CN113801891A - Construction method and application of beet BvCENH3 gene haploid induction line - Google Patents

Construction method and application of beet BvCENH3 gene haploid induction line Download PDF

Info

Publication number
CN113801891A
CN113801891A CN202111069180.5A CN202111069180A CN113801891A CN 113801891 A CN113801891 A CN 113801891A CN 202111069180 A CN202111069180 A CN 202111069180A CN 113801891 A CN113801891 A CN 113801891A
Authority
CN
China
Prior art keywords
beet
gene
vector
cenh3
bvcenh3
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111069180.5A
Other languages
Chinese (zh)
Other versions
CN113801891B (en
Inventor
吴新荣
白晨
孙瑞芬
李晓东
韩平安
唐宽刚
常悦
张自强
王良
张必周
梁亚晖
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiaxing Qinghao Agricultural Technology Co.,Ltd.
Original Assignee
Inner Mongolia Academy of Agricultural and Animal Husbandry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inner Mongolia Academy of Agricultural and Animal Husbandry Sciences filed Critical Inner Mongolia Academy of Agricultural and Animal Husbandry Sciences
Priority to CN202111069180.5A priority Critical patent/CN113801891B/en
Publication of CN113801891A publication Critical patent/CN113801891A/en
Application granted granted Critical
Publication of CN113801891B publication Critical patent/CN113801891B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Botany (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a construction method and application of a beet BvCENH3 gene haploid induction line. The method for constructing the beet BvCENH3 gene haploid induction line comprises the following steps: transforming beet petioles by agrobacterium tumefaciens containing a beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector to prepare a beet plant with CENH3 gene mutation; the sugar beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector is a CRISPR-Cas9 vector containing two sgRNAs targeting sugar beet CENH3 genes. The invention constructs a haploid induction line based on CENH3 gene regulation, and constructs a pBWA (V) K-EGFP-CENH3 complementary vector to save the embryonic lethality of CENH 3. The haploid breeding applying the technology of the invention can greatly shorten the breeding period of the beet, and is an efficient beet breeding approach.

