a rice anti-disease gene by using the promoter, thereby improving the disease and insect resistance of the rice.

The biological stress inducible promoter provided by the invention comprises a nucleotide sequence shown as SEQ ID NO. 1.

The present invention also provides a genetic construct comprising:

(a) the above-described promoter of the present invention; and

(b) a heterologous nucleic acid sequence operably linked to the promoter of (a); and optionally

(c) A 3' transcription terminator.

The term "genetic construct" as used herein refers to a nucleic acid made by genetic engineering.

The term "operably linked" to a promoter as used herein means that transcription is driven and/or regulated by the promoter. It will be understood by those skilled in the art that operably linked to a promoter preferably means that the promoter is located upstream (i.e., at the 5' -end) of the operably linked nucleic acid. The distance from the operably linked nucleic acid is variable, so long as the promoter of the invention is capable of driving and/or regulating transcription of the operably linked nucleic acid. For example, there may be a cloning site, a linker, a transcriptional or translational enhancer between the promoter and the operably linked nucleic acid.

The term "heterologous" as used herein refers to "heterologous to a promoter of the invention". Nucleic acids heterologous to the promoter of the invention are not naturally present in the nucleic acid sequences flanking the promoter of the invention when in its biological genomic environment. Although the nucleic acid may be heterologous to the promoter of the invention, it may be homologous or native or heterologous or foreign to the plant host cell. The heterologous nucleic acid sequence of the invention may alternatively be any of SEQ ID NO 3-5.

(c) The term "transcription terminator" as used herein refers to a DNA sequence at the end of a transcription unit which gives a transcription termination signal. A terminator is a 3 '-untranslated DNA sequence that typically contains a polyadenylation signal, which facilitates the addition of polyadenylic acid sequences to the 3' -end of the primary transcript. Terminators active in and/or isolated from viruses, yeasts, molds, bacteria, insects, birds, mammals and plants are known and have been described in the literature. Examples of suitable terminators for use in the genetic constructs of the present invention include Agrobacterium tumefaciens (Agrobacterium tumefaciens) nopaline synthase (NOS) gene terminator (shown in SEQ ID NO: 2), Agrobacterium tumefaciens octopine synthase (OCS) gene terminator sequence, cauliflower mosaic virus (CaMV)35s gene terminator sequence, rice ADP-glucose pyrophosphorylase terminator sequence (t 3' Bt2), maize protein gene terminator sequence, rbcs-1A gene terminator and rbcs-3A gene terminator sequence, and the like.

The invention also provides an expression cassette, a transformation vector and an expression vector containing the genetic construct.

An "expression cassette" herein refers to the smallest genetic construct required for expression of a nucleic acid. Typical expression cassettes include promoter-gene-terminator combinations. The expression cassette may additionally include a cloning site, such as a Gateway (TM) recombination site or a restriction enzyme recognition site to facilitate cloning of the operably linked nucleic acid or to facilitate transfer of the expression cassette into a vector. The expression cassette may further comprise a 5 'untranslated region, a 3' untranslated region, a selection marker, a transcriptional enhancer, or a translational enhancer.

"transformation vector" refers to a genetic construct that can be introduced into an organism by transformation and can be stably maintained in the organism. Some vectors can be maintained in, for example, E.coli, A.tumefaciens, s.cerevisiae or Schizosaccharomyces pombe, while others, such as phagemid and cosmid vectors, can be maintained in bacteria and/or viruses. The transformation vector may be propagated in its host cell and may be isolated therefrom again for transformation into another host cell. The vector sequence typically includes a set of unique sites recognized by restriction enzymes, a Multiple Cloning Site (MCS), into which one or more non-vector sequences may be inserted. The vector sequence may further include an origin of replication necessary for maintenance and/or replication in the particular host cell. Examples of origins of replication include, but are not limited to, the f1-ori and colE 1.

An "expression vector" constitutes a subgroup of transformation vectors which, by virtue of comprising appropriate regulatory sequences, are capable of promoting expression of the inserted non-vector sequences. Expression vectors suitable for expression in bacteria (e.g., E.coli), fungi (e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris), insect cells (e.g., baculovirus expression vectors), animal cells (e.g., COS or CHO cells), and plant cells have been described. One suitable expression vector of the present invention is a plant expression vector for transformation of plant cells, stable integration in the plant genome, maintenance within plant cells, and expression of non-vector sequences in plant cells.

The genetic constructs of the invention may further comprise a "selection marker". As used herein, the term "selectable marker" includes any gene that confers a phenotype on a cell in which expression is obtained to facilitate the identification and/or selection of transfected or transformed cells. Suitable markers may be selected from markers that confer antibiotic or herbicide resistance. Cells comprising the genetic construct will therefore survive at concentrations of antibiotic or herbicide that kill untransformed cells. Examples of selection marker genes include genes conferring antibiotic resistance (such as nptII encoding neomycin phosphotransferase capable of phosphorylating neomycin and kanamycin, or hpt encoding hygromycin phosphotransferase capable of phosphorylating hygromycin), genes conferring herbicide resistance (e.g., bar, which provides resistance to Basta; aroA or gox, which provides resistance to glyphosate), or genes that provide metabolic properties (such as manA, which allows plants to utilize mannose as a sole carbon source). Visible marker genes cause color formation (e.g., β -glucuronidase, GUS), luminescence (e.g., luciferase), or fluorescence (green fluorescent protein, GFP and derivatives thereof). Further examples of suitable selection marker genes include ampicillin resistance (Ampr), tetracycline resistance gene (Tcr), bacterial kanamycin resistance gene (Kanr), phosphinothricin resistance gene and Chloramphenicol Acetyltransferase (CAT) gene, and the like.

