CN112126703A - Molecular marker of multiple-effect QTLs locus qTLS-4 for regulating rice leaf size and application thereof - Google Patents
Molecular marker of multiple-effect QTLs locus qTLS-4 for regulating rice leaf size and application thereof Download PDFInfo
- Publication number
- CN112126703A CN112126703A CN202011053639.8A CN202011053639A CN112126703A CN 112126703 A CN112126703 A CN 112126703A CN 202011053639 A CN202011053639 A CN 202011053639A CN 112126703 A CN112126703 A CN 112126703A
- Authority
- CN
- China
- Prior art keywords
- rice
- qtls
- leaf
- molecular marker
- size
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 111
- 235000009566 rice Nutrition 0.000 title claims abstract description 110
- 230000001105 regulatory effect Effects 0.000 title claims abstract description 30
- 239000003147 molecular marker Substances 0.000 title claims description 39
- 240000007594 Oryza sativa Species 0.000 title description 2
- 241000209094 Oryza Species 0.000 claims abstract description 110
- 238000009395 breeding Methods 0.000 claims abstract description 22
- 230000001488 breeding effect Effects 0.000 claims abstract description 22
- 238000000034 method Methods 0.000 claims abstract description 22
- 230000002068 genetic effect Effects 0.000 claims abstract description 11
- 230000001276 controlling effect Effects 0.000 claims abstract description 10
- 241001433070 Xiphoides Species 0.000 claims abstract description 9
- 210000000349 chromosome Anatomy 0.000 claims abstract description 9
- 230000008569 process Effects 0.000 claims abstract description 9
- 210000002417 xiphoid bone Anatomy 0.000 claims abstract description 9
- 239000012634 fragment Substances 0.000 claims abstract description 5
- 241000196324 Embryophyta Species 0.000 claims description 18
- 238000011144 upstream manufacturing Methods 0.000 claims description 10
- 230000003321 amplification Effects 0.000 claims description 9
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 5
- 238000006243 chemical reaction Methods 0.000 claims description 5
- 238000012257 pre-denaturation Methods 0.000 claims description 4
- 230000000243 photosynthetic effect Effects 0.000 claims description 3
- 230000001737 promoting effect Effects 0.000 claims description 3
- 108090000790 Enzymes Proteins 0.000 claims description 2
- 102000004190 Enzymes Human genes 0.000 claims description 2
- 238000000137 annealing Methods 0.000 claims description 2
- 239000012154 double-distilled water Substances 0.000 claims 1
- 238000011160 research Methods 0.000 description 17
- 101000988395 Homo sapiens PDZ and LIM domain protein 4 Proteins 0.000 description 14
- 108090000623 proteins and genes Proteins 0.000 description 11
- 238000004458 analytical method Methods 0.000 description 9
- 238000001962 electrophoresis Methods 0.000 description 8
- 239000000463 material Substances 0.000 description 6
- 238000001514 detection method Methods 0.000 description 5
- 239000003550 marker Substances 0.000 description 5
- 230000000306 recurrent effect Effects 0.000 description 5
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 4
- 238000000227 grinding Methods 0.000 description 4
- 230000012010 growth Effects 0.000 description 4
- 230000004983 pleiotropic effect Effects 0.000 description 4
- 240000002582 Oryza sativa Indica Group Species 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 101100480530 Danio rerio tal1 gene Proteins 0.000 description 2
- 101001027192 Homo sapiens Kelch-like protein 41 Proteins 0.000 description 2
- 102100037644 Kelch-like protein 41 Human genes 0.000 description 2
- 101100480538 Mus musculus Tal1 gene Proteins 0.000 description 2
- 101100312945 Pasteurella multocida (strain Pm70) talA gene Proteins 0.000 description 2
- 101100536300 Pasteurella multocida (strain Pm70) talB gene Proteins 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 230000005540 biological transmission Effects 0.000 description 2
- 230000010261 cell growth Effects 0.000 description 2
- 235000013339 cereals Nutrition 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 230000008303 genetic mechanism Effects 0.000 description 2
- 238000009396 hybridization Methods 0.000 description 2
- 238000013507 mapping Methods 0.000 description 2