Description

Construction method and application of beet BvCENH3 gene haploid induction line
Technical Field
The invention relates to a construction method and application of a beet BvCENH3 gene haploid inducer, in particular to a construction method of a beet BvCENH3 gene haploid inducer based on a CRISPR/Cas9 editing system, a sgRNA and CRISPR/Cas9 editing system used in the method and related application, and belongs to the field of genetic modification.
Background
The beet has the characteristics of cool preference, barren tolerance, salt and alkali tolerance and wide adaptability. The beet belongs to cross-pollinated crops, and the self-breeding seed setting rate of the beet is low due to high self-incompatibility, so that pure lines are difficult to generate. In the process of beet breeding, the time of 12-16 years is generally needed for stabilizing one filial generation, and sometimes variation occurs in the filial generation, and a haploid can obtain a DH (double-hatched) pure line with consistent characters in one generation through chromosome doubling, so that the breeding progress is greatly accelerated.
The haploid can be spontaneously generated or artificially induced, but the spontaneous generation frequency is extremely low, the artificial induction cost is high, and the haploid is easily limited by the genotype of the plant, so that the development and application of the haploid are limited to a great extent. In 2010, Ravi et al developed a novel haploid induction line based on a centromere protein modified variant when studying Arabidopsis thaliana CENH3 mutant, the N-terminal tail domain of traditional histone H3(H3.3) was used to replace the N-terminal tail domain of CENH3, GFP-tailswap composite protein formed after GFP is added can save the embryonic lethality of CENH3 mutant, in the offspring obtained by crossing CENH3 mutant with GFP-tailswap gene and other Arabidopsis thaliana, the chromosomes from GFP-tailswap plants completely disappear to form a haploid only containing another parent chromosome group, and male parent or female parent haploid can be efficiently generated in Arabidopsis thaliana.
Genome editing technology is an operation technology for modifying a specific DNA sequence at the genome level. CRISPR/Cas9 is a novel RNA-guided nuclease site-directed cleavage technology based on bacterial type II adaptive immune system, and has become yet another highly efficient genome editing tool following ZFNs and TALENs. The CRISPR/Cas system is widely present on bacterial (50%) and archaea (90%) genomes or plasmids, and consists of two parts, a unique CRISPR (clustered regulated interstitial short palindromic repeats) sequence element and some related genes (CRISPR associated genes, Cas) flanking it. The CRISPR sequence element also comprises a leader sequence (leader) which is rich in AT base and is 300-500 bp in length, a 20-50 bp repeat sequence (repeat) covering a palindromic sequence and a 26-72 bp spacer sequence (spacer) which are positioned AT the upstream of the CRISPR locus. The Leader sequence is considered to be the promoter sequence of CRISPR; the Repeat is separated by a Spacer; the Spacer region is composed of captured exogenous DNA, is similar to immunological memory, and can be recognized by a bacterial organism when the exogenous DNA containing the same sequence invades, and is cut to silence the expression of the exogenous DNA, so that the aim of protecting the safety of the organism is fulfilled. Cas protein exists near a CRISPR site, is a double-stranded DNA endonuclease, and contains RuvC and HNH nuclease domains, wherein the two nuclease domains are at the same site, generally 3-4 bp upstream of PAM (promoter ad jacent mobility), and can cut a target site simultaneously under the guide of guide RNA (single guide RNA, sgRNA). A specific Cas protein will recognize the PAM sequence of the target sequence DNA, resulting in blunt ends. DNA at the 5' end of PAM (i.e., protospacer) is processed by Cas protein into short DNA fragments that are inserted between repeats of its CRISPR sequence, ultimately allowing the bacteria to recognize and subsequently target these foreign sequences for cleavage by the pacer sequence.
The CRISPR/Cas9 system confers specific immunity to foreign DNA on prokaryotic cells, the specificity being determined by the spacer sequence. At present, there are mainly 3 types of CRISPR/Cas9 systems, and according to the difference of tissue origins of genes at Cas9 locus, the 3 types can be further divided into 10 subtypes, and different protein complexes can be expressed aiming at different interferences. The type II system is the simplest in composition, and comprises Cas9 nuclease and guide RNA (gRNA) as cores. The Cas9 endonuclease cleaves DNA at a specific site under the guidance of sgRNA molecules to form a double-stranded DNA nick, and then the cell repairs the fragmented DNA by means of homologous recombination mechanism (HR) or non-homologous end linking mechanism (NHEJ). If the cell is repaired by the HR mechanism, another DNA segment is used for filling up a broken DNA gap, so that a new section of genetic information is introduced; in the NHEJ repair process, one or two nucleotides are often eventually deleted or added, causing a frameshift mutation that prevents gene expression. CRISPR technology is not only a tool for already existing gene functions, but also can be used for gene editing to improve crops, establish animal models of genetic diseases and gene therapy.
The CRISPR/Cas9 system is simple in construction and low in cost, and is successfully applied to crops such as escherichia coli, fruit flies, mice, model plants, arabidopsis thaliana and tobacco, rice, wheat, corn, cotton, soybeans, grapes and sweet oranges. Unlike animals and microorganisms, CRISPR/Cas 9-based gene editing in plants typically relies on stable transformation of constructs expressing Cas9 and sgrnas, mainly using agrobacterium-mediated transformation methods. Among the mutations mediated by CRISPR/Cas technology are indels, base substitutions, gene substitutions, and multiple gene edits. Studies on altering a single-gene mutation of centromere protein CENH3 gene by CRISPR/Cas means to alter the function of the gene have been reported. A novel haploid inducer line based on the CENH3 variant was first developed in the model plant arabidopsis thaliana, and subsequently successfully developed in maize using the CENH 3-mediated approach. However, no study on sugar beet of CRISPR/Cas9 system based on CENH3 variant was reported.
Disclosure of Invention
The invention aims to provide a method for constructing a beet BvCENH3 gene haploid inducer line.
Another object of the present invention is to provide a sugar beet plant with a mutant CENH3 gene for use in haploid breeding.
Another object of the present invention is to provide a plant complementing the sugar beet plant with the CENH3 gene mutation.
The invention also aims to provide a sugar beet plant with CENH3 gene mutation, sgRNA used in the construction method of a complementary plant thereof, an intermediate vector and related application.
According to the specific embodiment of the invention, the invention provides a construction method of a beet BvCENH3 gene haploid inducer based on a CRISPR/Cas9 editing system, wherein the BvCENH3 gene is changed by reasonably utilizing a CRISPR/Cas9 editing means, so that the haploid inducer of the beet can be rapidly cultured. The invention firstly designs 2 target DNA sequences (sgRNA1 and sgRNA2) according to a cDNA conserved sequence of a beet CENH3 gene, then designs primers of sgRNA1 and sgRNA2 genes according to the 2 target sequences, introduces an enzyme cutting site of Eco31I, constructs a double-target editing vector CRISPR-Cas9 containing the sgRNA1 and the sgRNA2, can edit a gene of CENH3 to cause the gene to be mutated, realizes the silencing of the CENH3 gene, and causes partial or complete lack of gene functions. In order to further verify the effect of the invention, the CRISPR-Cas9 vector containing 2 sgrnas is transformed into agrobacterium, the agrobacterium containing the CRISPR-Cas9 vector is transformed into sugar beet petioles, and the transgenic plants with base mutation and deletion are successfully detected by using PCR and sequencing technology, wherein the function of the CENH3 gene is deleted. The invention further synthesizes a target gene AtCENH3-GFP-H3.3TAIL-HFD-NOS sequence, constructs a CENH3-GFPtailswap complementary vector, transforms agrobacterium into the complementary vector containing the sequence, transforms beet petioles into agrobacterium with the agrobacterium containing the CENH3-GFPtailswap vector to obtain a transgenic plant, and the transgenic plant is used for crossing with the transgenic CENH3 mutant plant to save embryo death of CENH3 and obtain a haploid induction line.
Specifically, in one aspect, the invention provides a method for constructing a haploid inducer line of a beet BvCENH3 gene, which comprises the following steps:
transforming beet petioles by agrobacterium tumefaciens containing a beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector to prepare a beet plant with CENH3 gene mutation;
the sugar beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector is a CRISPR-Cas9 vector containing two sgRNAs targeting sugar beet CENH3 genes.
According to a specific embodiment of the invention, in the method for constructing the haploid inducer line of the beet BvCENH3 gene, the two sgrnas targeting the beet CENH3 gene have the following nucleotide sequences:
sgRNA 1: the nucleotide sequence shown in SEQ ID NO.1 or the sequence consisting of 4 th to 23 th nucleotides of SEQ ID NO. 1;
sgRNA 2: the nucleotide sequence shown in SEQ ID NO.2, or the sequence consisting of the 4 th to 23 th nucleotides of SEQ ID NO. 2.
According to a specific embodiment of the invention, the construction method of the beet BvCENH3 gene haploid inducer line further comprises a process for preparing agrobacterium containing the beet BvCENH3 gene double-target CRISPR/Cas9 editing vector:
and (3) transforming agrobacterium with the beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector to prepare the agrobacterium containing the beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector.
According to a specific embodiment of the invention, the construction method of the beet BvCENH3 gene haploid inducer line further comprises the process of preparing the beet BvCENH3 gene double-target CRISPR/Cas9 editing vector:
two sgRNAs targeting the beet CENH3 gene are connected to CRISPR-Cas9 with kanamycin resistance, and a beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector is prepared.
According to a specific embodiment of the invention, in the method for constructing the beet BvCENH3 gene haploid inducer line, preferably, the process for preparing the beet BvCENH3 gene double-target CRISPR/Cas9 editing vector comprises the following steps:
connecting two sgRNAs targeting a beet CENH3 gene to a CRISPR-Cas9 and another empty vector respectively to obtain two ligation products, wherein each ligation product contains one sgRNA;
and (3) respectively carrying out enzyme digestion on the two ligation products by using Lgu I, and carrying out enzyme digestion on the products by using T4 ligase to construct a beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector.
