CN116751808A

CN116751808A - Method for regulating and controlling flowering and maturation time of plant, biological material and application thereof

Info

Publication number: CN116751808A
Application number: CN202310522140.4A
Authority: CN
Inventors: 邱丽娟; 李英慧; 李艳妃; 郭诗雨
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2023-05-10
Filing date: 2023-05-10
Publication date: 2023-09-15

Abstract

The invention relates to the technical field of genetic engineering and plant breeding, in particular to a method for regulating and controlling flowering and maturation time of plants, and a biological material and application thereof, wherein the flowering and maturation time of plants is regulated and controlled by regulating qFT13-3 gene activity in plants. The activity of the qFT13-3 gene in plants directly affects the flowering and maturation times of plants. When the qFT-3 gene is highly expressed, the flowering and maturation time of the plant is delayed; and when the qFT-3 gene is expressed in a low way, the flowering and maturation time of the plant is advanced. Furthermore, the research of the invention finds that the change of qFT13-3 gene activity in a specific plant can not cause the yield of crop plants to be reduced while influencing the flowering and maturation time of the plant, which has obvious advantages in the regulation of the flowering and maturation of the crop plants.

Description

Method for regulating and controlling flowering and maturation time of plant, biological material and application thereof

Technical Field

The invention relates to the technical fields of genetic engineering and plant breeding, in particular to a method for regulating and controlling flowering and maturation time of plants, and biological materials and application thereof.

Background

Soybean is not only an important source of vegetable oils and proteins, but also an important leguminous model plant, and has wide application in scientific research. However, soybeans are used as typical short-day crops, are sensitive to photoperiod reactions, so that the ecological application range of the soybeans is very narrow, and the introduction, cultivation and large-scale planting popularization of soybean varieties are severely limited.

Photoperiod response at flowering time is one of the most important factors affecting soybean regional adaptability and yield (Lin et al 2021). Currently, important sites/genes identified by forward genetics to regulate soybean flowering time and maturity to accommodate different photoperiod ecology environments are E1-E11 and J, and Tof11/GmPRR3a, tof12/GmPRR3b and qDTF-J/GmFT5a (Cober et al, 2010;Cober and Voldeng,2001;Elroyr,2011;Kong et al, 2010; li et al, 2020; lin et al, 2021; liu et al, 2008; lu et al, 2020; lu et al, 2017;Samanfar et al, 2016, 2017;Takeshima et al, wang et al, 2019; wang et al, 2020;Watanabe et al, 2009;Watanabe et al, 2011; xaa et al, 2012, yue et al, 2017; zhai et al, 2014; zhao et al, 2016). Wherein the sites E1, E2, E3, E4, E7, E8, E10, tof11, tof12 inhibit flowering, and E6, E9, E11, J and qDTF-J promote flowering.

High yield and early ripening have long been a pair of contradictions in crops, resulting in great challenges in breeding varieties that are both high yield and early ripe. In rice, both crop yield enhancement and flowering and maturity reduction have been achieved by genetic modification of the genes OsNRT1.1A/OsNPF6.3 (Wang et al, 2018), early flowering-completely dominant (Ef-cd) (Fang et al, 2019), osDREB1C (Wang et al, 2023; wei et al, 2022), osNF-YB4 (Peng et al, 2023). However, no report of such genes has been found in soybean.

The prior soybean flowering gene related report promotes the preliminary knowledge of the flowering network regulation, and partially explains the molecular basis of the expansion of soybean to the north and northeast of long-day illumination and to the south of short-day illumination. In the long-term domestication and breeding process of soybean germplasm resources in China, wide genetic variation is enriched in the flowering period and the maturity period so as to adapt to illumination variation of different areas. Further research on soybean photoperiod reaction genetic materials, especially excavation of early maturing high-yield genes, is helpful for providing theoretical basis for introduction and popularization, new variety cultivation and the like.

In view of this, the present invention has been made.

Disclosure of Invention

In order to achieve the purpose of the invention, the technical scheme of the invention is as follows:

in a first aspect, the present invention provides a method of regulating flowering and maturation times in a plant, comprising the steps of: regulate qFT13-3 gene activity in plants.

The present invention found that the activity of the qFT-13-3 gene in plants directly affects plant flowering and maturation times. Specifically, when the qFT13-3 gene is highly expressed, the flowering and maturation time of the plant is delayed; and when the qFT-3 gene is expressed in a low way, the flowering and maturation time of the plant is advanced. And the present invention is found in a specific class of plants such as soybean: the reduced qFT-13-3 gene activity does not result in reduced yield-related traits in crop plants while reducing plant flowering and maturation times, which is a significant advantage in the regulation of flowering and maturation in crop plants.