- 230000000877 morphologic effect Effects 0.000 description 2
- 210000000056 organ Anatomy 0.000 description 2
- 230000029553 photosynthesis Effects 0.000 description 2
- 238000010672 photosynthesis Methods 0.000 description 2
- 230000009467 reduction Effects 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 230000009261 transgenic effect Effects 0.000 description 2
- 241000037488 Coccoloba pubescens Species 0.000 description 1
- 108700029231 Developmental Genes Proteins 0.000 description 1
- 101000998814 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) N-acetylneuraminate lyase 1 Proteins 0.000 description 1
- 241000209510 Liliopsida Species 0.000 description 1
- 101000962325 Oryza sativa subsp. japonica Protein NARROW LEAF 1 Proteins 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 230000009418 agronomic effect Effects 0.000 description 1
- 238000009412 basement excavation Methods 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 230000032823 cell division Effects 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000035784 germination Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 229940043355 kinase inhibitor Drugs 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 239000003757 phosphotransferase inhibitor Substances 0.000 description 1
- 230000001766 physiological effect Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 230000008117 seed development Effects 0.000 description 1
- 230000005068 transpiration Effects 0.000 description 1
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a multi-effect QTLs for regulating the size of a rice xiphoid leaf, wherein a QTLs locus is positioned on a No. 4 chromosome DNA fragment of rice and is named as qTLS-4, the genetic distance is 87.1-97.4cM, the physical distance is 28747360 and 29507404bp, and the QTLs locus has a regulating effect on the size of the rice xiphoid leaf. The invention also discloses qTLS-4 molecular markers of the multi-effect QTLs site for regulating and controlling the size of the leaf of the xiphoid leaf of the rice, which comprise two pairs of molecular markers Indel Fls-1 and Indel Fls-2 which are closely linked. The invention utilizes a molecular marking method to detect whether the rice variety or strain has QTLs for regulating the size of the rice flag leaf, thereby accelerating the breeding process of the excellent rice variety.
Description
Technical Field
The invention belongs to the technical field of rice breeding and molecular biology, and particularly relates to a molecular marker of a multi-effect QTLs locus qTLS-4 for regulating and controlling the size of rice leaves and application thereof.
Background
Rice (Oryza sativa.L) is the grain crop with the largest planting area, the largest total yield and the highest consumption in China, and rice breeding in China mainly goes through 6 important courses of dwarf breeding, three-line hybrid rice breeding, two-line hybrid rice breeding, utilization of interspecific heterosis, ideal plant type breeding, green super rice breeding and the like[1,2]. In the breeding process, good individual plant types are the necessary conditions for high yield of rice, leaf shapes are important components of plant shapes, multiple breeders propose an ideal plant type mode for high yield of rice, and all the exceptions are the breeding of leaf shapes. The leaves are the main organs for photosynthesis, from the heading and flowering period to the grain filling and maturing period of the rice, the functional leaves (the sword leaves, the inverted 2 leaves and the inverted 3 leaves) of the rice are the main suppliers of the nutrients at the heading part, the size of the leaves of the rice directly influences various physiological activities and final yields of the rice, such as photosynthesis, transpiration and the like, wherein the sword leaves have the highest contribution rate to the yield of the rice[3,4]. The size of the leaf includes the characteristics of leaf length, leaf width, leaf thickness, leaf perimeter, leaf area and the like[5]However, the gene has pleiotropic type, and most of the genes regulating the length and width of the leaf also influence the size of the leaf area.