Furthermore, the invention includes a host cell comprising a promoter, or a genetic construct, or an expression cassette, or a transformation vector or expression vector of the invention as described above. In a particular embodiment of the invention, the host cell is selected from rice cells.

The invention also provides a method for improving stress resistance of rice, which comprises the following steps:

(a) operably linking a rice-resistant foreign gene to the promoter of claim 1, and

(b) the resulting genetic construct is introduced into rice or rice cells.

Preferably, the operably linked nucleic acid of (a) is heterologous to the nucleic acid of the invention. Furthermore, expression of the operably linked nucleic acid may be driven and/or regulated in a particular cell, tissue or organ of rice. The rice resistance exogenous gene comprises a bacterial leaf blight resistance gene, a brown planthopper resistance gene and a chilo suppressalis resistance gene.

The method may further comprise culturing the transformed rice or rice cells under conditions that promote growth, promote regeneration, and/or promote maturation.

The invention also provides a method for producing transgenic rice, which comprises the following steps:

(a) introducing the above-mentioned promoter, or genetic construct, or expression cassette, or transformation vector, or expression vector into rice or rice cells, and

(b) culturing the rice or rice cells under conditions that promote the growth of rice.

Preferably, the "introduction" of the isolated promoter, or genetic construct, or expression cassette, or transformation vector or expression vector described above into a host cell (e.g., a rice cell) is accomplished by transformation. The term "transformation" as used herein encompasses the transfer of an exogenous polynucleotide into a host cell, regardless of the method used for the transfer. Transformation of plant species is currently a fairly routine technique. Conveniently, any of a number of transformation methods may be used to introduce the nucleic acids of the invention into a suitable progenitor cell. Transformation methods include the use of liposomes, electroporation, chemical agents that enhance free DNA uptake, direct injection of DNA into plants, particle gun bombardment, transformation with viruses or pollen, and microprojectiles. The transgenic rice plants of the present invention are preferably produced by Agrobacterium-mediated transformation using any of the well-known methods for rice transformation.

Typically, following transformation, rice cells or cell clusters are selected having one or more markers encoded by a plant-expressible gene co-transfected with a gene of interest (which may be under the control of any of the promoters of the invention), followed by culturing the transformed material under conditions promoting rice growth.

The resulting transformed rice cells can then be used to regenerate transformed plants in a manner known to those skilled in the art. The present invention further provides rice comprising the rice cell described above. The rice plant may be grown, or even mature, including, for example, fruit production, seed formation, seed maturation, and seed set.

In addition, progeny may be produced from these seeds, which progeny is fertile. Alternatively or additionally, transformed and regenerated rice can also be used to produce progeny by asexual propagation, such as cloning, grafting. The resulting transformed rice can be propagated in a variety of ways, such as by asexual propagation or traditional breeding techniques. For example, first generation (or T1) transformed plants can be selfed to give homozygous second generation (or T2) transformants, and T2 plants further propagated by conventional breeding techniques. The transformed organisms produced may take a variety of forms. For example, it may be a chimera of transformed and non-transformed cells; clonal transformants (e.g., all cells transformed to contain an expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rhizome is grafted to an untransformed scion).

The invention further comprises the application of the promoter in improving the expression of the exogenous gene in the transgenic rice.

The invention has the beneficial effects that:

the invention obtains a gene which is constitutively low-expressed in each tissue of the whole growth period of rice and the expression level of which is up-regulated by the induction of various biological stresses by screening, separates the promoter region of the gene from the rice genome by a PCR method, and names the promoter as PBBI7, and the nucleotide sequence of the promoter is shown as SEQ ID NO:1 is shown. The fusion expression gene is constructed by using PBBI7 and artificial small RNA (amiB) for resisting bacterial leaf blight, a gene OsLecRK1 for resisting brown planthopper and a gene Cry1C for resisting borer, and the rice middle flower 11 is transformed by an agrobacterium-mediated method. The obtained transgenic rice seedlings are subjected to RT-PCR detection before and after inoculation of the bacterial blight, brown planthopper and chilo suppressalis, and the PBBI7 promoter is determined to be capable of remarkably improving the expression level of downstream genes under different biological stress hazard conditions, so that the characteristic has good application value in rice stress-resistant gene engineering breeding.

Drawings

FIG. 1: is the expression mode of the endogenous gene of the promoter in MH63 chip in the whole growth period.

FIG. 2: the expression pattern of the promoter endogenous gene is under the conditions of acupuncture, bacterial leaf blight inoculation, brown planthopper inoculation and chilo suppressalis inoculation.

