CN112322631B - Cultivation method of glyphosate-resistant transgenic soybean - Google Patents

Abstract

The invention provides a method for cultivating glyphosate-resistant transgenic soybeans, and relates to the field of plant cultivation by using genetic engineering. In the cultivation method, a vector pTWGM1 containing a target gene I.variabilis-EPSPS gene is constructed, an agrobacterium strain containing an expression vector pTWGM1 and a soybean cotyledon node explant are subjected to infection and co-culture, a cluster bud is induced by screening of glyphosate, and when the induced bud is extended to about 3cm, a transgenic T0 generation seedling is obtained by rooting culture. During the growth of T0 generation plants, single copy plants were harvested by screening positive plants and identifying the copy number of the positive plants by Southern blot. And (3) at the T1 generation, planting transgenic plants in families, spraying glyphosate through field observation, and selecting the transgenic families with good glyphosate tolerance and no obvious change in agronomic characters. The transgenic soybean exogenous gene obtained by the method can be stably inherited in the progeny thereof, has glyphosate herbicide tolerance, can reduce the labor cost in production management, and improves the planting benefit.

Description

Cultivation method of glyphosate-resistant transgenic soybean

[ technical field ] A method for producing a semiconductor device

The invention relates to the technical field of plant genetic engineering, in particular to a method for cultivating glyphosate-resistant transgenic soybeans.

[ background of the invention ]

Soybean (Glycine max (L.). Merr) originates from china, is an important oil and commercial crop in the world, and is also a major source of edible vegetable oil and vegetable protein. As an important component in the agricultural ecosystem, the weeds can compete with crops for resources such as light, water, nutrients and the like, so that the yield of the crops is reduced. Therefore, the effective control of weeds in soybean fields is one of the key factors for stable yield and high yield of soybeans. Traditional manual weeding comprises manual weeding, weeding with simple farm implements and the like, is time-consuming and labor-consuming, has low efficacy and cannot prevent and remove weeds in a large area in time. The use of chemical herbicides greatly improves the control efficiency of farmland weeds, but the traditional herbicides such as chlorimuron-ethyl, metsulfuron-methyl and the like are seriously remained in soil and pollute the environment, thereby limiting the application range of the herbicides.

Glyphosate (Glyphosate) is a systemic conduction type broad-spectrum biocidal herbicide, has the advantages of wide herbicidal spectrum, high efficiency, low toxicity, no residue and the like, is particularly low in toxicity to people and livestock, and is one of the broadest herbicides in the global application range. However, as a non-selective herbicide, glyphosate also damages soybeans while killing weeds, so that the glyphosate-resistant transgenic crops are cultivated by a transgenic technology, the glyphosate-resistant characteristic is endowed to the crops, and the glyphosate-resistant transgenic crops are one of important ways for protecting the crops from being damaged by the glyphosate and improving the comprehensive control efficiency of the weeds. Existing research and commercial development history of transgenic crops prove that the tolerance of soybean to glyphosate herbicide is a useful character for weed control and management.

To confer glyphosate tolerance to crop plants, researchers have focused on introducing into plants genes that increase glyphosate tolerance, such as EPSPS, which are typically derived from microorganisms that encode enzymes with structural properties that do not allow glyphosate to bind to them, and thus retain their catalytic activity in the presence of glyphosate (PCT/CN 03/00651). Currently, the vast majority of glyphosate resistant transgenic crops grown commercially worldwide are designed for EPSPS.

N-acetyltransferase (GAT) is able to cause efficient degradation of glyphosate by N-acetylation in plant tissues, thereby losing herbicidal activity, and acetylated glyphosate is unable to bind effectively to EPSPS in plants, thereby conferring tolerance to glyphosate in plants (ZL 200510086626. X). In addition, due to the degradation of glyphosate, the transgenic crop cultivated by the N-acetylation method can be applied with glyphosate in the whole growth cycle of the plant and is not limited by the growth and development stage.

At present, researches on introduction of glyphosate-resistant genes into soybeans are wide, but the insertion of different sites can affect the functions of other genes of the soybeans, so that the insertion of different sites is realized by combining the synthesis of the glyphosate-resistant genes, and the requirements that exogenous genes can be stably inherited in the offspring and have glyphosate herbicide tolerance are met, so that the labor cost in production management is reduced, and the planting benefit is improved.

[ summary of the invention ]

Based on the defects of the prior art, the invention provides a culture method of glyphosate-resistant transgenic soybeans, which obtains the transgenic soybeans which meet the requirements that exogenous genes can be stably inherited in the offspring and have glyphosate herbicide tolerance by optimizing exogenous gene vectors and inserting the exogenous gene vectors into different sites.