The related research of the rice leaf shape control gene has important research value for analyzing the molecular genetic mechanism of the rice leaf shape character, and beneficial genes can be effectively polymerized by the technical means of positioning and cloning the leaf shape control gene, applying molecular marker assisted selection and the like, so that a plurality of excellent agronomic characters including leaf shapes can be cultivatedThe new rice variety of (1). FANG, etc[6]A mutant mini1 with early termination of rice stem development is obtained by separating from a flower 11 group in a japonica rice variety treated by EMS, compared with a wild type, the division of a Shoot Apical Meristem (SAM) of mini1 is stopped, so that overground part growth is stopped, and the mutant mini1 is used as a micro-activity gene for controlling leaf length and leaf width and participates in the process of leaf size and morphological establishment. CHEN and the like[7]A recombinant inbred line is constructed by utilizing a japonica rice variety D50 (narrow leaves) and an indica rice variety HB277 (wide leaves), and 5 QTLs for controlling the width of the sword leaves are identified. And the pleiotropic QTLss qFLW4 was finely positioned in the 74.8kb interval between RM17483-RM17486, which contains the narrow leaf gene NAL 1. Compared with the wild type, the nal1 mutant has the advantages of reduced longitudinal pulse number of leaves, narrowed leaves, no difference in leaf length, shortened inverted 3, 4 and 5 sections, no difference in length between inverted 1 and 2 sections, and short whole plant. LI and the like[8]A narrow-leaf mutant nal9 mutant is separated from transgenic rice with T-DNA insertion, and is positioned in a range of 69.3kb between molecular markers V239B and V239G on a BAC fragment OJ1212_ C05, and the mutant nal9 shows phenotypes such as narrow leaves, light green leaves at seedling stage, plant height dwarfing, spike reduction and tillering increase in the whole growth period. A compensation mechanism exists in monocotyledons, namely the influence caused by the reduction of cell division is compensated through cell expansion, for example, KRP1 transgenic plants show the characters of slightly smaller leaf area, slightly shorter leaves, reduced cell number on the leaf surface and the like, but the cell expansion is partially compensated[9]。
At present, the analysis of complex regulation networks formed by combining various leaf shapes and various multi-effect genes and the research on related molecular genetic mechanisms are relatively few. Therefore, the QTLs positioning and gene clone research of the leaf-shape related traits still needs further deep excavation and analysis, and a new breakthrough is expected to be realized by means of increasingly developed research means and methods of molecular biology and genomics.
The references referred to above are as follows:
1. chen hua, chen wenfu, xihuaan, wu xiao jin, chinese super rice breeding [ J ]. chinese rice, 2010,16(3): 54-54;
2. development of developmental genes of floral organs of rice [ J ] rice in china, 2007 (3): 8-9;
3. zhu Changfeng, Lianglijun, Zengsiyuan, Litianwei, Dongguan, Hongdelin, fine positioning of qFla-8-2 sites of rice flag leaf angle [ J ]. China Rice science, 2016,30(1): 27-34;
4. zhongxing Yue, Wu oriented Dong, Wang Feng bin, Wang Rong, high-yield rice variety plant type mode discussion [ J ]. Xinjiang agricultural reclamation science and technology, 1999, (4): 30-31;
5. lin ze Chuan, Zhan Xiao Deng, Cheng Hua, Cao Li Yong, research progress on leaf-shape related genes of rice [ J ]. Nuclear agriculture report, 2013,27(11): 1662-1669;
fang Y X, Hu J, Xu J, Yu H P, Shi Z Y, Xiong G S, Zhu L, Zeng D L, Zhuang G H, Gao Z Y, Dong G J, Yan M X, Guo L B, Wang Y H, Qian Q.identification and characterization of catalysis of Mini1, a gene regulation rice shoot depth [ J ]. J Integr Plant Biol,2015,57(2):151-161(FangY X, Hu J, Xu J, Yu H P, Shi Z Y, Xiong G S, Zhu L, Zeng D L, Zhang G H, Gao Z Y, Dong G J, Yan M X, Guo L B, Wang Y regulatory bud development genes [ Qia ] 1. J ] (Qian J), (2015-161, 57-2) and (2015-161);
cai J, Zhang M, Guo L B, Li X M, Ma L Y. QTLs for the edge flag leaves traits in double haploid leaves in differential environment [ J ]. Genet Mol Res,2015,14(2): 6786-;
8. plum, zhahuzhi, maotang, xuzheng, chen wenfu, analysis of morphological character of rice sword leaf QTL [ J ]. crop journal, 2010,3(27): 26-29;
barroco R M, Peres A, Droual A M, De Veylder L, Nguyen L S L, De Wolf J, Mironov V, Peerbolte R, Beemster G T S, Inze D, Broekaert W F, Frankard V.the cycle-dependent kinase inhibitor Orysa; KRP1 Plays an immobilized roller in Seed Development of Rice [ J ] Plant Physiol,2006,142(3) 1053-.