FIG. 3: is a structural schematic diagram of a transformation vector of a promoter PBBI7 driving 3 resistance genes.

FIG. 4: the result of the transcription level detection and the resistance phenotype of the PBBI7-amiB transgenic plant 72h after the bacterial blight inoculation are carried out.

FIG. 5: the result of the transcription level detection and the resistance phenotype of the PBBI7-OSLecRK1 transgenic plant 24h after brown planthopper inoculation are shown.

FIG. 6: the result of the transcription level detection and the resistance phenotype of the PBBI7-Cry1C transgenic plant after chilo suppressalis inoculation for 48 h.

Detailed Description

According to the whole genome expression chip data of the rice eaten by brown planthopper in the crop genetic improvement national key laboratory of the applicant and the whole genome whole-growth-period expression profile chip data of rice varieties Minghui 63 and Zhenshan 97, a gene (figure 2) Os01g03390 which is constitutively low-expressed in each tissue of the rice whole-growth period and is up-regulated by induction of different biological adversities is selected. Determining the first initiation codon ATG of the gene, designing a primer aiming at the interval of about 2Kb of the upstream of the gene, taking the genome of the Zhonghua 11 rice variety as a template, cloning a promoter fragment of the gene and naming the fragment as PBBI 7. After different biological stresses are harmful, the expression levels of different target genes in the transgenic plant are obviously up-regulated, and the promoter fragment is proved to be a biological stress inducible promoter.

The invention constructs promoters PBBI7 and NOS terminator with amiB, OslecRK1 and Cry1c on 1300 respectively by a one-step method to form terminal vectors 1300-PBBI7-amiB, 1300-PBBI7-OslecRK1 and 1300-PBBI7-Cry1c (figure 3). 1300-PBBI7-amiB, 1300-PBBI7-OslecRK1 and 1300-PBBI7-Cry1c are introduced into the japonica rice variety flower 11 by an agrobacterium-mediated method. Inoculating the obtained transgenic seedlings with the bacterial blight, brown planthopper and chilo suppressalis respectively, detecting the expression quantity of the target genes of the rice samples before and after inoculation, and determining the expression mode of the target genes driven by the PBBI7 promoter (fig. 4, 5 and 6). After different biological stresses are harmful, the expression levels of different target genes in the transgenic plant are obviously up-regulated, and the promoter fragment is proved to be a biological stress inducible promoter.

The present invention will be described in detail with reference to examples for better understanding the objects, technical solutions and advantages of the present invention, but they should not be construed as limiting the scope of the present invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

Example 1

Isolation of promoters

Obtaining 2015bp BB1-7 gene promoter sequence according to http:// rice. plant biology. msu. edu/website, designing primer P-F/P-R, and performing PCR amplification by using leaf genome DNA of rice variety TN1 as a template.

P-F：agtggtaccaggaatccaaaac；

P-R：cctaactgactttaattgtgtggat。

The PCR reaction system is as follows: DNA template (50 ng/. mu.L) 2. mu.L, 2 XKOD Buffer 10. mu.L, 10. mu. M P-F0.2. mu.L, 10. mu. M P-R0.2. mu. L, KOD (Toyobo) 0.2. mu.L, 10. mu.LmM dNTPs0.4μL、ddH ₂0 7μL；

The procedure for obtaining PCR amplification of the full-length ORF sequence of the promoter of the BB1-7 gene was: 3min at 98 ℃; 20s at 98 ℃, 30s at 54 ℃, 1min at 68 ℃ for 30s, and 32 cycles; 7min at 68 ℃; the BB1-7 gene promoter is obtained after the PCR product is sequenced correctly at 25 ℃ for 1s and is named as PBBI 7.

Example 2

Construction of vectors

The PCR product obtained in example 1 was subjected to 1% agarose gel electrophoresis, and the band of interest was recovered by cutting the gel. And (3) performing PCR amplification by taking the recovered product as a template and taking P-HF/PamiB-R, P-HF/PLECRK1-R and P-HF/P1C-R as primers respectively, and adding different joints to gene promoters.

P-HF：cgacggccagtgccaagcttagtggtaccaggaatccaaa；

PamiB-R：ctgtggctgctgctgggatcccctaactgactttaattgtg；

PLECRK1-R：aagagcaggagggccaccatcctaactgactttaattgtg；

P1C-R：cactggttctgattgttctcctccatcctaactgactttaattgtgtgg。

The PCR reaction system is as follows: DNA template (50 ng/. mu.L) 2. mu.L, 2 XKOD Buffer 25. mu.L, 10. mu. M F0.5.5. mu.L, 10. mu. M R0.5.5. mu. L, KOD (Toyobo) 0.5. mu.L, 10mM dNTPs 1. mu. L, ddH ₂0 20.5μL；

The procedure for PCR amplification was: 3min at 98 ℃; 20s at 98 ℃, 2min at 68 ℃ and 35 cycles; 7min at 68 ℃; 25 ℃ for 1 s.

The PCR product was subjected to 1% agarose gel electrophoresis, and the target band was recovered by cutting gel to obtain PamiB (SEQ ID NO: 1+3), PLECRK1 (SEQ ID NO: 1+4), and P1C (SEQ ID NO: 1+5), respectively.