The means of modulating qFT13-3 gene activity in plants of the invention preferably comprises at least one of the following:

(1) Knocking out qFT-13 gene;

(2) Silencing qFT13-3 gene;

(3) Decreasing qFT13-3 gene expression;

(4) Introducing qFT-3 gene;

(5) And qFT13-3 gene expression is promoted.

Wherein modes (1), (2) and (3) can promote the plants to bloom and mature in advance, and modes (4) and (5) can delay the plants to bloom and mature; and the modulation in (1), (2) and (3) does not lead to a decrease in yield-related traits.

In the present invention, the qFT13-3 gene is derived from soybean. However, the plant of the invention is not limited to soybean, other plants (such as crop plants obtained by transgenic cultivation) capable of stably expressing qFT-3 gene can realize the regulation and control of flowering and maturation time by regulating the expression of qFT-3 gene, and the scheme of not causing yield reduction is within the protection scope of the invention.

In a preferred embodiment of the invention, the plant is soybean.

The change of qFT13-3 gene activity in soybean can influence the flowering and maturation time of plants, and can not reduce the yield of crop plants, so that the method has obvious advantages in the control of the flowering and maturation of crop plants.

In particular, when the method adopts the modes of knocking out qFT13-3 genes, silencing qFT-3 genes, reducing qFT13-3 gene expression and the like to promote the flowering and the mature of soybeans to advance, the yield of the soybeans is not reduced, and the yield is increased to a certain extent. This technical effect was first found in the homologous genes reported in the prior art, and this function is also less common in genes known in the prior art to have flowering regulation function, which is a biomaterial-based regulation method that is urgently needed in breeding.

In a more specific preferred embodiment of the invention, the reference genomic version of the qFT13-3 gene is Glycine max wm82.a2.v1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO. 2.

Further preferably, the nucleotide sequence of the qFT13-3 gene comprises SEQ ID NO.1 and/or a complement of SEQ ID NO. 1.

In a second aspect, the present invention provides a method of growing a plant variety having variations in flowering and maturity times, comprising the steps of: regulate qFT13-3 gene activity in plants.

Based on the association of qFT13-3 gene activity with plant flowering and maturation time regulation, qFT-3 has great potential in cultivating plant varieties with variations in flowering and maturation time.

Preferably, the means for modulating qFT13-3 gene activity in a plant also comprises at least one of the following means:

(1) Knocking out qFT-13 gene;

(2) Silencing qFT13-3 gene;

(3) Decreasing qFT13-3 gene expression;

(4) Introducing qFT-3 gene;

(5) And qFT13-3 gene expression is promoted.

Further preferably, the amino acid sequence of the protein after qFT13-3 gene expression is shown as SEQ ID NO. 2. The nucleotide sequence of the qFT13-3 gene preferably comprises SEQ ID NO.1 and/or a complement of SEQ ID NO. 1.The plant is preferably soybean.

In a third aspect, the present invention provides the use of a biomaterial for targeted editing of the qFT13-3 gene for regulating flowering and maturation time of plants, or for breeding plant varieties with variations in flowering and maturation time.

In particular, in a preferred embodiment provided by the present invention, the biological material comprises a CRISPR-Cas9 system; the crna nucleotide sequence in the CRISPR-Cas9 system that targets the qFT13-3 gene is preferably:

qFT13-3-g1: CCAGCAGCATATACCACAGCCTC (SEQ ID NO. 3); and/or

qFT13-3-g2: CCTCAAGGGGCAATAATTTGTTG (SEQ ID NO. 4); and/or

qFT13-3-g6：AAGTATAGGACTGAATAATGGGG(SEQ ID NO.5)。

According to the invention, the CRISPR-Cas9 system is utilized to edit the qFT-3 gene in plants (such as soybeans), and after qFT-3 mutation is found, flowering and maturation time of the plants are remarkably advanced, and yield is not reduced.

In another preferred embodiment provided by the invention, the biological material comprises an expression vector and/or engineering bacteria with qFT13-3 gene expression function.

The invention can delay the flowering and the maturation of plants by introducing the coding gene of qFT13-3 into the target plants or over-expressing the coding gene of qFT-3 in the target plants by using an expression vector and/or engineering bacteria.

In a fourth aspect, the present invention also provides a biomaterial for regulating flowering and maturation times in plants, the biomaterial comprising at least one of the following:

(1) A CRISPR-Cas9 system targeting the qFT13-3 gene;

(2) An expression vector or engineering bacteria with qFT13-3 gene expression function.