Disclosure of Invention
The invention aims to solve the technical problem of providing a molecular marker of multi-effect QTLs qTLS-4 for regulating and controlling the size of rice leaves and application thereof.
In order to solve the technical problems, the invention provides a multi-effect QTLs for regulating the size of the leaf of the rice xiphoid leaf, wherein the QTLs are positioned on the No. 4 chromosome DNA fragment of the rice and named as qTLS-4, the genetic distance is 87.1-97.4cM, the physical distance is 28747360 and 29507404bp, and the QTLs have a regulating effect (more obvious regulating effect) on the size of the leaf of the rice xiphoid leaf.
The invention also provides a qTLS-4 molecular marker of the multi-effect QTLs site for regulating the size of the leaf of the rice flag leaf:
the qTLS-4 molecular marker comprises two pairs of molecular markers Indel Fls-1 and Indel Fls-2 which are closely linked;
the primer pair of the molecular marker Indel Fls-1 is as follows:
the upstream primer 5'-CCCCGTCCTATAATATAGCAACC-3' is the primer that is used,
a downstream primer 5'-CTCTATACTCACTCCGTCCCA-3';
the primer pair of the molecular marker Indel Fls-2 is as follows:
the upstream primer 5'-AGATCCCAGGTAATGATGCGA-3' is the primer that is used,
the downstream primer 5'-CGCGCAATCCAAATCCATCA-3'.
The primer pair has good marking polymorphism, convenient selection and high efficiency.
The invention also provides the application of the multi-effect QTLs for regulating the size of the rice xiphoid leaves: the molecular marking method is used for detecting whether the rice variety or strain has QTLs for regulating the size of the rice flag leaf, thereby accelerating the breeding process of the excellent rice variety.
The invention is used as the improvement of the application of the multi-effect QTLs for regulating the size of the leaf of the rice sword-like leaf: cultivating the rice with enlarged sword leaf blades, and optimizing the plant type of the rice; thereby improving the photosynthetic efficiency and promoting the yield and income increase of the rice.
The application of the multi-effect QTLs for regulating the size of the blades of the rice flag leaves is further improved as follows: extracting the genome DNA of the rice to be detected, and carrying out PCR amplification on the extracted genome DNA by using a primer pair of a molecular marker Indel Fls-1 or a primer pair of a molecular marker Indel Fls-2.
The invention uses the RIL group of japonica rice hot grinding/indica rice Huazhan hybrid combination as the material to carry out QTL positioning of the size of the leaf of the rice xiphophyll.
The multi-effect QTLs for regulating the size of the rice xiphoid leaves have the LOD value of the leaf length as high as 6.92, the LOD value of the leaf width as high as 4.51 and the LOD value of the leaf area as high as 6.37. Because the size of the rice leaf is one of the important indexes of the ideal plant type of the rice and has important significance for improving the plant type of the rice and promoting the yield increase of the rice, whether the rice variety or the strain has the QTL related to the size of the rice sword leaf can be detected by developing the molecular marker tightly linked with the multi-effect QTLs, and the breeding process of the excellent rice variety can be accelerated.
The invention relates to a method for positioning multi-effect QTLs related to the sizes of blades of rice xiphoid leaves, which comprises the following steps:
1) carrying out hybridization by taking heat research and Huazhan as parents, and obtaining 134 strains (F13) with stable inheritance by a single-grain transmission method to jointly form an RIL population;
2) investigating phenotype data related to the size of the leaves of the population of the recombinant inbred line;
3) utilizing a genetic map constructed by a large number of SNP and Indel marks developed in the early stage of a laboratory, analyzing the relation between the marks of the whole chromosome set and the phenotypic values of quantitative characters through R-QTL professional software, positioning the QTL to the corresponding positions of the linkage group one by one, and estimating the genetic effect of the linkage group; if the molecular marker with LOD >3 is detected, 1 QTL exists between 2 markers corresponding to the highest LOD value.