In the process of preparing the beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector, the empty vector CRISPR-Cas9 is an empty vector pBWA (V) -KAT containing Cas9 and kana resistance genes. The other empty vector is used for connecting multiple targets in series, and a section of sequence on the framework is identical to a section of sequence of sgRNA on the gene editing vector. Preferably, the other empty vector is pbwd (lb) dnai (at). According to a more specific embodiment of the invention, in the process of preparing the double-target CRISPR/Cas9 editing vector of the beet BvCENH3 gene, two ligation products are obtained respectively as CRISPR-Cas9/sgRNA and pbwd (lb) dnai (at)/sgRNA.
According to a specific embodiment of the invention, when the two ligation products are respectively cut by Lgu I and are connected by T4 ligase, the cut target fragment of pBWD (LB) DNAi (AT)/sgRNA is inserted into CRISPR-Cas9/sgRNA to obtain the recombinant vector CRISPR-Cas9/CENH3 containing the double targets.
According to a specific embodiment of the invention, the method for constructing the beet BvCENH3 gene haploid inducer line further comprises the following steps:
carrying out positive and negative hybridization on the beet plant with CENH3 gene mutation and a complementary plant to form beet BvCENH3 gene haploid;
wherein the complementary plant is a beet plant containing a pBWA (V) K-EGFP-CENH3 complementary vector using NPT II gene as a screening marker.
According to a specific embodiment of the invention, the method for constructing the beet BvCENH3 gene haploid inducer line further comprises the process of preparing a complementary plant:
transforming beet petiole with Agrobacterium containing complementary vector pBWA (V) K-EGFP-CENH3 to prepare complementary plant;
wherein, the agrobacterium containing the complementary vector pBWA (V) K-EGFP-CENH3 is prepared by transforming agrobacterium with the complementary vector pBWA (V) K-EGFP-CENH 3.
According to a specific embodiment of the invention, in the method for constructing the beet BvCENH3 gene haploid inducer line, the complementary vector pBWA (V) K-EGFP-CENH3 is preferably pBWA (V) K vector connected with CENH3-GFPtailswap gene.
According to a specific embodiment of the invention, in the method for constructing the beet BvCENH3 gene haploid inducer line, more preferably, the CENH3-GFPtailswap gene has a nucleotide sequence shown in SEQ ID No. 9.
In another aspect, the present invention also provides a sgRNA comprising:
sgRNA having the nucleotide sequence shown in SEQ ID NO.1 or the sequence consisting of the 4 th to 23 th nucleotides of SEQ ID NO. 1; and/or
sgRNA having the nucleotide sequence shown in SEQ ID NO.2 or the sequence consisting of the 4 th to 23 th nucleotides of SEQ ID NO. 2.
In another aspect, the present invention also provides an intermediate vector containing a nucleotide sequence of the sgRNA of the present invention. The intermediate carrier may include, for example: the sugar beet BvCENH3 gene double-target CRISPR/Cas9 editing vector and/or the agrobacterium containing the sugar beet BvCENH3 gene double-target CRISPR/Cas9 editing vector.
In another aspect, the present invention also provides a complementary intermediate vector comprising:
pBWA (V) K-EGFP-CENH3 complementary vector using NPT II gene as selection marker, and/or
Agrobacterium comprising the pBWA (V) K-EGFP-CENH3 complementation vector.
In another aspect, the invention also provides application of the sgRNA, the intermediate vector and/or the complementary intermediate vector in constructing a beet BvCENH3 gene haploid inducer line.
In another aspect, the invention also provides a primer for detecting a transformation vector in a haploid induction line for constructing the beet BvCENH3 gene, wherein the primer comprises a primer pair shown in the following sequence:
SEQ ID NO.7 and SEQ ID NO. 8; and/or
SEQ ID NO.12 and SEQ ID NO. 13.
In some specific embodiments of the invention, the invention provides a BvCENH3 gene dual-target vector CRISPR-Cas9/CENH3 and a construction method thereof. The construction method of the BvCENH3 gene double-target vector CRISPR-Cas9/CENH3 comprises the following steps:
(1) selecting a target: 2 target sequences are designed according to a cDNA conserved sequence of a beet CENH3 gene (NW _017567392), and are shown as SEQ ID No.1 and SEQ ID No. 2;
(2) designing a primer combination of a beet CENH3 target region for obtaining 2 sgRNAs, introducing an ECO31I enzyme cutting site, wherein the nucleotide sequences of forward and reverse primers are shown as SEQ ID NO.3 and SEQ ID NO.4 (sgRNA1 is amplified), SEQ ID NO.5 and SEQ ID NO.6 (sgRNA 2 is amplified);
(3) primer denaturation and annealing are carried out, and fragments of sgRNA1 and sgRNA2 are obtained;
(4) enzyme digestion and connection: the sgRNA1 and sgRNA2 fragments, an empty vector pBWA (V) -KAT (containing a Cas9 kana resistance gene) and an empty vector pBWD (LB) DNAi (AT) are respectively digested by ECO31I, and the digested sgRNA1 and the empty vector pBWA (V) -KAT, sgRNA2 and the empty vector pBWD (LB) DNAi (AT) are respectively connected by T4-ligase to obtain sgRNA1 and sgRNA2 recombinant intermediate vectors CRISPR-Cas9/sgRNA1 and pBWD (LB) DNAi (AT) -sgRNA2 containing a specific targeting CENH3 gene;
the recombinant intermediate vectors CRISPR-Cas9/sgRNA1 and pBWD (LB) DNAi (AT)/sgRNA2 can be respectively transferred into Escherichia coli; extracting plasmids, sequencing and verifying the correct sequence;
(5) constructing a double-target vector CRISPR-Cas9/CENH 3: the recombinant intermediate vectors CRISPR-Cas9/sgRNA1 and pBWD (LB) DNai (AT)/sgRNA2 are cut by Lgu enzyme and are connected by T4-ligase, and the cut target fragments of pBWD (LB) DNai (AT)/sgRNA2 are inserted into CRISPR-Cas9/sgRNA1 to obtain the recombinant vector CRISPR-Cas9/CENH3 containing the double targets.
In some embodiments of the invention, the invention provides a pBWA (V) K-CENH3-GFPtailswap complement vector and a method for constructing the same. The construction method of the pBWA (V) K-CENH3-GFPtailswap complementary vector comprises the steps of synthesizing a target sequence AtCENH3-GFP-H3.3TAIL-HFD (AtCENH3 is an Arabidopsis thaliana CENH3 promoter sequence, GFP-H3.3TAIL-HFD is a tail domain of H3.3 histone and a GFP tag protein to replace the original tail domain of CENH3, and HFD is the C end of the tail domain), and constructing the pBWA (V) K-EGFP-CENH3 complementary vector which takes an NPT II gene as a screening marker. The method specifically comprises the following steps:
(1) synthesizing a target sequence with the length of 2566bp, recording the target sequence as CENH3-GFPtailswap, and displaying the sequence as SEQ ID NO. 9;
(2) and amplifying the target fragment by PCR. Amplifying a CENH3-GFPtailswap target band by using a specific primer, recovering and purifying, wherein the primers are shown as SEQ ID NO.10 and SEQ ID NO.11, and introducing an Eco31I enzyme cutting site;
(3) the product of the step (2) is cut by Eco31I and then is connected with pBWA (V) K-EGFP cut by Eco31I to obtain a complementary vector pBWA (V) K-EGFP-CENH 3.
In some specific embodiments of the invention, the CRISPR-Cas9 system and the CENH3-GFPtailswap complementation system of the beet CENH3 gene are respectively transformed into agrobacterium and then are used for beet transgenosis. Experiments show that in the offspring obtained by positive and negative hybridization of the double-editing plant CRISPR-Cas9/CENH3 and the complementary plant GFP-tailswap, chromosomes from the GFP-tailswap plant disappear completely, and a haploid only containing another parent chromosome group is formed. The technology of the invention is fully shown to be capable of saving embryo lethality of CENH3 mutant, and haploid breeding can greatly shorten the breeding period of beet, thus being a high-efficiency beet breeding approach.
In conclusion, the CRISPR/Cas9 technology is utilized to edit the CENH3 gene in the beet genome, a double knockout vector CRISPR-Cas9/CENH3 with a kat gene as a screening marker is constructed, an agrobacterium-mediated method is utilized to transform beet to obtain CRISPR-Cas9/CENH3 transgenic plants, and mutation detection is carried out on part of the transgenic single plants to obtain target site mutant plants. The invention also constructs a pBWA (V) K-EGFP-CENH3 complementary vector which takes the NPT II gene as a screening marker so as to save the embryonic lethality of CENH 3. The method can be used for preparing the beet transgenic haploid induction line edited by the CENH3 gene and has an important effect on accelerating the beet breeding process.
Drawings
FIG. 1 is an agarose gel electrophoresis diagram of an amplification product of an sgRNA double-target vector CRISPR-Cas9/CENH3 Escherichia coli liquid.
FIG. 2 is an agarose gel electrophoresis diagram of an amplification product of an agrobacteria liquid of an sgRNA double-target vector CRISPR-Cas9/CENH 3.
FIG. 3 is an agarose gel electrophoresis chart of the amplification product of the target sequence CENH 3-GFPtailswap.
FIG. 4 is the agarose gel electrophoresis chart of the complementary vector pBWA (V) K-EGFP-CENH3 E.coli liquid PCR detection.
FIG. 5 shows the agarose gel electrophoresis of complementary vector pBWA (V) K-EGFP-CENH3 after digestion verification.
FIG. 6 is an agarose gel electrophoresis of the product of Agrobacterium tumefaciens amplification product of the complementary vector pBWA (V) K-EGFP-CENH 3.
FIG. 7 is an agarose gel electrophoresis of the specific primer amplification products of the transgenic double target carrier sugar beet plants.
FIG. 8 is a sequence map of the mutant strain and a sequence alignment chart with a target region of a wild-type DNA.
FIG. 9 is a photograph of control plants (wild type sugar beet) and mutant plants.
FIG. 10 is an agarose gel electrogram of the specific primer amplification product of the transcomplementing vector pBWA (V) K-EGFP-CENH3 sugar beet.
FIG. 11 is a photograph of control plants (wild type sugar beet) and trans-complementation vector plants.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, steps or conditions of the invention may be made without departing from the spirit of the invention.
In each example, unless otherwise specified, the materials and biochemical reagents used were all conventional and commercially available reagents (all reagents were obtained from Biotech, Boyuan, Inc., unless otherwise noted), and the techniques used were those known to those skilled in the art, or they were performed according to the conditions recommended by the manufacturer of the apparatus.
Unless otherwise noted, each sequence described herein is in the 5 '-3' direction.
Example 1: sgRNA design of sugar beet CENH3 gene CRISPR-Cas9
1. Search for the PAM (proto adjacent motif) motif:
the sequence region of CENH3 gene was searched for the PAM motif, i.e., NGG.
2. Determining the sequence of sgRNA:
a sequence of 20bp at the 5 'end of the PAM position is an sgRNA sequence, and the CaM 35S promoter is used in the beet CRISPR-Cas9 to transcribe the sgRNA, so the base at the 20 th position of the 5' end of the NGG is preferably G (N)19 NGG. 2 target sequences of beet CENH3 gene, as shown in SEQ ID NO.1 and SEQ ID NO. 2.
SEQ ID NO.1：ccacctgcttgctgctgctcccc
SEQ ID NO.2：ccgcgcagtttgcaatcaccaca
sgRNA primer synthesis:
the sequences of the 2 sgRNA primers are shown in SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO. 6.
SEQ ID NO.3：cagtGGTCTCaattggggagcagcagcaagcagg
SEQ ID NO.4：cagtGGTCTCaaaaccctgcttgctgctgctccc
SEQ ID NO.5：cagtGGTCTCaattgtgtggtgattgcaaactgcg
SEQ ID NO.6：cagtGGTCTCaaaaccgcagtttgcaatcaccaca
sgRNA reaction system:
the synthesized primers were added to ddH separately2O, to a concentration of 10. mu. mol.L-1. Then preparing an sgRNA reaction system: forward primer (10. mu. mol. L)-1)5 μ L, reverse primer (10 μmol. L)-1)5 μ L, supplement ddH2O to 50. mu.L.
sgRNA reaction conditions:
denaturation at 95 deg.C for 10min, annealing at 55 deg.C for 10min, and cooling at 14 deg.C for 5 min.
After the reaction, sgRNA1 and sgRNA2 products were obtained.
Example 2: sugar beet CENH3 genes sgRNA1 and sgRNA2 are respectively connected to CRISPR-Cas9 and pBWD (LB) DNAi (AT)
sgRNA1 and sgRNA2 product purification:
sgRNA1 and sgRNA2 products were purified according to the kit instructions.
2. Enzyme digestion/ligation:
(1) CRISPR-Cas9/sgRNA1 obtained:
cleavage ligation (10. mu.L): t4-buffer1 μ L, sgRNA1 fragment 2 μ L, empty vector pBWA (V) -KAT1.5 μ L, ECO31I 0.5.5 μ L, T4-ligase0.5 μ L, ddH2O4.5. mu.L. After mixing, the mixture was reacted at 37 ℃ for 2 hours. The ligation product CRISPR-Cas9/sgRNA1 is obtained.
(2) pBWD (LB) DNAi (AT)/sgRNA 2:
cleavage ligation (10. mu.L): t4-buffer 1. mu.L, sgRNA2 fragment 2. mu.L, empty vector pBWD (LB) DNAI (AT) 1.5. mu.L, ECO31I 0.5.5. mu.L, T4-ligase 0.5. mu.L, H2O4.5. mu.L. After mixing, the mixture was reacted at 37 ℃ for 2 hours. The ligation product pBWD (LB) DNAi (AT)/sgRNA2 was obtained.
3. The ligation product was transformed into E.coli:
(1) mixing 50 μ L of Escherichia coli competent cell DH5 α with the above 5 μ L of ligation products, and ice-cooling for 30 min;
(2) quickly placing in a constant temperature water bath kettle at 42 deg.C, thermally shocking for 90s, and ice-cooling for 2 min;
(3) adding 500 μ L LB liquid culture medium, mixing;
(4) culturing at 37 deg.C and 200rpm for 45min to restore normal growth state of cells;
(5) uniformly coating the bacterial liquid on an LB solid culture medium flat plate;
(6) after 30min, the cells were incubated overnight in a 37 ℃ incubator. And obtaining the constructed intermediate vector of the escherichia coli transformed by the ligation product.
4. Bacteria detection and plasmid extraction
The constructed intermediate vector can be subjected to bacteria detection as required (if bacteria detection is not required, the bacteria are directly picked and shaken, and the accuracy can reach 99 percent) and then plasmid extraction is carried out.
The plasmid extraction process was as follows:
(1) single colonies were picked from LB solid medium plates and inoculated to a final concentration of 50. mu.g.mL-1The kanamycin-resistant LB liquid medium of (1), cultured overnight at 37 ℃;
(2) taking 4mL of activated bacterium liquid, centrifuging at room temperature of 10000rpm for 2min, and completely removing supernatant;
(3) taking 250 mu L of Solution I reagent containing the ribonuclease A to completely resuspend the bacterial block;
(4) taking 250 mu L of Solution II reagent to crack the bacterium block, and slightly reversing the bacterium block up and down for a plurality of times until the bacterium is transparent;
(5) taking 350 mu L of Solution III reagent, and reversing for several times until white compact floccules are formed;
(6) centrifuging at 12000rpm for 10min at room temperature, and collecting supernatant;
(7) taking out the nucleic acid purification column from the kit, and placing the nucleic acid purification column on a collection tube;
(8) taking the clarified supernatant obtained in the step (6) to a nucleic acid purification column, centrifuging at the room temperature of 12000rpm for 1min, and removing the filtrate;
(9) 500. mu.L of Buffer W1 was put on a nucleic acid purification column, centrifuged at 12000rpm at room temperature for 30s, and the filtrate was discarded;
(10) taking 700 mu L of Buffer W2 to a nucleic acid purification column, centrifuging at the room temperature of 12000rpm for 30s, and removing the filtrate;
(11) repeating the above operation step (10);
(12) placing the nucleic acid purification column on a collection tube, and performing air separation at the room temperature of 12000rpm for 2min to remove residual liquid as far as possible;
(13) discarding the collection tube, placing the nucleic acid purification column in 1.5mL EP tube, adding 50 μ L of eluent to elute DNA attached to the membrane of the nucleic acid purification column (the eluent can be preheated in a 65 deg.C constant temperature water bath kettle in advance to facilitate DNA elution), and standing at room temperature for 2 min;
(14) centrifuging at 12000rpm for 2min at room temperature, eluting DNA attached on nucleic acid purification column membrane, and storing in refrigerator at-20 deg.C for use.
Example 3: double-target vector CRISPR-Cas9/CENH3 for constructing beet CENH3
1.sgRNA1 and sgRNA2 of the sugar beet CENH3 gene were ligated to CRISPR-Cas9 having Kanamycin (Kanamycin, Kan) resistance.
Double target enzyme digestion ligation system (10 μ L): 10XT4 buffer1 uL, CRISPR-Cas9/sgRNA1 (plasmid) 1 uL prepared in example 2, pBWD (LB) DNAi (AT)/sgRNA2 (plasmid) 1.5 uL prepared in example 2, Lgu I0.5 uL, T4-ligase0.5 uL, ddH2O5.5. mu.L. After homogenization, the reaction was carried out at 37 ℃ for 2 hours. Obtaining the double-target recombinant vector CRISPR-Cas9/CENH 3.
2. The double-target recombinant vector CRISPR-Cas9/CENH3 is transformed into Escherichia coli.
The procedure of the transformation was the same as that of example 2.
3. Bacteria detection Kat-CENH3 dual target:
white single colonies were picked on LB plates into 10mL LB liquid medium (with kan 100 mg.L)-1) Incubated overnight at 37 ℃. PCR detection of bacteria liquid is carried out by using specific primers, the sequences of the primers are shown as SEQ ID NO.7 and SEQ ID NO.8, and the size of an amplified band is about 1250 bp.
SEQ ID NO.7：CGTTATTTATGAGATGGGTTTT
SEQ ID NO.8：ATACGAAGTTATGACTGCGACCGA
PCR assay system (20. mu.L): 2xMix 10. mu.L, upstream primer 1. mu.L, downstream primer 1. mu.L, ddH2O7. mu.L, and bacterial suspension 1. mu.L.
PCR bacterial detection program: 5min at 95 ℃; 30 cycles of 95 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 2 min; 10min at 72 ℃; storing at 4 ℃.
The PCR product was detected by 1% agarose gel electrophoresis and the correct target fragment was about 1250bp, as shown in FIG. 1 (lanes 1-9 are monoclonal).
4. Sequencing: the correct monoclonal inoculum was picked, the plasmid extracted (same procedure as plasmid extraction in example 2) and sequenced.
Analyzing and aligning sequencing results, and detecting whether the 2 double-stranded sgrnas are successfully connected to the Cas9 vector. The sequencing result is shown in SEQ ID NO. 16. Sequencing results show that the CRISPR-Cas9/CENH3 vector contains 2 sgRNAs (nucleotide sequences 4-23 of SEQ ID NO.1 and nucleotide sequences 4-23 of SEQ ID NO. 2), and no base mutation occurs, so that the CRISPR-Cas9/CENH3 vector (namely, a dual-target CRISPR-Cas9/CENH3 plasmid) containing the sgRNAs of the specific targeting beet CENH3 gene is obtained.
SEQ ID NO.16：
ACGGAGTCTCGACTGCTCTTCCTACGACAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGCAGTTTGCAATCACCACACAATCACTACTTCGACTCTAGCTGTATATAAACTCAGCTTCGTTTTCTTATCTAAGCGATGTGGGACTTTTGAAGATTGTTTTCAACTTAAATGGGCCTATATAAGAAATACTATTGTTCTTTCCCATATAAATGGGCCTGCTTCTCTTCTTTCAGATTCCCAGGGGCCTTTTGAAGATTATCTTCATATCTTAAGAATGAAGATGTTTTATTCAATCAAATTCTTGAAGGTTCGATGCCTAATCATTCTAATCCTGGGACAAACTATGAAACAAGATACAAAAACTCCGAATGGAAAGTTAAAAAGAAGAAAACGAAAGCTACGGTTCAAGAAAATGTAAGCTGATAAACAAAAAAAAACTGTATGAACGAAGAAGAAGAAAAAAAGCTAAGAAGAAATGATGTATTGTGCGGAAGGCAAGTCGAGTTTCCGTTGTTCAACGAAGCTTTCTACGACAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCCTGCTTGCTGCTGCTCCCCAATCACTACTTCGACTCTAGCTGTATATAAACTCAGCTTCGTTTTCTTATCTAAGCGATGTGGGACTTTTGAAGATTGTTTTCAACTTAAATGGGCCTATATAAGAAATACTATTGTTCTTTCCCATATAAATGGGCCTGCTTCTCTTCTTTCAGATTCCCAGGGGCCTTTTGAAGATTATCTTCATATCTTAAGAATGAAGATGTTT
Example 4: sugar beet CRISPR-Cas9/CENH3 vector transformation agrobacterium
1. And (3) transformation:
50 μ L of Agrobacterium EHA105 competent cells were mixed with 5 μ L of the dual target CRISPR-Cas9/CENH3 plasmid prepared in example 3, respectively, according to the EHA105 competent cell protocol. 100. mu.L of the bacterial suspension was applied to a sample containing Kan (100 mg.L)-1) On YEB plates, and incubated overnight at 28 ℃.
2. And (4) bacteria detection:
well-dispersed white single clones were selected to 10mL containing Kan (100 mg.L.)-1) In YEB liquid medium of (5), and cultured overnight at 28 ℃. PCR detection of bacteria liquid is carried out by specific primers, and the upstream and downstream primers are shown as SEQ ID NO.7 and SEQ ID NO. 8.
SEQ ID NO.7：CGTTATTTATGAGATGGGTTTT
SEQ ID NO.8：ATACGAAGTTATGACTGCGACCGA
The PCR assay system and procedure were the same as those in example 3.
The target PCR product was detected by 1% agarose gel electrophoresis, and the amplified band size was about 1250bp, as shown in FIG. 2 (lane 1 is a positive control, i.e., E.coli plasmid CRISPR-Cas9/CENH3, lanes 2-7 are monoclonal).
3. And (3) preserving the agrobacterium liquid:
the bacterial liquid is mixed with 50% glycerol and stored at-80 ℃ for subsequent transformation of the beet.
Example 5: the beet CENH3-GFPtailswap gene is connected to a vector
1. The CENH3-GFPtailswap gene is synthesized, the length is 2566bp, and the sequence is shown as SEQ ID NO. 9.
SEQ ID NO. 9: AtCENH3EGFP-H3.3TAIL-HFD-NOS (CENH3-GFPtailswap) artificially synthesized sequence
ATCAATGAACAAGGGCATTGAAGTGAAGTATCAATTCCAGTTTGTGATATAATCAATATTCTTCAGGATTTTTTTGGTTTGGCCTAGATATATATATAGATATCTATCCTCGGTAATGACCAGTCTAAAAAGATGTACATATTGTCCCAATGGTGAAGTTTTGATGTAAGATATCTCCTGGTGGTTTGTTATTTGTAGATATTTTTGTAAACAATGTAAATGTGAATGGTTTATGATGTATAATATATAGTTCACAAAAGATGTTTCTGTAGACTTCAGATTCCACTTCTCTATTGAACAGAACCTATGATTGGATGCTGAGAACTTGTAAAGAATCTGAGGCAGAAAGTTGAAAAACTGTGTCAATTTCATTAACTTGAAAAGATGAGCATAAATTGGGAGAGAGAGAGAGAGACAAAGATTTTGAATTGAGGTTTAACGGTAAAACACACAAAACCTATTCCCCTCTGTTTCCAATTTTCATCTAAACAAACAGGTACATATTTGAATGTAATATTGTATACAGACCAGGGGTAAAACAGGAACTAAAGAAGGCTAACAATCGAGTCGAACCCTCTATGTGAAGCCACAGGTTTAGTGCAAATTGTAATAAGTTGTTCAGAGAGACTCTTGACTGAAACAAATTGTGAAGCAGATTCGATTTTAAAATCAAAATTTGAGTGTCGAGCGGGAAAGTAAAAGTTCCGCTCCAATCTTCTAATCTTTTCGTATCTAGCGGGAAATTTCTCAGCAGGTGACTTTCATAATCGCAGTTTTCGTCGATTCTCTTTTCCGATTTTACGATTCCTCTCTCTCTCTCATGGTGCGATTTCTCCAGCAGTAAAAATCAATGGCGAGAACCAAGCATCGCGTTACCAGGTCACAACCTCGGAATCAAACTGGTATCTTAAATCTGCTTTCTCTTTCAATTTTTACTTCTGATTTTACCCAGAATTTTAGGTTTTTTATTTCGATTTTGTTAACCCTAGATTTCGAATCTGAAATTTGTAGATGCCGCCGGTGCTTCATCTTCTCAGGCGGCAGGTCCAACTACGGTACGGCATCTTTTTCCGTCTTAGGGTTTCCAATGTTTCTTCCTTTTATCGTTATGATCAAATTTGTTTATCTATCGAAATTGAAGACCCCGACAAGGAGAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGATGGCTCGTACGAAGCAATCCGCGAGAAAATCACACGGAGGAAAAGCTCCGACGAAGCAGCTCGCTACCAAGGCGGCAAGGAAATCTGCACCGACTACCGGAGGAGTCAAGAAACCTCACCGTTTCCGTCCAGGAACCGTTGCTCTAAAAGAGATTCGCCATTTCCAGAAGCAGACAAACCTTCTTATTCCGGCTGCCAGTTTCATAAGAGAAGTGAGAAGTATAACCCATATGTTGGCCCCTCCCCAAATCAATCGTTGGACAGCTGAAGCTCTTGTTGCTCTTCAAGAGGCGGCAGAAGATTACTTGGTTGGTTTGTTCTCAGATTCAATGCTCTGTGCTATCCATGCAAGACGTGTTACTCTAATGAGAAAAGACTTTGAACTTGCACGCCGGCTTGGAGGAAAAGGCAGACCATGGTGAAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGG
PCR amplification:
PCR reaction (50. mu.L): ddH2O31. mu.L, buffer 5. mu.L, dNTP mix 10. mu.L, forward primer 1. mu.L, reverse primer 1. mu.L, KOD 1. mu.L, Template 1. mu.L. The primer sequences are shown as SEQ ID NO.10 and SEQ ID NO. 11.
SEQ ID NO.10：cgatGGTCTCacaacatcaatgaacaagggcattgaagtgaagtatcaattccagtttg
SEQ ID NO.11：CagtGGTCTCatacaccgatctagtaacatagatgacaccgcgcgcgataatttatcct
PCR reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 50 ℃ for 45s, 72 ℃ for 150 s; 10min at 72 ℃ and 30min at 16 ℃. The PCR product of interest was detected by electrophoresis on a 1% agarose gel, and the amplified band size was 2566bp, as shown in FIG. 3 (lane 1 is the over-amplification of the first amplification product, and lane 2 is the first amplification product).
And 3, PCR product recovery and purification:
cutting off 2566bp amplified electrophoresis band, putting the cut band into the same system for sol recovery, operating the recovery program according to the kit instruction, and using ddH with the total volume of 30 mu L2The recovered DNA was O-solubilized and the recovered product was labeled CENH 3-GFPtailswap.
4. Enzyme digestion:
the recovered product and pBWA (V) K vector were digested with Eco31I, and the digested fragments were ligated. The specific enzyme digestion operation is as follows:
(1) and (3) carrying out enzyme digestion on the vector:
enzyme digestion system (20 μ L): ddH2O13. mu.L, Buffer 2. mu.L, Eco31I 1. mu.L, vector 4. mu.L.
Enzyme cutting conditions are as follows: the reaction was carried out at 37 ℃ for 1 h. Obtaining the carrier enzyme digestion product.
(2) And (3) enzyme digestion of a target fragment:
enzyme digestion system (20 μ L): ddH2O13. mu.L, Buffer 2. mu.L, Eco31I 1. mu.L, target fragment (recovered product CENH3-GFPtailswap) 4. mu.L.
Enzyme cutting conditions are as follows: the reaction was carried out at 37 ℃ for 1 h. Obtaining the target fragment enzyme digestion product.
5. Connecting:
putting the carrier enzyme digestion product and the target fragment enzyme digestion product into a system for ligation reaction, wherein the ligation product is marked as pBWA (V) K-EGFP-CENH 3.
Ligation system (10 μ L): 1 μ L vector, 3 μ L target fragment, H2O 4μL，Buffer 1μL，T4-ligase 1μL。
The connection reaction conditions are as follows: the reaction was carried out at 37 ℃ for 1 h. The ligation product pBWA (V) K-EGFP-CENH3 was obtained.
6. Transformation of the ligation products into E.coli
Coli competence was transformed with the ligation product (the transformation procedure was the same as in example 2), and 50. mu.L of the ligation product was pipetted and smeared in a medium containing Kan (100 mg.L)-1) The plate was incubated at 37 ℃ for 16 hours.
7. Detecting bacterial plaque by PCR:
10 bacterial plaques are picked and connected in a 1.5mL centrifuge tube at the same time for PCR detection, and the size of an electrophoresis strip is detected to be about 580 bp. The primer sequences of the PCR system are shown as SEQ ID NO.12 and SEQ ID NO. 13.
SEQ ID NO.12：ccatgcaagacgtgttactct
SEQ ID NO.13：gcgattaagttgggtaacgccaggg
PCR reaction (25. mu.L): ddH2O 16.5μL，buffer 2.5μL，Mg 2+2 mu L, 1 mu L dNTP, 1 mu L upstream primer, 1 mu L downstream primer, 1 mu L Taq enzyme and 1 mu L bacterial liquid.
And (3) PCR reaction conditions: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 50 ℃ for 45s, 72 ℃ for 30 s; 10min at 72 ℃ and 30min at 16 ℃.
The target PCR product was detected by 1% agarose gel electrophoresis, and the amplified band size was 580bp, as shown in FIG. 4 (lane 1 is a positive control, i.e., the PCR amplified product of the target gene in FIG. 3, and lanes 2-8 are monoclonal).
8. Enzyme digestion verification:
the extracted plasmid was digested with Eco31I and tested to verify the complementary vector pBWA (V) K-EGFP-CENH 3.
Enzyme digestion system (10 μ L): plasmid 3. mu.L, Eco31I 0.5.5. mu.L, Buffer 1. mu.L, ddH2O 5.5μL。
Enzyme cutting conditions are as follows: after digestion at 37 ℃ for 1h, electrophoresis is carried out. The results are shown in FIG. 5.
9. Sequencing and verifying: the plasmid with the correct restriction enzyme identification is further sequenced, and the result is shown as a sequence shown in SEQ ID NO. 17.
SEQ ID NO.17：
TGATGGCATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCACCATGTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTGCAGGTCTAGGCAACATCAATGAACAAGGGCATTGAAGTGAAGTATCAATTCCAGTTTGTGATATAATCAATATTCTTCAGGATTTTTTTGGTTTGGCCTAGATATATATATAGATATCTATCCTCGGTAATGACCAGTCTAAAAAGATGTACATATTGTCCCAATGGTGAAGTTTTGATGTAAGATATCTCCTGGTGGTTTGTTATTTGTAGATATTTTTGTAAACAATGTAAATGTGAATGGTTTATGATGTATAATATATAGTTCACAAAAGATGTTTCTGTAGACTTCAGATTCCACTTCTCTATTGAACAGAACCTATGATTGGATGCTGAGAACTTGTAAAGAATCTGAGGCAGAAAGTTGAAAAACTGTGTCAATTTCATTAACTTGAAAAGATGAGCATAAATTGGGAGAGAGAGAGAGAGACAAAGATTTTGAATTGAGGTTTAACGGTAAAACACACAAAACCTATTCCCCTCTGTTTCCAATTTTCATCTAAACAAACAGGTACATATTTGAATGTAATATTGTATACAGACCAGGGGTAAAACAGGAACTAAAGAAGGCTAACAATCGAGTCGAACCCTCTATGTGAAGCCACAGGTTTAGTGCAAATTGTAATAAGTTGTTCAGAGAGACTCTTGACTGAAACAAATTGTGAAGCAGATTCGATTTTAAAATCAAAATTTGAGTGTCGAGCGGGAAAGTAAAAGTTCCGCTCCAATCTTCTAATCTTTTCGTATCTAGCGGGAAATTTCTCAGCAGGTGACTTTCATAATCGCAGTTTTCGTCGATTCTCTTTTCCGATTTTACGATTCCTCTCTCTCTCTCATGGTGCGATTTCTCCAGCAGTAAAAATCAATGGCGAGAACCAAGCATCGCGTTACCAGGTCACAACCTCGGAATCAAACTGGTATCTTAAATCTGCTTTCTCTTTCAATTTTTACTTCTGATTTTACCCAGAATTTTAGGTTTTTTATTTCGATTTTGTTAACCCTAGATTTCGAATCTGAAATTTGTAGATGCCGCCGGTGCTTCATCTTCTCAGGCGGCAGGTCCAACTACGGTACGGCATCTTTTTCCGTCTTAGGGTTTCCAATGTTTCTTCCTTTTATCGTTATGATCAAATTTGTTTATCTATCGAAATTGAAGACCCCGACAAGGAGAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACAAGATGGCTCGTACGAAGCAATCCGCGAGAAAATCACACGGAGGAAAAGCTCCGACGAAGCAGCTCGCTACCAAGGCGGCAAGGAAATCTGCACCGACTACCGGAGGAGTCAAGAAACCTCACCGTTTCCGTCCAGGAACCGTTGCTCTAAAAGAGATTCGCCATTTCCAGAAGCAGACAAACCTTCTTATTCCGGCTGCCAGTTTCATAAGAGAAGTGAGAAGTATAACCCATATGTTGGCCCCTCCCCAAATCAATCGTTGGACAGCTGAAGCTCTTGTTGCTCTTCAAGAGGCGGCAGAAGATTACTTGGTTGGTTTGTTCTCAGATTCAATGCTCTGTGCTATCCATGCAAGACGTGTTACTCTAATGAGAAAAGACTTTGAACTTGCACGCCGGCTTGGAGGAAAAGGCAGACCATGGTGAAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGTGTAACGTCGCAGTCATAACTTCGTATAGCATACATTATACGAAGTTATGGGCCGCATTACCCTGTTATCCCTAGGCCGCATAACTTCGTATAGCCTACATTATAGGATGGAGGGATATCCTCTCTTAAGGTAGCGAGCAAGCTCTAAGAGGAGTGTCGACAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCC
Example 6: complementary vector pBWA (V) K-EGFP-CENH3 transformation of Agrobacterium
1. And (3) transformation:
50 μ L of Agrobacterium EHA105 competent cells were mixed with 5 μ L of pBWA (V) K-EGFP-CENH3 plasmid and transformed according to the EHA105 competent cell protocol. Sucking 100 μ L of bacterial liquid, and spreading on a layer containing 100mg-1Kan's YEB plate, 28 ℃ culture 2 d.
2. And (4) bacteria detection:
well-dispersed white single clones were selected in 10mL (Kan 100 mg.L)-1) YEB liquid medium, and cultured overnight at 28 ℃. PCR detection of bacteria liquid is carried out by using specific primers, and the upstream and downstream specific primers are shown as SEQ ID NO.14 and SEQ ID NO. 15.
SEQ ID NO.14：TATTCTTCAGGATTTTTTTGG
SEQ ID NO.15：GGTGTTCTGCTGGTAGTGGTC
PCR assay system (20. mu.L): 2xMix 10. mu.L, upstream primer 1. mu.L, downstream primer 1. mu.L, ddH2O7. mu.L, and bacterial suspension 1. mu.L.
PCR reaction procedure: 3min at 94 ℃; 94 ℃ for 1.5min, 58 ℃ for 1.5min, 72 ℃ for 1.5min, 32 cycles; preserving at 72 deg.C for 10min and 4 deg.C.
The desired PCR product was detected by 1% agarose gel electrophoresis, and the amplified band size was about 1661bp, as shown in FIG. 6 (lane 1 is the amplification product of E.coli plasmid pBWA (V) K-EGFP-CENH3, lanes 2-6 are monoclonal).
3. And (3) preserving the agrobacterium liquid:
mixing the bacterial liquid with 50% glycerol, and storing at-80 deg.C.
Example 7: transformation of sugar beet petioles by using CRISPR-Cas9/CENH3 agrobacterium
1. Preparing an explant:
the surface of the seeds is disinfected by taking the seeds of the beet 44176 as materials.
(1) Soaking the seeds in concentrated sulfuric acid for 30min, and washing with sterile water for 3-5 times;
(2) soaking the seeds in 75% alcohol for 1min, then soaking the seeds in sodium hypochlorite for 25-30 min, and washing the seeds with sterile water for 3-5 times;
(3) inoculating the seeds in 1/2MS culture medium (Coolaber product) under 26 + -2 deg.C for 16 h/d;
(4) after 2 pairs of true leaves grow out from the seeds, transferring the seeds to a subculture medium for culturing for 20-30 days. Cutting the petiole of the seedling, cutting a plurality of small knife edges by a blade, inoculating the petiole on a pre-culture medium, and culturing for 3d under the same culture conditions.
Subculture medium:
Figure BDA0003259485920000171
pre-culture medium:
Figure BDA0003259485920000172
2. agrobacterium activation
10. mu.L of the Agrobacterium strain containing the CRISPR-Cas9/CENH3 vector preserved at-80 ℃ prepared in example 4 was added to 10mL (Kan 100 mg.L)-1) In LB medium of (1), shaking-culturing at 28 ℃ for 2d, and adjusting Agrobacterium OD with MS medium6000.4 to 0.5.
3. Transforming sugar beet leaf stalks
Placing the pre-cultured petiole in Agrobacterium tumefaciens bacterial liquid, placing on a shaking bed, infecting for 20min at 28 ℃, then sucking off excessive bacterial liquid by using filter paper, inoculating the petiole on a co-culture medium, and culturing for 3d in dark at 26 +/-2 ℃.
Co-culture medium:
Figure BDA0003259485920000173
Figure BDA0003259485920000181
4. screening culture
After the petiole and agrobacterium are co-cultured for 3 days, the petiole and agrobacterium are transferred to a screening culture medium for culture, and are transferred for 1 time at intervals of 7 days and 3 times in total.
Screening a culture medium:
Figure BDA0003259485920000182
5. rooting culture
When the cluster buds appear and grow to 0.5-1 cm, cutting the cluster buds from the explant and putting the cluster buds into a rooting culture medium to induce rooting.
Rooting culture medium:
Figure BDA0003259485920000183
6. hardening off and transplanting
And opening the bottle cap to acclimatize the seedlings for 4-5 days when the root systems grow to 2-3 cm, taking the seedlings out of the culture medium, carefully washing off the culture medium on the roots, transplanting the seedlings into a flowerpot filled with the matrix, covering the flowerpot with a plastic bag for moisturizing and culturing for 7-10 days, and removing the plastic bag to enable the seedlings to gradually adapt to the external environment.
FIG. 9 shows the growth of the mutant and wild-type sugar beet strains obtained in this example.
Example 8: mutation detection
1. Extraction of genomic DNA
Genomic DNA of wild beet and the transgenic beet plants prepared in example 7 was extracted using a fully automatic nucleic acid extractor, the extraction method was performed according to the instructions of the magnetic bead method plant DNA extraction kit, and the DNA concentration was checked (50 ng.. mu.L)-1) For subsequent detection.
And 2, carrying out PCR amplification on the target fragment by using the extracted genome DNA as a template and using specific primers, wherein the upstream and downstream specific primers are shown as SEQ ID NO.7 and SEQ ID NO. 8.
SEQ ID NO.7：CGTTATTTATGAGATGGGTTTT
SEQ ID NO.8：ATACGAAGTTATGACTGCGACCGA
PCR reaction (20. mu.L): 2xMix 10. mu.L, upstream primer 1. mu.L, downstream primer 1. mu.L, ddH2O 7μL，DNA 1μL。
PCR bacterial detection program: 5min at 95 ℃; 30s at 95 ℃, 30s at 60 ℃ and 2min at 72 ℃ for 32 cycles; 10min at 72 ℃; storing at 4 ℃.
The target PCR product was detected by 1% agarose gel electrophoresis, and the amplified band size was 1250bp or so, as shown in FIG. 7 (CK)+Is a positive control, namely plasmid CRISPR-Cas9/CENH 3; CK (CK)-Negative control, i.e. non-transgenic plants; water is blank control; lanes 1-6 are transgenic plants).
3. Sequencing
Second generation sequencing is carried out by using DNA samples of partial positive plants.
4. Sequence alignment
And comparing and analyzing the second-generation sequencing result with a wild beet BvCENH3 sequence by using DNAMAN software to obtain a target site mutation plant.
FIG. 8 shows a sequence diagram of a part of the mutant and the alignment of the target region with the wild-type DNA. As can be seen from the figure, the mutant strain 1 sequence is deleted 2 bases (TC) at positions 83 and 84 as compared with the wild type sequence; the mutant strain 2 sequence has single base substitution at the 56 th position, C for A and deletion of 4 bases (TCTC) at the 81-84 th position, so that the function of the CENH3 gene is completely or partially lost, and the method lays a foundation for saving CENH3 embryo fatality through hybridization and obtaining a haploid induction line.