In view of the above, the present invention provides a method for breeding glyphosate-resistant transgenic soybean, wherein an exogenous gene DNA fragment is inserted into chromosome 19 of soybean genome No. 1 tianlong to obtain transgenic soybean, and the left boundary flanking sequence of the insertion site is as shown in SEQ ID NO: 1, the right border flanking sequence of the insertion site is shown as SEQ ID NO: 2 is shown in the specification; the exogenous gene DNA fragment comprises a glyphosate resistance gene.

Further, the nucleotide sequence of the exogenous gene DNA fragment is shown as SEQ ID NO: 3, respectively.

Furthermore, the exogenous gene DNA fragment is obtained by constructing a plant expression vector by using a glyphosate-resistant gene I.variabilis-mEPSPS.

Further, the exogenous DNA fragment insertion process is to introduce the exogenous DNA fragment into the target soybean receptor by an agrobacterium-mediated genetic transformation method.

The invention also aims to provide a method for detecting the exogenous gene of the transgenic soybean obtained by the cultivation method, which comprises the steps of using the GmCYP2 gene as an internal reference gene, designing primers GmCYP2-RTF and GmCYP2-RTR for quality detection, and designing primers IVA-EPSPs-RTF and IVA-EPSPs-RTR for exogenous gene expression quantity detection; the nucleotide sequences of the primers GmCYP2-RTF and GmCYP2-RTR are shown in SEQ ID NO: 4-5; the nucleotide sequences of the designed primers IVA-EPSPs-RTF and IVA-EPSPs-RTR are shown in SEQ ID NO: 6-7.

The invention also aims to provide an analysis method of the exogenous gene locus of the transgenic soybean obtained by the cultivation method, which comprises the steps of carrying out two rounds of PCR analysis by using a reverse PCR method, and then carrying out locus verification to obtain a flanking sequence, wherein the nucleotide sequence of a primer of the first round of PCR is shown as SEQ ID NO: 8-9; primers for the second round of PCR are shown in SEQ ID NO: 10-11.

According to one embodiment provided herein, the site verification uses primers GM1-V1F and GM17-gLBR for left boundary flanking sequence verification, and GM1-V2F and GM 17-gBR for right boundary flanking sequence verification; the nucleotide sequences of the primers GM1-V1F and GM17-gLBR are shown in SEQ ID NO: 12-13; the nucleotide sequences of the primers GM1-V2F and GM 17-gBR are shown in SEQ ID NO: 14-15.

According to one embodiment of the present invention, the verification result of the left border flanking sequence has a specific band at 520bp, and the verification result of the right border flanking sequence has a specific band at 592 bp.

Compared with the prior art, the invention has the beneficial effects that:

1) the invention introduces the artificially synthesized glyphosate-resistant gene I.variabilis-EPSPS into the genome of the soybean receptor variety Tianlong No. 1, and the exogenous gene can be stably inherited in the descendant and has glyphosate herbicide tolerance, thereby reducing the labor cost in production management and improving the planting benefit.

2) The position of the glyphosate-resistant gene I.variabilis-EPSPS in the soybean genome is different from any other glyphosate-resistant soybean containing similar genes, and the insertion site of the exogenous gene in the soybean genome does not influence the function of other genes of the soybean.

3) The glyphosate-resistant transgenic soybean material can introduce glyphosate-resistant genes into other soybean varieties through conventional breeding modes such as hybridization, backcross and the like, and further culture new glyphosate-resistant herbicide transgenic strains or new varieties.

[ description of the drawings ]

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a map of a pCAMBIA1300 vector.

FIG. 2 is a map of the plant expression vector pTWGM1 of the present invention.

FIG. 3 shows the results of RT-PCR assay of IVA-EPSPs in pTWGM 1-7.

FIG. 4 shows the comparison of the resistance performance of the transgenic homozygous lines to glyphosate.

FIG. 5 shows the verification results of the flanking sequences at the left and right borders of pTWGM 1-7.

FIG. 6 shows the sequence alignment of the left border flanking sequence NCBI of pTWGM 1-7.

FIG. 7 shows the sequence alignment of the right border flanking sequence NCBI of pTWGM 1-7.

[ detailed description ] embodiments

The following examples are intended to illustrate the invention without limiting its scope. It is intended that all modifications or alterations to the methods, procedures or conditions of the present invention be made without departing from the spirit and substance of the invention.

The invention relates to a method for cultivating glyphosate-resistant transgenic soybean, which inserts an exogenous DNA fragment into a target soybean genome, and obtains a glyphosate-resistant plant pTWGM1-7 by screening a single-copy plant homozygous strain. Through the detection of the exogenous gene and the analysis and verification of the left and right flanking sequences of the insertion site, the insertion site of the exogenous gene of the genome is chromosome 19, a 55bp base sequence is replaced, and after the exogenous gene is planted by offspring, the exogenous gene shows excellent glyphosate resistance and grows normally.