The invention utilizes a primer pair of molecular markers Indel Fls-1 and Indel Fls-2 to carry out PCR amplification on DNA of a rice material to be identified, and an amplification product is subjected to electrophoresis detection, and if a DNA fragment with a corresponding size is amplified, the existence of multiple-effect QTLs qTLS-4 for regulating and controlling the size of a rice leaf is marked.
After the DNA is amplified by the primer pair of the molecular marker Indel Fls-1, a band at the same position as the hot-ground position of the rice variety can be detected by electrophoresis.
The primer pair of the molecular marker Indel Fls-1 is as follows:
upstream primer 5'-CCCCGTCCTATAATATAGCAACC-3'
Downstream primer 5'-CTCTATACTCACTCCGTCCCA-3'
After the DNA is amplified by the primer pair of the molecular marker Indel Fls-2, a band at the same position as the hot-ground position of the rice variety can be detected by electrophoresis.
The primer pair of the molecular marker Indel Fls-2 is as follows:
upstream primer 5'-AGATCCCAGGTAATGATGCGA-3'
Downstream primer 5'-CGCGCAATCCAAATCCATCA-3'
Wherein, the reaction system of the PCR is as follows:
wherein, the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min, pre-denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 30s, amplification for 38 cycles, and final extension at 72 ℃ for 10 min.
The molecular marking method of the multiple-effect QTLs qTLS-4 locus for regulating the size of the rice flag leaf provided by the invention can be applied to breeding rice varieties with large size of the flag leaf.
According to the invention, 2 pairs of molecular markers which are closely linked with multiple-effect QTLs qTLS-4 for regulating the size of the sword leaf of rice and positioned on the No. 4 chromosome of a hot-ground rice variety are screened by adopting a QTL locus molecular marker method, the size of the sword leaf of the rice material is predicted, and the breeding of the ideal plant type of the rice is accelerated.
In conclusion, the invention takes the japonica rice variety heat research as the female parentHybrid F with indica rice variety Huazhan as male parent1And taking 134 recombinant inbred line groups obtained after continuous inbred of the generations as materials, measuring and analyzing the leaf length, the leaf width, the leaf area of the leaves, simultaneously carrying out QTL mapping analysis on data by using an encrypted genetic map constructed by the groups, finding a multi-effect QTLs according to statistical results, and detecting the QTLs to obtain the leaf length LOD value of 6.92, the leaf width LOD value of 4.51 and the leaf area LOD value of 6.37. The technical advantages of the invention are as follows: the constructed genetic linkage map has high density, 4858 markers are uniformly distributed on 12 chromosomes, and QTL positioning is more accurate; in addition, the marker polymorphism is very good, and the screening of rice progeny is more convenient and efficient; the detected QTL effect value is large, and the QTL effect value is a multi-effect QTLs for regulating and controlling the size of rice leaves, so that the breeding efficiency can be effectively improved.
Drawings
The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 is a flow chart of genetic material construction in a multi-effect QTLs positioning method for regulating and controlling the sizes of rice and sword leaf blades.
FIG. 2 is the frequency distribution (A) and QTL analysis (B) of leaf length of the RIL population at the tillering stage.
FIG. 3 is the frequency distribution (A) and QTL analysis (B) of leaf width of RIL population at the tillering stage.
FIG. 4 is the frequency distribution (A) and QTL analysis (B) of the leaf area of the RIL population at the tillering stage.
FIG. 5 shows the position of pleiotropic QTLs qTLS-4 on chromosome 4 for regulating leaf size.
FIG. 6 shows the primer pair for molecular marker Indel Fls-1 in the parent and its F1Electropherograms generated by amplification in the generation and RIL populations. Wherein, 1 is heat research, 2 is Huazhan, and 3 is heat research/Huazhan filial generation F14-11 are RIL populations of the Reyan/Huazhan hybrid combination.