Respectively taking plasmids containing amiB, OsLecRK1 and Cry1C genes as templates, and taking amiB-F/R, LECRK1-F/LECRK1-R and 1C-F/1C-R as primers to carry out PCR amplification, and adding corresponding linkers to the amiB, Lecrk1 and Cry1C genes.

amiB-F：cacaattaaagtcagttaggggatcccagcagcagccacag；

amiB-R：gatcggggaaattcgagctcggtaccgctgctgatgctgat；

LECRK1-F：cacaattaaagtcagttaggatggtggccctcctgctctt；

LECRK1-R：gatcggggaaattcgagctcctacgggagagagctgatga；

1C-F：ccacacaattaaagtcagttaggatggaggagaacaatcagaaccagtg；

1C-R：cgatcggggaaattcgagctcctacttttgtgctctttcaagg。

The PCR reaction system is as follows: DNA template (50 ng/. mu.L) 2. mu.L, 2 XKOD Buffer 25. mu.L, 10. mu. M F0.5.5. mu.L, 10. mu. M R0.5.5. mu. L, KOD (Toyobo) 0.5. mu.L, 10mM dNTPs 1. mu. L, ddH ₂0 20.5μL；

The procedure for PCR amplification was: 3min at 98 ℃; 20s at 98 ℃, 2min at 68 ℃ and 35 cycles; 7min at 68 ℃; 25 ℃ for 1 s.

And (3) carrying out 1% agarose gel electrophoresis on the PCR product, and cutting and recovering the target band to obtain amiB, OsLECRK1 and Cry1 c.

The pCAMBIA1300-NOS vector is subjected to double digestion by HindIII and SacI, and the reaction is carried out at 37 ℃ for 1h, wherein the reaction system of the double digestion is as follows: 10 XBuffer 10 u l, pCAMBIA1300-NOS vector 5 u g, HindIII1 u l, SacI 1 u l, water to 100 u l, recovery product for 1% agarose gel electrophoresis, the target band for cutting gel recovery, get the linear vector 1300-NOS. The recombination reaction was carried out using the One Step Cloning Kit of Novowed corporation as follows: 4. mu.l of 5 XCE II Buffer, 1300-NOS 250ng of linearized cloning vector, 100ng of each of insert PamiB and amiB,

II 2. mu.l, water to 20. mu.l. After the system is prepared, lightly blowing and beating the components up and down by a pipettor for several times to uniformly mix the components, so as to avoid generating bubbles (do not need to shake violently or swirl for uniform mixing); the reaction mixture was left at 37 ℃ for 30 min. After the reaction is finished, immediately placing the reaction tube in an ice water bath for cooling for 5 min; add 20. mu.l of the cooled reaction solution to 200. mu.l of competent cells, flick the tube wall and mix well, and leave on ice for 30 min. Carrying out heat shock at 42 ℃ for 45-90 seconds, and incubating for 2min in an ice water bath; adding 600 μ l LB culture medium, incubating at 37 deg.C for 10min for sufficient resuscitation; shaking bacteria at 37 deg.C for 45 min; uniformly coating 100 mu l of bacterial liquid on an LB plate containing Kan + (50 mg/ml); the plate was inverted and incubated at 37 ℃ overnight.

Selecting a single clone to carry out plasmid extraction (the conventional plasmid extraction method can be used), carrying out enzyme digestion by HindIII + SacI, reacting for 20min at 37 ℃, carrying out 1% agarose gel electrophoresis on the enzyme digestion product, sending positive clones to sequencing, and obtaining the plasmid with correct sequencing, namely 1300-PBBI 7-amiB. The same construction was carried out 1300-PBBI7-LECRK1 and 1300-PBBI7-Cry 1C. The HindIII + SacI double digestion reaction system is as follows: 10 XBuffer 2. mu.l, recombinant plasmid 2. mu.l, HindIII 0.2. mu.l, SacI 0.2. mu.l, water to 20. mu.l.

Example 4

Genetic transformation of expression vectors

With reference to the Agrobacterium-mediated transformation method published in Lin et al (2005), 3 constructed expression vectors 1300-PBBI7-amiB, 1300-PBBI7-OslecRk3 and 1300-PBBI7-Cry1c were transformed into japonica rice variety flower 11. PCR positive screening of transgenic plants was performed using PCR primers Hpt-F and Hpt-R of hygromycin resistance genes.

Hpt-F：agaatctcgtgctttcagcttcga；

Hpt-R：tcaagaccaatgcggagcatatac。

The PCR reaction system is as follows: DNA template (50 ng/. mu.L) 2. mu.L, 2 XKOD Buffer 25. mu.L, 10. mu.M Hpt-F0.5. mu.L, 10. mu.M Hpt-R0.5. mu. L, KOD (Toyobo) 0.5. mu.L, 10mM dNTPs 1. mu. L, ddH ₂0 20.5μL；

The procedure for PCR amplification was: 3min at 98 ℃; 20s at 98 ℃, 2min at 68 ℃ and 35 cycles; 7min at 68 ℃; 25 ℃ for 1 s.