The beneficial effects are that:

the invention provides a method for regulating and controlling flowering and maturation time of plants and a biological material thereof, which realize the regulation and control of the flowering and maturation time of plants through the regulation of qFT13-3 gene activity in plants. The activity of the qFT13-3 gene in plants directly affects the flowering and maturation times of plants. When the qFT-3 gene is highly expressed, the flowering and maturation time of the plant is delayed; and when the qFT-3 gene is expressed in a low way, the flowering and maturation time of the plant is advanced. And the reduced qFT-3 gene activity in the plant can shorten the flowering and maturation time of the plant, and can not reduce the yield of the crop plant, so that the method has obvious advantages in the flowering and maturation regulation of the crop plant. The invention provides an important molecular module for molecular breeding of crop plants (such as soybeans) in the growth period, and has important guiding significance for cultivating materials adapting to different photoperiod environments.

Drawings

In order to more clearly illustrate the technical solutions of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be described below.

FIG. 1 is a photograph showing the result of examining experimental plants in experimental example 3 of the present invention, in which the left side is an electrophoresis chart of positive seedling examination and the right side is a photograph of the result after 0.1% Basta reagent is applied. Wherein M:2000bp DNAmarker;0: blank control (H) ₂ O)；1：WT(Williams 82)；2：qFT13-3-SP1&2 mutant (carrying the Bar gene). 3: qFT13-3-SP6 mutant (carrying Bar gene). If the leaf withers, it indicates that there is no Bar gene.

FIG. 2 shows the phenotype of the experimental plants in example 4 of the present invention, wherein the qFT13-3 mutant shows early flowering phenotype under long-day conditions. Wherein, (a) is a schematic diagram of the position of the target site on the qFT13-3 gene. g1&2 represents target sites 1 and 2 on the first exon; g6 represents the target site 6 on the fourth exon. (b) Sequences of two representative homozygous mutants of qFT13-3-cr1 and qFT13-3-cr 2. (c) Sequencing results for the qFT13-3-cr1 and qFT13-3-cr2 mutants. (d) And (f) the flowering phenotype of the qFT13-3 mutant under short and long day conditions. The length of the scale bar is 10cm. (e) And (g) statistical analysis of flowering-time under short and long day conditions for the qFT13-3 mutant in turn.

FIG. 3 shows the phenotype of the experimental plants according to example 4 of the present invention, in which the qFT13-3 mutant exhibited an early maturing phenotype. Wherein, (a) and (b) are the phenotype of the qFT13-3 mutant and the wild type under the natural long-day condition in the field in sequence. The length of the scale bar is 10cm. (c) And (d), (e), (f), (g) and (h) are flowering time, maturation time, plant height, node number, individual plant weight and hundred-grain weight data in sequence. t-test (×p <0.05; (×p <0.001; ns, not significant).

Detailed Description

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention. Unless otherwise indicated, all the experimental procedures used in the examples were conventional; the materials, reagents and the like used are all commercially available.

EXAMPLE 1 construction of Soybean qFT13-3-CRISPR vector

This example provides a soybean qFT-3-CRISPR vector capable of targeted editing of qFT13-3 genes.

In the embodiment, an online tool CRISPR-P (http:// CRISPR. Hzau. Edu. Cn) is used for designing sgRNA of a gene qFT-3, screening standards are that score is highest and off-target sites are few, and three target sites on a gene exon are finally determined:

qFT13-3-g1：5’-ccagcagcatataccacagcctc-3’，

qFT13-3-g2：5’-cctcaaggggcaataatttgttg-3’，

qFT13-3-g6：5’-aagtataggactgaataatgggg-3’。

and then the U6 promoter sequence, the sgRNA and the zCas9 are sequentially connected by bridge PCR, and then constructed on a knockout vector pCAMBIA3301 by utilizing In-fusion. The method specifically comprises the following steps:

(1) And (3) carrier enzyme cutting:

the reaction system:

reaction conditions: and (3) carrying out water bath at 37 ℃ for 1h, and running gel by agarose gel electrophoresis and recycling.

(2) In-fusion connection

The reagent was Clontech 5XHD Enzyme Premix. The recovered DNA fragment was ligated with the digested and recovered JRH0645 vector.

The reaction system:

In-fusion 1μL

DNA fragment 2. Mu.L

Vector fragment 2. Mu.L

Reaction conditions: 50℃for 30min.