According to a common technical means, the glyphosate-resistant transgenic soybean material cultured by the invention can introduce glyphosate-resistant genes into other soybean varieties through conventional breeding modes such as hybridization, backcross and the like, and further culture new glyphosate-resistant herbicide transgenic strains or new varieties.

The exogenous gene used in the invention is I.variabilis-EPSPS, which is synthesized and obtained by professor Liuzi bell and Lincux of Huazhong university of agriculture (patent application No. 201610317483.7; Lincuu, Traunt, Liuzi bell: a modified glyphosate-resistant gene and a cultivation method of glyphosate-resistant rice, publication No. CN 107129993A). The varilabilis-EPSPS gene was found by sequence alignment from a newly discovered actinomycete (Isoptericola varilabis) to have a sequence encoding a protein similar to type I EPSPS, and expression in e.coli (e.coli) found to have very high resistance to glyphosate with enzymatic properties similar to type I EPSPS, which is likely to be a novel type of glyphosate resistant. The similarity of the gene sequence of the variabilis-EPSPS to the representative gene of the EPSPSs of the type I is 35 percent from E.coli, the similarity of the gene sequence of the EPSPSs of the type II to the sequences of Agrobacterium tumefaciens (A.tumefaciens) CP4 and Staphylococcus aureus (S.aureus) is 29 percent and 26 percent respectively, and the applicant classifies the i.variabilis-EPSPS as the EPSPS gene of the type I by the amino acid multiple sequence alignment and evolutionary analysis of the two types of EPSPS genes, but belongs to a new branch. The original length of the variabilis-EPSPS gene was 1374bp, encoding 458 amino acids. Optimization was performed by using codon optimization software according to codon preference. The complete gene sequence is shown in the related invention patent.

Example 1 construction of plant expression vectors

The construction process of the transformation vector of the invention is as follows: the hpt gene in the pCAMBIA1300 vector is removed by XhoI enzyme digestion, and then a UTR-CTP-EPSPs fragment carrying XhoI cohesive ends at two ends is connected with the vector from which the hpt gene is removed, so as to obtain a final expression vector pTWGM1 (the map is shown in figure 2). The EPSPs gene has a full length of 1374bp, and a 100bp UTR sequence and a 228bp chloroplast localization signal peptide CTP are added at the 5' end of the EPSPs gene. The final plant expression vector pTWGM1 plasmid has the nucleotide sequence shown in SEQ ID NO: 1, introducing the strain into Escherichia coli DH5 alpha in an electric transformation mode, introducing the strain into an agrobacterium strain EHA105 to form a transformed engineering strain after sequencing verification, and freezing and storing the transformed engineering strain at a temperature of 80 ℃ below zero for later use.

Example 2 Agrobacterium-mediated genetic transformation of Soybean

2.1 Soybean seed chlorine Disinfection

Selecting full and non-speckled soybean seeds with intact seed coats, sterilizing the seeds for 3h in a fume hood by using chlorine generated by the reaction of hydrochloric acid and sodium hypochlorite, then putting the seeds into a sterile operating platform for ventilation for 30min, and then fully soaking the seeds in sterile water overnight.

2.2 seed soaking overnight

Selecting sterilized soybean seeds, and fully soaking the soybean seeds in sterile water overnight.

2.3 isolation of explants

The overnight soaked soybean seeds were bisected along the direction of embryo growth, the seed coat was discarded, a part of terminal bud was excised and a wound was vertically scribed along the cotyledon axis direction near the cotyledonary node, whereby two cotyledonary node explants for genetic transformation were obtained per sterile soybean seed.

2.4 cultivation of Agrobacterium

50. mu.l of the preserved Agrobacterium were inoculated into 50ml of LB medium (10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride, pH 7.0) containing 50mg/L kanamycin, and cultured for 2 days in a shaker (28 ℃, 200rpm) to activate the Agrobacterium.

2.5 Agrobacterium Dip-staining

And (3) centrifugally collecting the activated agrobacterium tumefaciens bacterial liquid, then re-suspending the bacterial liquid with a CCM liquid culture medium until the OD is approximately equal to 0.6, then placing the prepared explant into the re-suspended staining solution, and shaking the explant for 30min by a constant-temperature shaking table at 28 ℃ and 200 rpm.

2.6 Co-cultivation

The immersed explant is placed on a CCM solid culture medium paved with sterile filter paper with the paraxial wound facing downwards, and is cultured in the dark for 3d at 28 ℃.