The PCR products were subjected to 1% agarose gel electrophoresis, and 38, 29 and 25 independent positive transformed plants of T0 generation were obtained from 3 vectors, respectively.

Example 5

Identification of bacterial leaf blight resistance and amiB expression pattern of 1300-PBBI7-amiB transgenic plants

In order to detect whether transgenic plants obtain expected disease resistance, all T0 transgenic plants are inoculated with physiological race PXO99 of blight bacteria (crop genetic improvement country emphasis laboratory preserves strain, using turbidimetry, inoculum concentration is controlled between 9 hundred million and 12 hundred million/ml) in tillering stage. 5-6 leaves are inoculated to each transgenic individual plant, and the length and area of lesion spots are examined 14 days after inoculation. The inoculation result shows that the wild type has obvious disease of flower 11, and the transgenic 1300-PBBI7-amiB shows extremely strong bacterial leaf blight resistance.

The amiB gene can achieve a disease-resistant effect by silencing the expression of the endogenous gene Xa13 in the leaves of the rice, but the expression of Xa13 in the anther can cause fertility to be reduced if the expression is influenced.

The detection of pollen potassium iodide staining (0.67% potassium iodide and 0.33% iodine) is carried out on wild type medium flower 11 control and part of transgenic rice lines with high disease resistance, and the result shows that most of transgenic rice (including plants with high disease resistance) has normal pollen development and no obvious difference with the control (figure 4).

Ubiquitin-F：gttcgcccagttgacatctc；

Ubiquitin-R：cagattgttgaggttagtattgc。

Expression level detection shows that the amiB expression level in leaves is very low when the bacterial blight is not inoculated, and the expression level is remarkably increased 72 hours after the bacterial blight is inoculated, so that the rice can achieve the effect of disease resistance. Meanwhile, the amiB expression level in the transgenic rice anther is low, and the function of the target gene Xa13 in the anther is not influenced, so that the normal fertility of the anther rice is ensured.

Example 6

Brown planthopper resistance identification and LecRK1 expression pattern identification of 1300-PBBI7-LecRK1 transgenic plants

To test whether transgenic plants acquired the expected resistance to brown planthopper, we inoculated some T0 transgenic positive plants with brown planthopper at the tillering stage. And counting the brown planthopper resistance of the transgenic rice after the wild type middle flower 11 dies. The inoculation result shows that the transgene 1300-PBBI7-LecRK1 shows extremely strong brown planthopper resistance. (FIG. 5).

Expression level detection shows that the expression level of LecRK1 in the transgenic rice is very low when brown planthopper is not inoculated, and the expression level is obviously increased 24 hours after brown planthopper inoculation, which is beneficial to the rice to achieve the effect of brown planthopper resistance.

Example 7

Chilo suppressalis resistance identification and Cry1C expression pattern identification of 1300-PBBI7-Cry1C transgenic plants

In order to detect whether transgenic plants obtain expected chilo suppressalis resistance, chilo suppressalis are inoculated on part of T0 transgenic positive plants in a tillering stage. And counting the Chilo suppressalis resistance of the transgenic rice after the wild type middle flower 11 dies. The inoculation result shows that Cry1C driven by the promoter shows the feeding inducibility of chilo suppressalis and the anti-chilo suppressalis phenotype, and the transgenic 1300-PBBI7-Cry1C shows extremely strong chilo suppressalis resistance. (FIG. 6).

Expression level detection shows that the expression level of Cry1C in the transgenic rice is very low when chilo suppressalis is not inoculated, and the expression level is obviously up-regulated after the chilo suppressalis is inoculated for 24 hours, which is beneficial to the rice to achieve the effect of chilo suppressalis resistance.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Wuhan space Biotechnology GmbH