Example 9: complementary vector pBWA (V) K-EGFP-CENH3 Agrobacterium tumefaciens transformation of sugar beet petioles
1. The procedure from the preparation of sugar beet 44176 explant to the hardening-off and transplanting of Kan resistant plants was the same as in example 7.
FIG. 11 shows the growth of transgenic plants of the transcomplementing vector of this example with wild type sugar beet.
2. Genomic DNA extraction of transgenic and wild type sugar beet plants the same genomic DNA extraction as in example 8 was performed.
And 3, carrying out PCR amplification on the target fragment by using the extracted genome DNA as a template and using specific primers, wherein the upstream and downstream specific primers are shown as SEQ ID NO.14 and SEQ ID NO. 15.
SEQ ID NO.14：TATTCTTCAGGATTTTTTTGG
SEQ ID NO.15：GGTGTTCTGCTGGTAGTGGTC
PCR reaction (15. mu.L): 2XMix 7.5. mu.L, forward primer (10. mu. mol/L) 0.3. mu.L, reverse primer (10. mu. mol/L) 0.3. mu.L, DNA 1. mu.L, ddH2O 5.9μL。
PCR reaction procedure: 3min at 94 ℃; 94 ℃ for 1.5min, 58 ℃ for 1.5min, 72 ℃ for 1.5min, 32 cycles; preserving at 72 deg.C for 10min and 4 deg.C.
The target PCR product was detected by 1% agarose gel electrophoresis, and the amplified band size was about 1661bp, as shown in FIG. 10 (CK)+As a positive control, plasmid pBWA (V) K-EGFP-CENH 3; CK (CK)-Negative control, i.e. non-transgenic plants; water is blank control; lanes 1-5 are transgenic plants).
The invention constructs a pBWA (V) K-EGFP-CENH3 complementary vector using NPT II gene as a screening marker by the method, and transfers the vector into a beet inbred line to obtain 19 complementary plants qualified by molecular detection. In subsequent offspring obtained by positive and negative hybridization of the double-editing plant CRISPR-Cas9/CENH3 and the complementary plant GFP-tailswap, chromosomes from the GFP-tailswap plant disappear completely, and a haploid only containing another parent chromosome set is formed. The invention has important significance for saving embryo lethality of CENH3 and shortening breeding period.
Sequence listing
<110> inner Mongolia autonomous region academy of agriculture and animal husbandry
Construction method and application of beet BvCENH3 gene haploid induction line
<130> GZI21CN5671
<160> 17
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> sgRNA
<400> 1
ccacctgctt gctgctgctc ccc 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> sgRNA
<400> 2
ccgcgcagtt tgcaatcacc aca 23
<210> 3
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 3
cagtggtctc aattggggag cagcagcaag cagg 34
<210> 4
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 4
cagtggtctc aaaaccctgc ttgctgctgc tccc 34
<210> 5
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 5
cagtggtctc aattgtgtgg tgattgcaaa ctgcg 35
<210> 6
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 6
cagtggtctc aaaaccgcag tttgcaatca ccaca 35
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 7
cgttatttat gagatgggtt tt 22
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 8
atacgaagtt atgactgcga ccga 24
<210> 9
<211> 2566
<212> DNA
<213> Artificial Sequence
<220>
<223> CENH3-GFPtailswap Gene
<400> 9
atcaatgaac aagggcattg aagtgaagta tcaattccag tttgtgatat aatcaatatt 60
cttcaggatt tttttggttt ggcctagata tatatataga tatctatcct cggtaatgac 120
cagtctaaaa agatgtacat attgtcccaa tggtgaagtt ttgatgtaag atatctcctg 180
gtggtttgtt atttgtagat atttttgtaa acaatgtaaa tgtgaatggt ttatgatgta 240
taatatatag ttcacaaaag atgtttctgt agacttcaga ttccacttct ctattgaaca 300
gaacctatga ttggatgctg agaacttgta aagaatctga ggcagaaagt tgaaaaactg 360
tgtcaatttc attaacttga aaagatgagc ataaattggg agagagagag agagacaaag 420
attttgaatt gaggtttaac ggtaaaacac acaaaaccta ttcccctctg tttccaattt 480
tcatctaaac aaacaggtac atatttgaat gtaatattgt atacagacca ggggtaaaac 540
aggaactaaa gaaggctaac aatcgagtcg aaccctctat gtgaagccac aggtttagtg 600
caaattgtaa taagttgttc agagagactc ttgactgaaa caaattgtga agcagattcg 660
attttaaaat caaaatttga gtgtcgagcg ggaaagtaaa agttccgctc caatcttcta 720
atcttttcgt atctagcggg aaatttctca gcaggtgact ttcataatcg cagttttcgt 780
cgattctctt ttccgatttt acgattcctc tctctctctc atggtgcgat ttctccagca 840
gtaaaaatca atggcgagaa ccaagcatcg cgttaccagg tcacaacctc ggaatcaaac 900
tggtatctta aatctgcttt ctctttcaat ttttacttct gattttaccc agaattttag 960
gttttttatt tcgattttgt taaccctaga tttcgaatct gaaatttgta gatgccgccg 1020
gtgcttcatc ttctcaggcg gcaggtccaa ctacggtacg gcatcttttt ccgtcttagg 1080
gtttccaatg tttcttcctt ttatcgttat gatcaaattt gtttatctat cgaaattgaa 1140
gaccccgaca aggagaatgg tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat 1200
cctggtcgag ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga 1260
gggcgatgcc acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc 1320
cgtgccctgg cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta 1380
ccccgaccac atgaagcagc acgacttctt caagtccgcc atgcccgaag gctacgtcca 1440
ggagcgcacc atcttcttca aggacgacgg caactacaag acccgcgccg aggtgaagtt 1500
cgagggcgac accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg 1560
caacatcctg gggcacaagc tggagtacaa ctacaacagc cacaacgtct atatcatggc 1620
cgacaagcag aagaacggca tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg 1680
cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct 1740
gctgcccgac aaccactacc tgagcaccca gtccgccctg agcaaagacc ccaacgagaa 1800
gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc gggatcactc acggcatgga 1860
cgagctgtac aagatggctc gtacgaagca atccgcgaga aaatcacacg gaggaaaagc 1920
tccgacgaag cagctcgcta ccaaggcggc aaggaaatct gcaccgacta ccggaggagt 1980
caagaaacct caccgtttcc gtccaggaac cgttgctcta aaagagattc gccatttcca 2040
gaagcagaca aaccttctta ttccggctgc cagtttcata agagaagtga gaagtataac 2100
ccatatgttg gcccctcccc aaatcaatcg ttggacagct gaagctcttg ttgctcttca 2160
agaggcggca gaagattact tggttggttt gttctcagat tcaatgctct gtgctatcca 2220
tgcaagacgt gttactctaa tgagaaaaga ctttgaactt gcacgccggc ttggaggaaa 2280
aggcagacca tggtgaagct cgaatttccc cgatcgttca aacatttggc aataaagttt 2340
cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc tgttgaatta 2400
cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat gggtttttat 2460
gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa 2520
ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatcgg 2566
<210> 10
<211> 59
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 10
cgatggtctc acaacatcaa tgaacaaggg cattgaagtg aagtatcaat tccagtttg 59
<210> 11
<211> 59
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 11
cagtggtctc atacaccgat ctagtaacat agatgacacc gcgcgcgata atttatcct 59
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 12
ccatgcaaga cgtgttactc t 21
<210> 13
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 13
gcgattaagt tgggtaacgc caggg 25
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 14
tattcttcag gatttttttg g 21
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 15
ggtgttctgc tggtagtggt c 21
<210> 16
<211> 899
<212> DNA
<213> Artificial Sequence
<220>
<223> double target CRISPR-Cas9/CENH3 plasmid
<400> 16
acggagtctc gactgctctt cctacgacaa aaaaagcacc gactcggtgc cactttttca 60
agttgataac ggactagcct tattttaact tgctatttct agctctaaaa ccgcagtttg 120
caatcaccac acaatcacta cttcgactct agctgtatat aaactcagct tcgttttctt 180
atctaagcga tgtgggactt ttgaagattg ttttcaactt aaatgggcct atataagaaa 240
tactattgtt ctttcccata taaatgggcc tgcttctctt ctttcagatt cccaggggcc 300
ttttgaagat tatcttcata tcttaagaat gaagatgttt tattcaatca aattcttgaa 360
ggttcgatgc ctaatcattc taatcctggg acaaactatg aaacaagata caaaaactcc 420
gaatggaaag ttaaaaagaa gaaaacgaaa gctacggttc aagaaaatgt aagctgataa 480
acaaaaaaaa actgtatgaa cgaagaagaa gaaaaaaagc taagaagaaa tgatgtattg 540
tgcggaaggc aagtcgagtt tccgttgttc aacgaagctt tctacgacaa aaaaagcacc 600
gactcggtgc cactttttca agttgataac ggactagcct tattttaact tgctatttct 660
agctctaaaa ccctgcttgc tgctgctccc caatcactac ttcgactcta gctgtatata 720
aactcagctt cgttttctta tctaagcgat gtgggacttt tgaagattgt tttcaactta 780
aatgggccta tataagaaat actattgttc tttcccatat aaatgggcct gcttctcttc 840
tttcagattc ccaggggcct tttgaagatt atcttcatat cttaagaatg aagatgttt 899
<210> 17
<211> 3037
<212> DNA
<213> Artificial Sequence
<220>
<223> complementary vector pBWA (V) K-EGFP-CENH3
<400> 17
tgatggcatt tgtaggtgcc accttccttt tctactgtcc ttttgatgaa gtgacagata 60
gctgggcaat ggaatccgag gaggtttccc gatattaccc tttgttgaaa agtctcaata 120
gccctttggt cttctgagac tgtatctttg atattcttgg agtagacgag agtgtcgtgc 180
tccaccatgt tggcaagctg ctctagccaa tacgcaaacc gcctgcaggt ctaggcaaca 240
tcaatgaaca agggcattga agtgaagtat caattccagt ttgtgatata atcaatattc 300
ttcaggattt ttttggtttg gcctagatat atatatagat atctatcctc ggtaatgacc 360
agtctaaaaa gatgtacata ttgtcccaat ggtgaagttt tgatgtaaga tatctcctgg 420
tggtttgtta tttgtagata tttttgtaaa caatgtaaat gtgaatggtt tatgatgtat 480
aatatatagt tcacaaaaga tgtttctgta gacttcagat tccacttctc tattgaacag 540
aacctatgat tggatgctga gaacttgtaa agaatctgag gcagaaagtt gaaaaactgt 600
gtcaatttca ttaacttgaa aagatgagca taaattggga gagagagaga gagacaaaga 660
ttttgaattg aggtttaacg gtaaaacaca caaaacctat tcccctctgt ttccaatttt 720
catctaaaca aacaggtaca tatttgaatg taatattgta tacagaccag gggtaaaaca 780
ggaactaaag aaggctaaca atcgagtcga accctctatg tgaagccaca ggtttagtgc 840
aaattgtaat aagttgttca gagagactct tgactgaaac aaattgtgaa gcagattcga 900
ttttaaaatc aaaatttgag tgtcgagcgg gaaagtaaaa gttccgctcc aatcttctaa 960
tcttttcgta tctagcggga aatttctcag caggtgactt tcataatcgc agttttcgtc 1020
gattctcttt tccgatttta cgattcctct ctctctctca tggtgcgatt tctccagcag 1080
taaaaatcaa tggcgagaac caagcatcgc gttaccaggt cacaacctcg gaatcaaact 1140
ggtatcttaa atctgctttc tctttcaatt tttacttctg attttaccca gaattttagg 1200
ttttttattt cgattttgtt aaccctagat ttcgaatctg aaatttgtag atgccgccgg 1260
tgcttcatct tctcaggcgg caggtccaac tacggtacgg catctttttc cgtcttaggg 1320
tttccaatgt ttcttccttt tatcgttatg atcaaatttg tttatctatc gaaattgaag 1380
accccgacaa ggagaatggt gagcaagggc gaggagctgt tcaccggggt ggtgcccatc 1440
ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgtccgg cgagggcgag 1500
ggcgatgcca cctacggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc 1560
gtgccctggc ccaccctcgt gaccaccctg acctacggcg tgcagtgctt cagccgctac 1620
cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacgtccag 1680
gagcgcacca tcttcttcaa ggacgacggc aactacaaga cccgcgccga ggtgaagttc 1740
gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc 1800
aacatcctgg ggcacaagct ggagtacaac tacaacagcc acaacgtcta tatcatggcc 1860
gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat cgaggacggc 1920
agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg ccccgtgctg 1980
ctgcccgaca accactacct gagcacccag tccgccctga gcaaagaccc caacgagaag 2040
cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactca cggcatggac 2100
gagctgtaca agatggctcg tacgaagcaa tccgcgagaa aatcacacgg aggaaaagct 2160
ccgacgaagc agctcgctac caaggcggca aggaaatctg caccgactac cggaggagtc 2220
aagaaacctc accgtttccg tccaggaacc gttgctctaa aagagattcg ccatttccag 2280
aagcagacaa accttcttat tccggctgcc agtttcataa gagaagtgag aagtataacc 2340
catatgttgg cccctcccca aatcaatcgt tggacagctg aagctcttgt tgctcttcaa 2400
gaggcggcag aagattactt ggttggtttg ttctcagatt caatgctctg tgctatccat 2460
gcaagacgtg ttactctaat gagaaaagac tttgaacttg cacgccggct tggaggaaaa 2520
ggcagaccat ggtgaagctc gaatttcccc gatcgttcaa acatttggca ataaagtttc 2580
ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac 2640
gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg 2700
attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac 2760
taggataaat tatcgcgcgc ggtgtcatct atgttactag atcggtgtaa cgtcgcagtc 2820
ataacttcgt atagcataca ttatacgaag ttatgggccg cattaccctg ttatccctag 2880
gccgcataac ttcgtatagc ctacattata ggatggaggg atatcctctc ttaaggtagc 2940
gagcaagctc taagaggagt gtcgacaagc ttggcactgg ccgtcgtttt acaacgtcgt 3000
gactgggaaa accctggcgt tacccaactt aatcgcc 3037