2.7 washing with water to remove bacteria, and inducing culture by transferring SIM

And washing the explants cultured in the dark for 3 days with sterile water for three times, washing the explants with SIM liquid culture medium for three times, cutting off the terminal bud of each explant, inserting the obtained new explants into the SIM solid bud induction culture medium containing a screening agent with a certain concentration, and culturing for 2 weeks at 28 ℃ under 16h/8h illumination.

2.8 resistant Cluster bud subculture

The resistant clumpy bud tissue was transferred to new SIM containing a concentration of the selection agent for about 2 weeks, and then the medium was changed and subcultured 1 time.

2.9 transformation of resistant clumpy buds into SEM Medium for elongation culture

Cutting off black tissues at the base parts of the resistant cluster buds, transferring the cut-off resistant cluster bud tissues into SEM solid culture medium containing a screening agent with a certain concentration, and culturing for 4 weeks at 28 ℃ for 16h/8h under illumination.

2.10 elongation bud subculture

And (3) cutting off white, yellow or black parts of the resistant cluster bud masses and black tissues at the base parts, transferring the green tissues of the broken-down cluster buds into a new SEM containing a screening agent with a certain concentration for culturing for 4 weeks again, and then replacing the culture medium for subculturing for 1 time.

2.11 transformation of the extended bud into RM rooting

When the soybean regeneration seedlings are cultured to be 3-4 cm high, the soybean seedlings are cut off from the basal part and transferred to an RM culture medium for rooting.

2.12 preparation of culture Medium

1) Coculture medium CCM (1L):

0.321g of B5 powder, 3.9g of MES, 9ml of 100 XB 5 organic matter, 7g of agar, 30g of cane sugar, 1ml of DTT and Na ₂ S ₂ O ₃ 1ml, 6-BA 1.67ml, AS 2ml, L-cys 4ml and GA 3100. mu.l.

2) Shoot induction medium SIM (1L):

3.21g of B5 powder, 0.59g of MES, 8g of agar, 30g of cane sugar, 1ml of timentin, 1120 ul of 6-BA, 400 ul of cefamycin and a screening agent (glyphosate) with a certain concentration.

3) Shoot elongation medium SEM (1L):

4.43g of MS powder, 0.59g of MES, 8g of agar, 30g of sucrose, 1ml of Glu, 1ml of Asp, 1ml of ZR, 1ml of timentin, 3600 ul of GA, 400 ul of cefamycin, 100 ul of IAA and a screening agent (glyphosate) with a certain concentration.

4) Rooting medium RM (1L):

2.215g of MS powder, 0.59g of MES, 9ml of 100 XB 5 organic, 8g of agar, 20g of cane sugar, 1ml of timentin, 1ml of Glu, 1ml of Asp, 1ml of IBA and 400 mu l of cefuroxime.

Example 3 PCR Positive detection of transgenic regenerated plants

Total DNA from soybean leaves was extracted by CTAB method (see Murry & Thompson, 1980). The design of PCR primers was done using Primer Premier 5 software. The two primers used for i.variabilis-EPSPs gene (abbreviated IVA-EPSPs in the following) amplification were:

IVA-EPSPsF: 5'-ATTAGCGCTAGGGACGTGAG-3', and

IVA-EPSPsR：5’-ATACGCTCCCACATCCTGTC-3’。

the PCR product size was 593 bp. And (3) PCR reaction system: 20ng template DNA, 2. mu.l 10 XPCR buffer, 0.3. mu.l dNTP (10mM), 0.3. mu.l IVA-EPSPsF primer (10. mu.M), 0.3. mu.l IVA-EPSPsR primer (10. mu.M), 1U rTaq, complement ddH ₂ O to 20. mu.l. PCR reaction procedure: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 30 s; repeat 32 cycles; 72 ℃ for 5 min; 25 ℃ for 2 min. The amplification products were detected by electrophoresis on a 0.8% agarose gel. For all T ₀ Carrying out PCR positive detection on the regeneration plants, and detecting T in total ₀ And 40 transformed plants are generated, wherein 29 transformed plants are IVA-EPSPS positive plants.

Example 4 copy number detection of exogenous genes in transgenic plants

And (3) carrying out copy number detection on all PCR detection positive plants by using a Southern blot technology. Total DNA from soybean plant leaves was extracted by CTAB method (see Murry)&Thompson, 1980), the Southern blot was examined for specific protocols in the application manual for the digoxin labeling protocol from Roche. The total DNA was digested with HindIII or SacI, the PCR fragment of the IVA-EPSPS gene was used as a hybridization probe, and hybridization was detected after labeling with digoxin. Based on the Southern blot results, 3T ₀ The generation transgenic family is a single-copy transgenic family.