<120> biological stress inducible promoter PBBI7 and application thereof

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2061

<212> DNA

<213> Oryza sativa

<400> 1

actatcacaa agtaataaca gagactatgc atatgctctt ttataattca tagtttcaca 60

aagtggtacc aggaatccaa aacgatgggt aaaggaaaag agagaaatcc attccagttc 120

caagttagcc tgttcgaaac caatagttcc aagttatagg ctagcacaag tactatagaa 180

tcttaccaca acatttcgaa aatattagaa ctgatactgt tctttggatg tgaaccaatg 240

tgatgtgaga aggaactatg taattcacat cacgtacaat tcggtttcat attttgcacc 300

gaacaataaa atttgcactc gccttctgct atttcccccc cccccccaca tgtatagaac 360

gagaatgttt gtgttgtttt gataaccttt tccttcaatt ccttcccaat gcaagtgtgc 420

cttgatagta tcgtgggtta agagtcgcct atgctagcta atttgacaaa ggagaccaat 480

caactggaat tcaatcgagc ataaagctcg gcgcggcgca taaaccctaa acactaaaat 540

cgggcaaagg caccccgcga gatcactcca atagtccaat ggaggagagt atagaataag 600

gaggtttccc aatcgaggtt gggtgtggcc gtacatcaaa accctaggcg ctgtggggtg 660

gggattagtc gccactgccg ccacctcgag gccctctggt ttcctagtct tgtggatgag 720

cgacgaggct agctagctgc tgcggtcatg aaccctcgtt gagaaaattt cctgctcccg 780

gaatgccggc ggcggtggac cccctcccca gtcgatccga gcagagcacg atgggggagg 840

acggcggcgg cgacgacaac gacgagtcgt cgccgacgac gacggaggag gaaggaggcg 900

gtgattgatg attttgcggg gtaaaacgtg ttaatccaag ggtttttttg ggtaaaaaca 960

tcactccgcc tctcgtttcg gtgcgatctg gacccttcct tgtttactac tcctattgat 1020

ctgacggttg tacgtggccc aacaggagga tcgcttagta ctggtagcga tctagcgtgc 1080

gctgggctgt attgacggta tgagcccatg gattttgcgc tgggctgtac tgacggtggg 1140

gttcttttct tatgaaaatg aagatgaaga taaagattaa gttttttacg taaaatgagg 1200

tggtattaac gtatgattga ttgagtttca attattacaa acttgaaaat tagattaata 1260

tgatatttta gagtaacttt catatagaaa gttttcgcac gaaacgcacc gtttagtaat 1320

ttgaaaagcg tgccacgaaa atcttaatct tcatccaact cttgttggag aaaagaacag 1380

gactacatca atatgtaatg gctgtttggt agagatatgt atgcataaac ctagcttcac 1440

tctctctagt ttattttttt tataagatgt ctctgaaaag accctcttta gtttattttg 1500

taagagtgct ttatttagtt tcactcttat tttagatgga gttgaaactc atcgatggaa 1560

aatgatgtat gtattagaat tcatttgttc aattcaatac ctgctctctg actctgcttg 1620

cttggctagc tgcccattca tcagcgactt gccacgcggc taaccgtacg tgtagtcacg 1680

atttagatta attaggtgcg tggatatatt gcatcgtatg aacggtcgtg atcatgtgat 1740

ggaaatggga accatacaat cacgcatgtc cctgtcttgt acacctatag tccgaacgaa 1800

gaaacgggtc agaaagaaac aaaactatgt cgatcttgtg cattgcatgc acatcttgtt 1860

gatatattct gacgttgagg ttgagccatc ctcctcatat aatctccatc tttcatacca 1920

caagatatgc attatcattt ttccatggac caaaggaata ataaggaata gtagctagga 1980

gtgttaagtt gcttgttaat tcctctctct acgagaacgt gctgccacgt gctcttatcc 2040

acacaattaa agtcagttag g 2061

<210> 2

<211> 276

<212> DNA

<213> Artificial Sequence

<400> 2

gaattcccga tctagtaaca tagatgacac cgcgcgcgat aatttatcct agtttgcgcg 60

ctatattttg ttttctatcg cgtattaaat gtataattgc gggactctaa tcataaaaac 120

ccatctcata aataacgtca tgcattacat gttaattatt acatgcttaa cgtaattcaa 180

cagaaattat atgataatca tcgcaagacc ggcaacagga ttcaatctta agaaacttta 240

ttgccaaatg tttgaacgat cggggaaatt cgagct 276

<210> 3

<211> 257

<212> DNA

<213> Artificial Sequence

<400> 3

ggatcccagc agcagccaca gcaaaatttg gtttgggata ggtaggtgtt atgttaggtc 60

tggttttttg gctgtagcag cagcagtgta gcgagaatct gtcgccgcag gagattcagt 120

ttgaagctgg acttcacttt tgcctctctc ggcgtcagtt tctcgctaca ttcctgctgc 180

taggctgttc tgtggaagtt tgcagagttt atattatggg tttaatcgtc catggcatca 240

gcatcagcag cggtacc 257

<210> 4

<211> 2442

<212> DNA

<213> Artificial Sequence

<400> 4

atggtggccc tcctgctctt cccaatgctg ctccagctgc tctcccctac gtgcgcgcag 60

acccagaaga atatcacact gggcagcacg ctcgcgccac agtctccggc gagcagctgg 120

ctctcacctt ccggcgactt cgccttcggc ttcaggccag tggagggcaa cacgagcttc 180

tacctgatcg ccgtctggtt caataagatc tctgacaaga cggtggtctg gtacgcgaag 240

aacaccgacc aggacccgag catcgtggag gtcccatccg atagcttcct ccagctgacc 300

aacgatggag ccctctccct gaaggatagg agcggccagg agggctggaa tccacaggtg 360

acatctgtcg cctacgcgtc aatgcgcgac acgggcaact tcgtgctgct cggcgccgat 420

ggcaccacaa agtggcagac attcgacatg ccttccgata ccatcctccc tacacaggtc 480

atcccgtgca acaagaccag gaataagagc ctgagggcca ggctcgacat caatgattac 540