Claims (11)

1. A method for constructing a beet BvCENH3 gene haploid inducer line, which comprises the following steps:
transforming beet petioles by agrobacterium tumefaciens containing a beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector to prepare a beet plant with CENH3 gene mutation;
the sugar beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector is a CRISPR-Cas9 vector containing two sgRNAs targeting sugar beet CENH3 genes.
2. The method of claim 1, wherein the two sgrnas targeting the sugar beet CENH3 gene have the following nucleotide sequences, respectively:
sgRNA 1: the nucleotide sequence shown in SEQ ID NO.1 or the sequence consisting of 4 th to 23 th nucleotides of SEQ ID NO. 1;
sgRNA 2: the nucleotide sequence shown in SEQ ID NO.2, or the sequence consisting of the 4 th to 23 th nucleotides of SEQ ID NO. 2.
3. The method of claim 1, further comprising a process of preparing agrobacterium containing the sugar beet BvCENH3 gene dual target CRISPR/Cas9 editing vector:
and (3) transforming agrobacterium with the beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector to prepare the agrobacterium containing the beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector.
4. The method according to claim 1 or 3, further comprising a process for preparing a sugar beet BvCENH3 gene dual target CRISPR/Cas9 editing vector:
connecting two sgRNAs targeting a beet CENH3 gene to CRISPR-Cas9 with kanamycin resistance to prepare a beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector;
preferably, the process for preparing the beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector comprises the following steps:
connecting two sgRNAs targeting a beet CENH3 gene to a CRISPR-Cas9 and another empty vector respectively to obtain two ligation products, wherein each ligation product contains one sgRNA; preferably, the further empty vector is pbwd (lb) dnai (at);
and (3) respectively carrying out enzyme digestion on the two ligation products by using Lgu I, and carrying out enzyme digestion on the products by using T4 ligase to construct a beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector.
5. The method of claim 1, further comprising:
carrying out positive and negative hybridization on the beet plant with CENH3 gene mutation and a complementary plant to form beet BvCENH3 gene haploid;
wherein the complementary plant is a beet plant containing a pBWA (V) K-EGFP-CENH3 complementary vector using NPT II gene as a screening marker.
6. The method of claim 5, further comprising the process of preparing a complementary plant:
transforming beet petiole with Agrobacterium containing complementary vector pBWA (V) K-EGFP-CENH3 to prepare complementary plant;
wherein, the agrobacterium containing the complementary vector pBWA (V) K-EGFP-CENH3 is prepared by transforming agrobacterium with the complementary vector pBWA (V) K-EGFP-CENH 3;
preferably, the complementary vector pBWA (V) K-EGFP-CENH3 is pBWA (V) K vector linked to CENH3-GFPtailswap gene;
more preferably, the CENH3-GFPtailswap gene has the nucleotide sequence shown in SEQ ID NO. 9.
7. An sgRNA, comprising:
sgRNA having the nucleotide sequence shown in SEQ ID NO.1 or the sequence consisting of the 4 th to 23 th nucleotides of SEQ ID NO. 1; and/or
sgRNA having the nucleotide sequence shown in SEQ ID NO.2 or the sequence consisting of the 4 th to 23 th nucleotides of SEQ ID NO. 2.
8. An intermediate vector containing the nucleotide sequence of the sgRNA of claim 7;
the intermediate carrier includes:
a sugar beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector, and/or
Agrobacterium containing the sugar beet BvCENH3 gene dual-target CRISPR/Cas9 editing vector.
9. A complementary intermediate vector, comprising:
pBWA (V) K-EGFP-CENH3 complementary vector using NPT II gene as selection marker, and/or
Agrobacterium comprising the pBWA (V) K-EGFP-CENH3 complementation vector.
10. Use of the sgRNA of claim 7, the intermediate vector of claim 8, and/or the complementary intermediate vector of claim 9 for the construction of a sugar beet BvCENH3 gene haploid inducer line.
11. A primer for detecting a transformation vector in a haploid induction line for constructing a beet BvCENH3 gene, wherein the primer comprises the following primer pairs with the sequences as shown in the specification:
SEQ ID NO.7 and SEQ ID NO. 8; and/or
SEQ ID NO.12 and SEQ ID NO. 13.
CN202111069180.5A 2021-09-13 2021-09-13 Construction method and application of beet BvCENH3 gene haploid induction line Active CN113801891B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111069180.5A CN113801891B (en) 2021-09-13 2021-09-13 Construction method and application of beet BvCENH3 gene haploid induction line