Example 5 Single copy plant homozygous lines Screen

Planting T in field by using 3 single-copy soybean transgenic families ₁ Generation, collecting seeds by individual plants, then selecting 60 seeds from each individual plant and planting T ₂ Generation, pair T ₂ And spraying glyphosate on the plants in the seedling-replacing period. Judging whether the corresponding T1 generation plants are homozygous lines according to the proportion of the progeny plants showing resistance expression to the glyphosate: 100% of the progeny of the homozygous line shows resistance to glyphosate, 75% of the progeny of the heterozygous line shows resistance to glyphosate, and all the progeny of the negative line shows sensitivity to glyphosate (all the progeny die after spraying glyphosate). Through screening of homozygous lines, the pTWGM1-7 single-copy family line shows higher resistance level to glyphosate.

Example 6: RT-PCR expression quantity detection of exogenous genes in homozygous lines

Total RNA in soybean leaves was extracted using a whole gold Transzol reagent, and the detailed experimental procedures were referred to the description thereof. Reverse transcription of RNA employs the following steps:

1) mu.g of RNA was taken and 1. mu.l of DNaseI Buffer (with Mg) ²⁺ Thermo), 1. mu.l DNaseI, water to 10. mu.l, 37 ℃, 30 min;

2) adding 1 μ l 50mM EDTA, mixing, and denaturing at 65 deg.C for 10 min;

3) mu.l dNTPs (10mM) and 1. mu.l oligo (dT) were added ₁₅ (50. mu.M), mixing, denaturing at 65 deg.C for 5min, and rapidly ice-cooling for 5 min;

4) slightly centrifuged, and 5. mu.l of 5 XFirst-strand Buffer, 2. mu.l of 0.1M DTT, 1. mu.l of RNaseOUT were added ^TM Recombinant ribonuclear Inhibitor (40U/. mu.l) and 1. mu. l M-MLV reverse transcriptase, 2. mu.l DEPC water, mix well and incubate at 37 ℃ for 50 min;

5) after inactivation at 70 ℃ for 15min, the reverse transcription reaction was terminated, and the obtained cDNA was added with DEPC water to 100. mu.l for further use.

The GmCYP2 gene is used as an internal reference gene, primers GmCYP2-RTF and GmCYP2-RTR are designed to carry out quality detection on cDNA, and primers IVA-EPSPs-RTF and IVA-EPSPs-RTR are designed to detect the expression quantity of the exogenous gene. And (3) PCR reaction system: mu.l cDNA, 2. mu.l 10 XPCR buffer, 0.3. mu.l dNTP (10mM), 0.3. mu. l F primer (10. mu.M), 0.3. mu. l R primer (10. mu.M), 1U rTaq, complementary ddH ₂ O to 20. mu.l. PCR reaction procedure: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 30 s; repeat 30 cycles; 72 ℃ for 5 min; 25 ℃ for 2 min. The results of RT-PCR detection of IVA-EPSPs in pTWGM1-7 are shown in FIG. 3 (N: Tianlong No. 1 control; 1: pTWGM1-7 homozygous strain), and the foreign gene EPSPs were expressed at high levels in the transformant pTWGM 1-7.

Table 1: RT-PCR detection primer

Example 7: detection of glyphosate resistance of transgenic homozygous lines in field

Progeny of the pTWGM1-7 homozygous line were grown in the field, and recipient variety Tianlong No. 1 was used as a control. After 6 weeks, 4-fold glyphosate concentration (3600g/ha, corresponding to 3600mg/L) of the production dose is used for spraying treatment on the transgenic homozygous plant line and the control material, after 2 weeks of glyphosate treatment, the transgenic plant line grows normally, but the control material Tianlong No. 1 shows sensitivity, as shown in FIG. 4, CK is the control material Tianlong No. 1.