tcttcaggca ggttcctgct cgacgtgcag accgatggca acctcgcgct gtacctcgtg 600

gccgtcccat ctggctcaaa gtaccagcag tactggtcaa cggatacgac cggcaatggc 660

tcggagctcg tgttctccga gaccggcaag gtctacttcg ccctgacaga cggcacgcag 720

atcaacatct cctctggagc cggaattggc tccatggcag attacttcca tagggccacc 780

ctcgaccctg atggagtctt caggcagtat gtgtacccga agaaggcaaa tgccggcatc 840

ctgggcggcg agacatggac cgccgtgagc atgcagccgc agaacatctg ccatgcgatt 900

gtgtcagatg tgggctcggg agtctgcggc ttcaactcat actgcacgtt cgatggcacc 960

cggaatcaga tcgcctcgtg ccagtgcccg ccatggtaca agttcttcga cgagcagaag 1020

aagtacaagg gctgcaagca ggatttccag ccgcactcgt gcgacctcga tgaggcaact 1080

gccctggcac agttcgagct ccgccctatc tacggcgtgg actggccgct ctccgattac 1140

gagaagtacg agccaatcgg ccaggacgat tgcggcaggc tgtgcgtgat cgactgcttc 1200

tgcgcgatgg ccgtctacaa tcaatcgacc tccacatgct ggaagaagaa gctccctctc 1260

tccaacggca atatggccga ttacgtgcag cggaccgtcc tgctcaaggt gccgagctct 1320

aactcatcgc agagcatgat ctctacatcc agcaacaagt ggaagaggaa tcggaagcat 1380

tgggtgctcg gctcttcact gatcctcggc acatcgatcc tggtcaattt cgcgctcatc 1440

tccatcttcc tgttcggcac ctactgccgc atcgccacaa agaagaacat cccactctca 1500

caggcgtcgt ccaagtcgca gctgcctctc aagacgttca cctacaagga gctcgagaag 1560

gcgactgcgg gattccatga gatcctggga gccggagcat ctggcgtggt ctacaagggc 1620

cagctggagg acgagctcaa gacaaacatc gccgtgaaga agatcgataa gctccagccg 1680

gagacggaga aggagttcat ggtcgaggtc gagacaatcg gccagacgtt ccataagaac 1740

ctcgtgcggc tgctcggctt ctgcaatgag ggagccgaga ggctgctggt ctacgagttc 1800

atgacgaacg gcccgctcaa taggctgctc ttcgacaact ccaggccaca ctggaatacc 1860

cgggtccata ttgccctggg agtggcaagg ggactgctct acctgcacga cgagtgctct 1920

aagcagatca tccattgcga tatcaagcct cagaacatcc tgctcgacga taatctcgtg 1980

gccaagatct cagatttcgg cctggcgaag ctgctcctga ccaaccagac acgcacgaat 2040

accggcatcc gcggcacaag gggctacgtc gcacctgagt ggttcaagaa catcggcatc 2100

tctaccaagg tggacgtcta ctcattcggc gtcatcctcc tggagctcgt gtgctgccgc 2160

aggaatgtcg agctggaggt ggtcgatgag gagcagacca tcgtgacata ctgggccaat 2220

gactgctaca ggtctggaag gattgatctc ctggtggagg gcgacgatga ggccatctac 2280

aatatcaaga aggtcgagag gttcgtgact gtggccctgt ggtgcctcca ggaggacccg 2340

tctatgcggc caaacatgct caaggtgaca cagatgctgg atggagccgt ggcaatccca 2400

tccccgccgg acccgtgcag cttcatcagc tctctcccgt ag 2442

<210> 5

<211> 2311

<212> DNA

<213> Artificial Sequence

<400> 5

tcggatccac catggaggag aacaatcaga accagtgtat cccttacaat tgtctttcta 60

atcctgaaga agttcttttg gatggagaaa ggatctcaac tggtaactca tcaattgaca 120

tctctctctc acttgttcag ttcttggttt ctaactttgt gccaggagga ggattccttg 180

ttggacttat cgacttcgtt tggggaatcg ttggaccttc tcaatgggat gcatttctcg 240

ttcagatcga acagctcatc aacgaaagaa tcgctgagtt cgctaggaat gctgctattg 300

ctaaccttga aggacttgga aacaacttca acatctacgt ggaggcattc aaggaatggg 360

aagaagatcc taacaaccca gcaaccagga ccagagtgat cgataggttc cgtatccttg 420

atggacttct tgaaagggac attcctagct ttaggatctc tggatttgaa gttccacttc 480

tctctgttta cgctcaagct gctaatctcc atcttgctat ccttagagat tctgtgatct 540

tcggagaaag atggggattg acaaccatca acgtgaacga gaactacaac agactcatca 600

ggcacatcga tgagtacgct gatcactgtg ctaacactta caaccgtgga ctcaacaacc 660

ttcctaagtc tacctatcaa gattggatca catacaaccg acttaggaga gaccttacat 720

tgactgttct tgatatcgct gctttctttc caaactatga caataggaga tatccaattc 780

agccagttgg tcaacttaca agggaagttt acactgaccc actcatcaac ttcaacccac 840

agcttcagtc tgttgctcag cttcctacct tcaacgttat ggagagcagc gcaatcagaa 900

atcctcacct cttcgacatc ttgaacaacc ttacaatctt taccgattgg tttagtgttg 960

gacgtaactt ctactgggga ggacatcgac tgatctctag cctcatcgga ggtggtaaca 1020

tcacatctcc tatctacgga agagaggcta accaggagcc tccaagatca ttcactttca 1080

acggacctgt gttcaggact ctttcaaatc ctactcttcg acttcttcag caaccttggc 1140

cagctccacc attcaacctt cgtggtgttg aaggagttga gttctctaca cctacaaaca 1200

gcttcaccta tcgtggaaga ggtactgttg attctcttac tgaacttcca cctgaggaca 1260

acagtgtgcc acctcgtgaa ggatacagtc atcgtctttg tcatgcaacc ttcgttcaaa 1320

gatctggaac acctttcctt acaactggtg ttgtgttctc ttggactcat cgtagtgcaa 1380

ctcttaccaa cacaattgat ccagagagga tcaaccagat ccctcttgtg aaaggattca 1440

gagtttgggg aggaacctct gtgattacag gaccaggatt cacaggaggt gatatccttc 1500

gaagaaacac ctttggtgac ttcgtttctc ttcaagtgaa catcaactca ccaatcaccc 1560