(3) Transformation of E.coli Trans10

The Trans10 competent cells are taken out from the temperature of minus 80 ℃ and placed on ice for melting, all the connection products are added into a 50 mu L competent 1.5mL EP tube, and the mixture is stirred gently and stirred evenly and then placed on ice for 30min;

heat shock is carried out for 1min in a water bath at the temperature of 42 ℃, and then the mixture is rapidly placed on ice for 2min;

500 mu L of LB culture medium without antibiotics is added into each centrifuge tube, and the centrifuge tubes are placed on a shaking table at 37 ℃ for shaking culture at 200rpm for 1 hour;

100. Mu.L of the bacterial liquid was taken out and spread evenly on LB plate medium added with kanamycin antibiotic, and the culture was inverted overnight at 37 ℃.

(4) Identification of Positive clones

The single clone was picked up by a gun head and gently stirred in 10. Mu.L of water, and 1. Mu.L of the mixture was used for PCR identification of bacterial liquid. The remaining bacterial liquid was added to LB liquid medium containing kanamycin, and the culture was expanded for plasmid extraction.

The reaction system:

the reaction procedure:

preheating at 95 ℃ for 3min; denaturation at 95℃for 5s, annealing at 60℃for 5s, extension at 68℃for 5s (1 kb/10 s), 35 cycles; final extension at 68℃for 5min.

And (3) detecting the PCR product through electrophoresis, sequencing corresponding propagation bacterial liquid of the clone of the target fragment to obtain positive clone, and returning plasmids by utilizing a company to carry out subsequent experiments.

Example 2 obtaining transgenic Soybean plants

In this example, transgenic soybean plants with qFT-13-3 mutation were prepared using agrobacterium-mediated genetic transformation of soybean cotyledonary nodes. The method specifically comprises the following steps:

(1) Agrobacterium preparation and activation culture:

after the construction of the plasmid containing the gRNA sequence qFT13-3 was transformed with agrobacterium, the resistant YEP plate was streaked and colonies were picked for PCR identification. After detection, 2-4 single colonies were picked and inoculated in 10mLYEP liquid medium (with appropriate antibiotics added) at 28℃and shaking at 250rpm for 16h. The once activated bacterial liquid was taken and cultured overnight at 28℃with addition of fresh YEP liquid medium (containing antibiotics) at 1:1000 with shaking at 250rpm for 16h to OD=1.0-1.2.

(2) Preparation of soybean explants:

the soybeans which are free of diseases, cracks and plump are selected for wet heat sterilization treatment and inoculated in germination culture for 1-5 days based on the dark treatment at 26 ℃.

(3) Infection of the explant agrobacterium and co-culture:

the explant cotyledonary node is placed into a culture medium containing agrobacterium tumefaciens heavy suspension for infection, inoculated into a co-culture medium with filter paper paved on the surface, and dark-cultured for 3-5 days.

(4) Recovery culture:

after co-cultivation, cotyledons are inserted into the recovery medium for recovery for 5-10 days.

(5) And (3) bud induction culture:

after recovery culture, the explants are transferred to a bud induction solid culture medium, and the explants are inoculated on the culture medium with the incision upwards for 7-10 days. The secondary culture is transferred into a Dingya induction medium containing 6-8mg/L grass for 3 weeks.

(6) Bud elongation culture:

after the bud induction is completed, cluster buds are left, and the cluster buds are inoculated into a bud elongation culture medium and are cultured for 3 weeks for subculture.

(7) Rooting culture:

when young stems with 3-4cm of cluster buds are extracted, the young stems are cut off close to the base of the young stems and are inoculated into a rooting culture medium for illumination culture for 3 weeks for secondary generation.

(8) Hardening seedlings and transplanting:

transplanting young stems into a pot of nutrient soil after growing roots, covering and moisturizing the young stems by using a transparent plastic bag after watering thoroughly, removing the bag after regenerating plant leaves without fog drops after one week, and transferring the plant leaves into a greenhouse for management.

Example 3 identification of transgenic Positive lines

In this example, the qFT13-3 mutant transgenic soybean positive strain prepared in example 2 was tested and identified, and the results are shown in FIG. 1.

In order to determine the transgenic positive plants, a proper amount of young leaves are taken, DNA is extracted, and molecular detection is carried out. For CRISPR knockout mutant plants, the Basta resistance gene is detected and PCR specific amplification and sequencing is performed on the place where its gRNA is located.

Specific primers for amplifying the containing gRNA are shown below:

qFT13-3-g1g2-F：GTGGTTTATACGAGGGCGAT(SEQ ID NO.6)；

qFT13-3-g1g2-R：GGGCATGCACTGGTATGTATAG(SEQ ID NO.7)；

qFT13-3-g6-F：TGCTCGATGTCAATGCAGA(SEQ ID NO.8)；

qFT13-3-g6-R：AAAGACATCCATGAAACCTAGC(SEQ ID NO.9)。

the gRNA positions of the qft13-3-cr1 and qft13-3-cr2 mutant plants are respectively inserted or deleted by non-3 times of nucleotide through PCR detection.