Example 8: pTWGM1-7 insertion site analysis

The insertion site of pTWGM1-7 was analyzed using the inverse PCR method. Mu.g of genomic DNA was digested with HindIII or SacI, inactivated at 75 ℃ for 10min, and ligated with T4 DNA ligase. Performing nested PCR on the ligation products: taking 0.5. mu.l of the ligation product to perform a first round of PCR, wherein the reaction system is as follows: mu.l of the ligation product, 10. mu.l of 2 XKOD buffer, 3. mu.l of dNTP (2mM), 0.3. mu.l of 10. mu.M GM1-VB1 (see Table 2 for sequence), 0.3. mu.l of 10. mu.M IVA-1 (see Table 2 for sequence), 0.4. mu.l of KOD, and compliment of ddH ₂ O to 20. mu.l. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 68 ℃ for 3min, and 30 cycles; at 68 ℃ for 5 min; 25 ℃ for 2 min. The second PCR reaction system was 0.5. mu.l of the first PCR product, 10. mu.l of 2 XKOD buffer, 3. mu.l of dNTP (2mM), 0.3. mu.l of 10. mu.M GM1-VB1 (SEQ ID NO: Table 2), 0.3. mu.l of 10. mu.M IVA-2 (SEQ ID NO: Table 2), 0.4. mu.l of KOD polymerase, and a complementary ddH ₂ O to 20. mu.l. PCR reaction procedure: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 68 ℃ for 3min, and 35 cycles; at 68 ℃ for 5 min; 25 ℃ for 2 min. And (3) carrying out agarose gel electrophoresis detection on the second round PCR product, recovering the gel, then sequencing, and carrying out comparison analysis on the sequencing result and an NCBI database to determine the insertion site of the T-DNA in the soybean genome.

Table 2: insertion site analysis primer

Example 9: verification of foreign gene insertion site in pTWGM1-7

Based on the flanking sequence isolation results in example 7, primers (Table 3) were designed for specific PCR validation analysis. Using primer GM1-V1F and GM17-gLBR were used to perform PCR amplification on pTWGM1-7 genomic DNA samples to verify the flanking sequences at the left border of the T-DNA insertion site, and primers GM1-V2F and GM 17-gBR were used to perform PCR amplification on pTWGM1-7 genomic DNA samples to verify the flanking sequences at the right border of the T-DNA insertion site. And (3) PCR reaction system: 20ng template DNA, 2. mu.l 10 XPCR buffer, 0.3. mu.l dNTP (10mM), 0.3. mu.l GM1-V1F (or GM1-V2F) primer (10. mu.M), 0.3. mu.l GM17-gLBR (or GM17-gRBR) primer (10. mu.M), 1U rTaq, complementary ddH ₂ O to 20. mu.l. PCR reaction procedure: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 30 s; repeat 32 cycles; 72 ℃ for 5 min; 25 ℃ for 2 min. The amplification results of pTWGM1-7 are shown in FIG. 5 (5a for the left border flanking sequence verification, 5b for the right border flanking sequence verification, M: DL2000 DNA Marker, N: Tianlong No. 1 control, 1 for pTWGM1-7 homozygous line).

The left border validation result has a specific band at 520bp, and the right border validation result has a specific band at 592 bp. The flanking sequences at both ends of the T-DNA were aligned with the genomic sequence of Williams 82 at NCBI website, and the results showed that the T-DNA was inserted into chromosome 19 of soybean (FIGS. 6 and 7) in the pTWGM1-7 transformant and 55bp of soybean genome was deleted due to the insertion of the T-DNA.

Table 3: insertion site verification primer

The left border flanking sequence of pTWGM1-7 is as follows:

ACTGAATAGACTCATCCAGGCTGATTTTTAAGGCATTGATATGAACACAGTTAGACAAATGAAATGTTGATGTAAGAAAAAAAATTTGAATTGTAATTTGATTTTAGTAAATTTTGTTTATGAGAAGTTTTAGTAACATATTCTTTAATACAATTTTTATTATGATTAAAATTTATTAAAAAATACAAAAATAATTAATAGAGTCTTTAAATGTGAGACTTATAAAGTTTTGTATTTTTAAATAATTTTTAATCAATAATAATAAAGTATGTTTAAAAGAGTTTTAAATAGCATATTGTTAGCAATTCTATTACTATGTCTATT

the right border flanking sequence of pTWGM1-7 is as follows:

TCTTTGCAAAGGCAAAGACACCGAAGTTGAGAAATATTTTCGTTGTCTTCATAAAAAAAATCGTTGTCATTCAAAATTTCTATAAAGCTCTCGGATGGTCGAATGCAGACTTGTTGTGCAATCACGTGTCTTTTGTTCAATCACGTGTCTTTTGTTCATATTAATGGTGCCGACATAAGTAAGGGTAAAAATAGATCATACCATCCATCATAAACAAGTTAAACTTAGATTTTTTTTAAAATATTTTTAATAAAAAATGTGAGACTCTAGACTTTAAATAAAAATCTTTTAAGTTTGATAAGTTGACATGTTTATATAATAATATATAATTATATATTATTTAATTTTAATATATAATTATTAATATTGATAATAAGTTTATAATAAAAATAATGTGACG

the invention is not limited solely to that described in the specification and embodiments, and additional advantages and modifications will readily occur to those skilled in the art, so that the invention is not limited to the specific details, representative embodiments, and illustrative examples shown and described herein, without departing from the spirit and scope of the general concept as defined by the appended claims and their equivalents.