aaagataccg tcttagattt cgttacgctt ctagtaggga tgcacgagtt atcgttctta 1620

caggagctgc atctacagga gtgggaggtc aagttagtgt gaacatgcct cttcagaaaa 1680

ctatggagat cggagagaac ctcacatcta gaacattcag atacaccgac ttcagtaatc 1740

ctttctcatt cagagctaat ccagacatca tcggtatcag tgaacaacct ctcttcggtg 1800

caggttctat cagtagcggt gaactttaca tcgacaagat cgagatcatc cttgcagatg 1860

caacatttga agcagaatct gaccttgaaa gagcacaaaa gtagtgacca acgtatttat 1920

atcagaaaat agatgagtcg aaattaaaag cttatacccg ttaatgacaa aaaataaata 1980

aaaacgaatt cccgatctag taacatagat gacaccgcgc gcgataattt atcctagttt 2040

gcgcgctata ttttgttttc tatcgcgtat taaatgtata attgcgggac tctaatcata 2100

aaaacccatc tcataaataa cgtcatgcac ctgaatagat cttggacaag cgttaggcct 2160

atctgtgcat tacatgttaa ttattacatg cttaacgtaa ttcaacagaa attatatgat 2220

aatcatcgca agaccggcaa caggattcaa tcttaagaaa ctttattgcc aaatgtttga 2280

acgatcgggg aaattcgagc tcggatccca a 2311

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 6

agtggtacca ggaatccaaa ac 22

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 7

cctaactgac tttaattgtg tggat 25

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 8

cgacggccag tgccaagctt agtggtacca ggaatccaaa 40

<210> 9

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 9

ctgtggctgc tgctgggatc ccctaactga ctttaattgt g 41

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 10

aagagcagga gggccaccat cctaactgac tttaattgtg 40

<210> 11

<211> 49

<212> DNA

<213> Artificial Sequence

<400> 11

cactggttct gattgttctc ctccatccta actgacttta attgtgtgg 49

<210> 12

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 12

cacaattaaa gtcagttagg ggatcccagc agcagccaca g 41

<210> 13

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 13

gatcggggaa attcgagctc ggtaccgctg ctgatgctga t 41

<210> 14

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 14

cacaattaaa gtcagttagg atggtggccc tcctgctctt 40

<210> 15

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 15

gatcggggaa attcgagctc ctacgggaga gagctgatga 40

<210> 16

<211> 49

<212> DNA

<213> Artificial Sequence

<400> 16

ccacacaatt aaagtcagtt aggatggagg agaacaatca gaaccagtg 49

<210> 17

<211> 43

<212> DNA

<213> Artificial Sequence

<400> 17

cgatcgggga aattcgagct cctacttttg tgctctttca agg 43

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 18

agaatctcgt gctttcagct tcga 24

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 19

tcaagaccaa tgcggagcat atac 24

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 20

gttcgcccag ttgacatctc 20

<210> 21

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 21

cagattgttg aggttagtat tgc 23

Claims (9)

1. A biological stress inducible promoter is characterized by a nucleotide sequence shown as SEQ ID NO. 1.

2. A genetic construct comprising:

(a) the promoter of claim 1; and

(b) a heterologous nucleic acid sequence operably linked to the promoter of (a); and optionally

(c) A 3' transcription terminator.

3. An expression cassette comprising the genetic construct of claim 2.

4. A transformation vector comprising the genetic construct of claim 2.

5. An expression vector comprising the genetic construct of claim 2.

6. A method for improving stress resistance of rice comprises the following steps:

(a) operably linking a rice-resistant foreign gene to the promoter of claim 1, and

(b) the resulting genetic construct is introduced into rice or rice cells.

7. The method of claim 6, wherein the rice-resistant foreign genes comprise a gene resistant to bacterial blight, a gene resistant to brown planthopper and a gene resistant to chilo suppressalis.

8. A method of producing a transgenic rice plant comprising:

(a) introducing the promoter according to claim 1, or the genetic construct according to claim 2, or the expression cassette according to claim 3, or the transformation vector according to claim 4, or the expression vector according to claim 5 into rice or rice cells, and

(b) culturing the rice or rice cells under conditions that promote the growth of rice.

9. The use of the promoter of claim 1 for increasing the expression of a foreign gene in transgenic rice.

Images