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111069180.5A CN113801891B (en) 2021-09-13 2021-09-13 Construction method and application of beet BvCENH3 gene haploid induction line

Publications (2)

Publication Number Publication Date
CN113801891A true CN113801891A (en) 2021-12-17
CN113801891B CN113801891B (en) 2023-06-09

Family

ID=78940900

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111069180.5A Active CN113801891B (en) 2021-09-13 2021-09-13 Construction method and application of beet BvCENH3 gene haploid induction line

Country Status (1)

Country Link
CN (1) CN113801891B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114854786A (en) * 2022-02-22 2022-08-05 沈阳农业大学 Method for improving corn haploid induction line induction rate by modifying CENH3 protein through genetic engineering
CN116463348A (en) * 2023-05-26 2023-07-21 中国农业科学院作物科学研究所 Sg RNA for editing corn ZmCENH3 gene by using CRISPR/Cas9 system and application thereof
CN116491415A (en) * 2023-03-07 2023-07-28 海南大学三亚南繁研究院 Method for improving CENH 3-mediated maternal haploid induction efficiency by optimizing temperature

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107205354A (en) * 2014-12-23 2017-09-26 Kws种子欧洲股份公司 Haploid induction thing
CN112725374A (en) * 2019-10-29 2021-04-30 中国种子集团有限公司 Method for creating plant haploid induction line and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107205354A (en) * 2014-12-23 2017-09-26 Kws种子欧洲股份公司 Haploid induction thing
CN112725374A (en) * 2019-10-29 2021-04-30 中国种子集团有限公司 Method for creating plant haploid induction line and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
RAHELEH KARIMI-ASHTIYANIA等人: "Point mutation impairs centromeric CENH3 loading and induces haploid plants", 《PNAS》 *
XM_010696392.2: "PREDICTED: Beta vulgaris subsp. vulgaris histone H3(LOC104907459),mRNA", 《GENBANK》 *
李燕 主编: "《精编分子生物学实验技术》", 30 September 2017 *
段民孝 等人: "CENH3介导的单倍体诱导技术研究进展", 《分子植物育种》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114854786A (en) * 2022-02-22 2022-08-05 沈阳农业大学 Method for improving corn haploid induction line induction rate by modifying CENH3 protein through genetic engineering
CN114854786B (en) * 2022-02-22 2024-05-28 沈阳农业大学 Method for improving corn haploid induction line induction rate through genetic engineering modification of CENH3 protein
CN116491415A (en) * 2023-03-07 2023-07-28 海南大学三亚南繁研究院 Method for improving CENH 3-mediated maternal haploid induction efficiency by optimizing temperature
CN116491415B (en) * 2023-03-07 2024-05-28 海南大学三亚南繁研究院 Method for improving CENH 3-mediated maternal haploid induction efficiency by optimizing temperature
CN116463348A (en) * 2023-05-26 2023-07-21 中国农业科学院作物科学研究所 Sg RNA for editing corn ZmCENH3 gene by using CRISPR/Cas9 system and application thereof
CN116463348B (en) * 2023-05-26 2024-05-14 中国农业科学院作物科学研究所 Sg RNA for editing corn ZmCENH gene by using CRISPR/Cas9 system and application thereof

Also Published As

Publication number Publication date
CN113801891B (en) 2023-06-09

Similar Documents

Publication Publication Date Title
CN106957855B (en) Method for targeted knockout of rice dwarf gene SD1 by using CRISPR/Cas9 technology
US9756871B2 (en) TAL-mediated transfer DNA insertion
WO2020007331A1 (en) Method for site-specific mutagenesis of medicago sativa gene by using crispr/cas9 system
CN113801891B (en) Construction method and application of beet BvCENH3 gene haploid induction line
US20140363561A1 (en) Tal-mediated transfer dna insertion
AU2019297209B2 (en) Method of obtaining multi-leaf alfalfa material by means of MsPALM1 artificial site-directed mutant
CN110317828B (en) Method for cultivating broad-spectrum bacterial leaf blight resistant rice by modifying rice OsSWEET gene promoter
CN109234310B (en) Recombinant vector for rapidly obtaining transgenic gene-free edited plant and use method thereof
CN108034671B (en) Plasmid vector and method for establishing plant population by using same
US11365423B2 (en) Method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants
CN112322631B (en) Cultivation method of glyphosate-resistant transgenic soybean
CN107058317B (en) Pollen specific promoter and application thereof
CN113493803B (en) Alfalfa CRISPR/Cas9 genome editing system and application thereof
CN112430684B (en) Nucleic acid sequence for detecting rice plant H23 and detection method thereof
CN106047878B (en) Rice root specific expression promoter POsr1 and application thereof
CN114181965A (en) Nucleic acid molecule, vector, cell and primer, application thereof and plant high-purity clone seed sorting method based on dual regulation
CN105734077B (en) Expression vector and application thereof in preparation of transgenic plants
CN116926109B (en) Plant programmed pollen self-cleaning CRISPR/Cas gene editing method
CN114763555B (en) Method and reagent for realizing high-yield and high-quality breeding by utilizing gene editing
CN107142262B (en) Rice seed specific promoter Posseed and application thereof
CN112646827A (en) Rice multi-antibody fusion gene and application thereof
CN106893723B (en) Plant bidirectional promoter and application thereof
CN117384919A (en) NtERF283 gene, protein coded by same and application thereof
CN116751808A (en) Method for regulating and controlling flowering and maturation time of plant, biological material and application thereof
CN111793626A (en) Oligo DNA group of sgRNA of two site-directed knockout rice OsMAP65-3.1 genes

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Wu Xinrong

Inventor after: Zhang Bizhou

Inventor after: Liang Yahui

Inventor after: Han Pingan

Inventor after: Sun Ruifen

Inventor after: Li Xiaodong

Inventor after: Bai Chen

Inventor after: Tang Kuangang

Inventor after: Chang Yue

Inventor after: Zhang Ziqiang

Inventor after: Wang Liang

Inventor before: Wu Xinrong

Inventor before: Zhang Bizhou

Inventor before: Liang Yahui

Inventor before: Bai Chen

Inventor before: Sun Ruifen

Inventor before: Li Xiaodong

Inventor before: Han Pingan

Inventor before: Tang Kuangang

Inventor before: Chang Yue

Inventor before: Zhang Ziqiang

Inventor before: Wang Liang

GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20240410

Address after: Room 215, No. 30 Guangzhong South Road, Guangchen Town, Pinghu City, Jiaxing City, Zhejiang Province, 314207

Patentee after: Jiaxing Qinghao Agricultural Technology Co.,Ltd.

Country or region after: China

Address before: 010030 No.22 Zhaojun Road, Yuquan District, Hohhot City, Inner Mongolia Autonomous Region

Patentee before: INNER MONGOLIA ACADEMY OF AGRICULTURAL & ANIMAL HUSBANDRY SCIENCES

Country or region before: China