Sequence listing

<110> Wuhan space Biotechnology GmbH

<120> cultivation method of glyphosate-resistant transgenic soybean

<141> 2020-10-15

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 324

<212> DNA

<213> Artificial Sequence

<400> 1

actgaataga ctcatccagg ctgattttta aggcattgat atgaacacag ttagacaaat 60

gaaatgttga tgtaagaaaa aaaatttgaa ttgtaatttg attttagtaa attttgttta 120

tgagaagttt tagtaacata ttctttaata caatttttat tatgattaaa atttattaaa 180

aaatacaaaa ataattaata gagtctttaa atgtgagact tataaagttt tgtattttta 240

aataattttt aatcaataat aataaagtat gtttaaaaga gttttaaata gcatattgtt 300

agcaattcta ttactatgtc tatt 324

<210> 2

<211> 406

<212> DNA

<213> Artificial Sequence

<400> 2

atctttgcaa aggcaaagac accgaagttg agaaatattt tcgttgtctt cataaaaaaa 60

atcgttgtca ttcaaaattt ctataaagct ctcggatggt cgaatgcaga cttgttgtgc 120

aatcacgtgt cttttgttca atcacgtgtc ttttgttcat attaatggtg ccgacataag 180

taagggtaaa aatagatcat accatccatc ataaacaagt taaacttaga ttttttttaa 240

aatattttta ataaaaaatg tgagactcta gactttaaat aaaaatcttt taagtttgat 300

aagttgacat gtttatataa taatatataa ttatatatta tttaatttta atatataatt 360

attaatattg ataataagtt tataataaaa ataatgtgac gaacaa 406

<210> 3

<211> 3274

<212> DNA

<213> Artificial Sequence

<400> 3

acgcttagac aacttaataa cacattgcgg acgtttttaa tgtactgaat taacgccgaa 60

ttaattcggg ggatctggat tttagtactg gattttggtt ttaggaatta gaaattttat 120

tgatagaagt attttacaaa tacaaataca tactaagggt ttcttatatg ctcaacacat 180

gagcgaaacc ctataggaac cctaattccc ttatctggga actactcaca cattattatg 240

gagaaactcg agttatcaag caccggctcc cacggtcctg ccggcagcga gcatacgctc 300

ccacatcctg tcgaagcctg ggagggtctt cgcagtcgta ccgacgttct ccacctgcac 360

acccggcacc ctaagaccga gcacagcggc ggatgtagcc atgcgatggt cggcgtaggt 420

acggaaggtg gcgccgtgca atggcctcgg ggtgataacg agtccatccc tggtctcctc 480

gcacctgcct ccgagccttg tgatctctgt agcaagagcg gcgagcctgt cggtctcatg 540

gccgcgaagg tgagcgatgc cgcggagcct gctcggggaa tccgccagag cggcgagagc 600

ggcgaacgtt ggagccagtt cgccagcggc gtgcaggtca acgtcgatgc cgtgaatctc 660

tccagtgccg gtgacagcga gcacgcttgt gccatcgtca gcagtgtgtt ccacggtaac 720

cctgccaccc atgcgctcaa gcagctctgg caccatagct cccggctggg tggtgctggc 780

aggccatccc ggcaccctca cggttccacc ggcagcgagg gcggcagcaa ggaacggagc 840

ggcgttggag aggtctggct cgaccctcac gtccctagcg ctaatcgcgc ccggtgaaac 900

gtgccagatg ccgtccctgc tatcgtccac agcgacgccc acttccctga gggtagccac 960

tgtcatctcg atgtgcggga gggatgggag ggtggctccg atgtggcgga gggcgaggcc 1020

gtcgtcgaac cttggggcgg cgagcagcag gccggacacg aactgcgagc tagcagaggc 1080

gtccacatcc acagctccgc cgcgcaggga acccttgccg tgaacggtga atggaaggtg 1140

ggacgggaag tctggtccgt cgccggtgac cttcacgccg agggcgcgca gcgcggcgag 1200

caccgggagc atcggcctca ccctggcctc tggatcgccg tcgaacctaa ccggaccgtc 1260

agcgagggca gccactggtg ggaggaacct catcacggtt ccggcaaggc cagtgaacac 1320

gtcgacatcg cccctcactg gacccggagt aacgtgcagg gtgcttggct cagtgccctc 1380

ggtgatctca gcgccaagag ccctgagggc ggcgatcatc agatcggcgt ccctggacct 1440

gagggctccc ctcagcacac ctgggccgtc tgcgagagcg gcaagcacca ggagcctgtt 1500

ggtgagggac ttgctgcctg ggatctccac ggtagcgtcc agctctcctg gcgccaccgg 1560

ggcctcccac ggagcctcgg acgctggagc cgggctggtg gcgtctgggg aagctggggc 1620

cggggtcatg catgcggtgg acacgctgga catcaccttg agcggcctca gctcggagcc 1680

gatgagggtc atgccgctct tcttgaggcc ccaggagctg gagatcgggt aggccctcgg 1740

gtgctgctgg gtcttgaggg acacggagag cggggacttc ctctggctgg acttggagag 1800

gttgctgatg aggctcgggt tctgcacgcc gttgcagatc ctggacacct gggccatggt 1860

accagcctta cctttgggtg ggggggtttt cgctttaagg aaaccggtta caggcaaatg 1920

atatcccgca caagctgcgt gtgacgacgc tcagagtgag tctctcgaga gagatagatt 1980

tgtagagaga gactggtgat ttcagcgtgt cctctccaaa tgaaatgaac ttccttatat 2040

agaggaaggt cttgcgaagg atagtgggat tgtgcgtcat cccttacgtc agtggagata 2100

tcacatcaat ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgctc 2160

ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag aggcatcttg aacgatagcc 2220

tttcctttat cgcaatgatg gcatttgtag gtgccacctt ccttttctac tgtccttttg 2280

atgaagtgac agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt 2340

tgaaaagtct caatagccct ttggtcttct gagactgtat ctttgatatt cttggagtag 2400

acgagagtgt cgtgctccac catgttatca catcaatcca cttgctttga agacgtggtt 2460

ggaacgtctt ctttttccac gatgctcctc gtgggtgggg gtccatcttt gggaccactg 2520

tcggcagagg catcttgaac gatagccttt cctttatcgc aatgatggca tttgtaggtg 2580

ccaccttcct tttctactgt ccttttgatg aagtgacaga tagctgggca atggaatccg 2640

aggaggtttc ccgatattac cctttgttga aaagtctcaa tagccctttg gtcttctgag 2700

actgtatctt tgatattctt ggagtagacg agagtgtcgt gctccaccat gttggcaagc 2760

tgctctagcc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct 2820

ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt 2880

agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg 2940

gaattgtgag cggataacaa tttcacacag gaaacagcta tgacatgatt acgaattcga 3000

gctcggtacc cggggatcct ctagagtcga cctgcaggca tgcaagcttg gcactggccg 3060

tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag 3120

cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc 3180

aacagttgcg cagcctgaat ggcgaatgct agagcagctt gagcttggat cagattgtcg 3240

tttcccgcct tcagtttaaa ctatcagtgt ttga 3274

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 4

gtcgagggga tggacgtc 18

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 5

cgacacattc agagccaccg a 21

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 6

catcgcatgg ctacatccg 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

atacgctccc acatcctgtc 20

<210> 8

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 8

tacgccgacc atcgcatggc tacatccgcc 30

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

cacgacaggt ttcccgactg 20

<210> 10

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 10

ttcgacagga tgtgggagcg tatgctcgct 30

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

gcaccccagg ctttacactt 20

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 12

ctatagggtt tcgctcatgt gttg 24

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 13

actgaataga ctcatccagg ctga 24

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 14

caacttaatc gccttgcagc ac 22

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

agcagatacg ctctggttcg 20

Claims (4)

1. Flanking sequences, characterized in that the left border flanking sequence is as shown in SEQ ID NO: 1, and the right border flanking sequence is shown in SEQ ID NO: 2, respectively.

2. A method for analyzing the exogenous gene locus of transgenic soybean obtained by inserting the flanking sequence of claim 1, which is characterized in that two rounds of PCR analysis are carried out by using a reverse PCR method, and then locus verification is carried out to obtain the flanking sequence, wherein the nucleotide sequence of a primer of the first round PCR is shown as SEQ ID NO: 8-9; primers for the second round of PCR are shown in SEQ ID NO: 10-11.

3. The method for analyzing the exogenous gene locus according to claim 2, wherein the locus verification comprises performing left boundary flanking sequence verification by using primers GM1-V1F and GM17-gLBR, and performing right boundary flanking sequence verification by using GM1-V2F and GM 17-gBR; the nucleotide sequences of the primers GM1-V1F and GM17-gLBR are shown in SEQ ID NO: 12-13; the nucleotide sequences of the primers GM1-V2F and GM 17-gBR are shown in SEQ ID NO: 14-15.

4. The method for analyzing the exogenous gene locus according to claim 3, wherein the verification result of the left border flanking sequence has a specific band at 520bp, and the verification result of the right border flanking sequence has a specific band at 592 bp.

Images