Example 4 identification of transgenic Soybean phenotypes

This example demonstrates the characterization of the phenotype of the qFT13-3 mutant transgenic soybean positive lines prepared in example 2, as shown in FIGS. 2 and 3.

The epicenter identification references "soybean germplasm resource description Specification and data standards" to check for seedling stage, flowering stage, maturity stage, plant height, node number, individual plant weight and hundred grain weight (Qia et al, 2006). Investigation was carried out on individual plants, the seedling emergence period was the date of emergence of the cotyledons of the seedlings, the flowering period was the date of onset of flowering of the plants, and the maturity period was the date of full plant 95% pod reaching maturity color and rattling. The number of the transgenic soybean and the wild control sample used in the embodiment is more than 7, and the method has statistical significance.

As shown in FIG. 2, after qFT-3 mutation, the transgenic plants showed significantly earlier flowering and maturity under natural long-day conditions (average light 15h: dark 9 h), with average flowering and maturity times shortened by 4.5 and 10 days, respectively, compared to the wild type control.

As shown in FIG. 3, after qFT-3 mutation, the transgenic plants showed a significant advance in flowering and maturity under natural long-day conditions (average light 15h: dark 9 h), with average flowering and maturity times shortened by 3.75 and 11 days, respectively, compared to the wild type control. Although the transgenic plants were mature in advance, the individual grain weight, plant height and node number were not significantly changed, and the hundred grain weight was also increased by 10.6%.

Comparative example 1

This comparative example provides a method of regulating flowering in rice using Zhonghuang11 (ZH 11; O.sativa ssp. Japonica) as a receptor material, knocking out OsPRR73 by CRISPR technique to obtain two types of asprr 73 mutants (see: liang, L., zhang, Z., cheng, N., liu, H, song, S., hu, Y, zhou, X, zhang, J.and Xing, Y.2021.the transcriptional repressor OsPRR links circadian clock and photoperiod pathway to control heading date in plant, cell environ.44, 842-855.).

The result of the field test shows that: under natural long-day conditions (NLD), the osprr73 mutant had 3 days earlier than wild-type flowering, but the plant height was shorter, the number of branches was reduced, the spike was smaller, and the thousand seed weight was reduced.

The above examples merely represent a few embodiments of the present invention, which facilitate a specific and detailed understanding of the technical solutions of the present invention, but are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention.

Claims

1. A method for regulating flowering and maturation times in plants comprising the steps of: regulate qFT13-3 gene activity in plants.

2. The method of modulating flowering and maturation times in a plant according to claim 1 wherein the manner in which the qFT13-3 gene activity in the plant is modulated comprises at least one of the following:

(1) Knocking out qFT-13 gene;

(2) Silencing qFT13-3 gene;

(3) Decreasing qFT13-3 gene expression;

(4) Introducing qFT-3 gene;

(5) And qFT13-3 gene expression is promoted.

3. The method for regulating flowering and maturation time of plants according to claim 1 or 2, wherein the amino acid sequence of the protein after the qFT13-3 gene is expressed is shown in SEQ ID No. 2.

4. A method of regulating flowering and maturation of plants according to claim 3, wherein the nucleotide sequence of the qFT13-3 gene comprises SEQ ID No.1 and/or the complement of SEQ ID No. 1.

5. The method of regulating flowering and maturation time in plants according to any of claims 1 to 4, wherein the plant is soybean.

6. A method for growing a plant variety having a variation in flowering and maturity times, comprising the steps of: regulate qFT13-3 gene activity in plants.

7. The application of the biological material for targeted editing of qFT13-3 genes in regulating and controlling the flowering and maturation time of plants or cultivating plant varieties with variation of the flowering and maturation time.

8. The use of claim 7, wherein the biological material comprises a CRISPR-Cas9 system; the gRNA nucleotide sequence of the target qFT13-3 gene in the CRISPR-Cas9 system is as follows:

qFT13-3-g1：CCAGCAGCATATACCACAGCCTC；

and/or

qFT13-3-g2：CCTCAAGGGGCAATAATTTGTTG；

And/or

qFT13-3-g6：AAGTATAGGACTGAATAATGGGG。

9. The use according to claim 7, wherein the biological material comprises an expression vector and/or engineering bacteria having the function of qFT13-3 gene expression.

10. A biomaterial for regulating flowering and maturation times in plants, said biomaterial comprising at least one of the following:

(1) A CRISPR-Cas9 system targeting the qFT13-3 gene;