FIG. 7 shows the primer pair for molecular marker Indel Fls-2 in the parent and its F1Electropherograms generated by amplification in the generation and RIL populations. Wherein, 1 is heat research, 2 is Huazhan, and 3 is heat research/Huazhan filial generation F14-11 are RIL populations of the Reyan/Huazhan hybrid combination.
FIG. 8Is a primer pair of a molecular marker Indel Fls-1 in parental hot grinding, 93-11 and F thereof1Generation and BC taking 93-11 as recurrent parent3F1The electrophorograms resulting from the amplifications in the generation. Wherein, 1 is heat research, 2 is 93-11, and 3 is heat research/93-11 filial generation F1And 4-10 are BC taking 93-11 as recurrent parent3F1The electrophorograms resulting from the amplifications in the generation.
FIG. 9 shows the primer pairs for molecular marker Indel Fls-2 in parental hot-grinding, 93-11 and F1Generation and BC taking 93-11 as recurrent parent3F1The electrophorograms resulting from the amplifications in the generation. Wherein, 1 is heat research, 2 is 93-11, and 3 is heat research/93-11 filial generation F1And 4-10 are BC taking 93-11 as recurrent parent3F1The electrophorograms resulting from the amplifications in the generation.
Detailed Description
The invention is further described below with reference to specific examples. These descriptions are not intended to limit the present invention further, and the technical means used in the following examples are conventional means well known to those skilled in the art, unless otherwise specified.
Example 1 acquisition of test materials
Using Huazhan as a donor parent and a local rice variety hot-ground as a receptor parent, carrying out hybridization to construct RILs, and finally obtaining 134 stably inherited strains by using a single seed transmission method (namely, carrying out bagging single strain seed receiving treatment on F1 until phenotype of a progeny strain is not separated), as shown in figure 1.
60 seeds of each parent and each strain (F13) are selected, the seeds are soaked for 2 days after the surfaces of the seeds are disinfected, the seeds are wrapped by a wet towel, the seeds are placed in a constant temperature box at 37 ℃ for accelerating germination for 48 hours, and the seeds with consistent exposure are selected and sowed. After 30 days, 24 seedlings of each plant line and parents with similar growth conditions are selected and transplanted, and all the rice materials are planted in test fields of biochemical academy colleges of Zhejiang university in Jinhua city, Zhejiang province and are managed conventionally.
Example 2 measurement of blade size data
At the tillering stage, 5 tillers are randomly selected from each plant line (each transplanted parent and plant line seedling), and the leaf length, the leaf width and the leaf area of the sword leaf are respectively measured. Each set of data was recorded and the average was calculated.
In fig. 2A, 3A, and 4A, RY represents the rice variety rezenith, and HZ represents the rice variety huazhan; according to the fig. 2A, 3A and 4A, the data of the sword leaf length, leaf width, leaf area and the like are shown as continuous normal distribution and are wide in range, and more super-parent individuals exist and show the genetic characteristics of quantitative traits.
Example 3 QTL localization analysis
The Quantitative Trait Locus (QTL) interval mapping is carried out on the rice leaf size by utilizing a genetic map constructed by a large number of SNP and Indel marks developed in the early stage of a laboratory, the relation between the marks of the whole chromosome set and the quantitative trait phenotype values is analyzed through R-QTL professional software, the QTL is positioned to the corresponding positions of the linkage group one by one, and the genetic effect of the linkage group is estimated. If the molecular marker with LOD >3 is detected, 1 QTL exists between 2 markers corresponding to the highest LOD value. One pleiotropic QTLs with LOD values up to 6.92 for leaf length, up to 4.51 for leaf width and up to 6.37 for leaf area were found between the Indel Fls-1 marker and the Indel Fls-2 marker on chromosome 4 throughout the entire genome (FIG. 2B, FIG. 3B, FIG. 4B). The genetic distance was 87.1-97.4cM, the physical distance was 28747360-29507404bp, and the gene was designated as qTLS-4 (FIG. 5).
Example 4 molecular marker assisted selection
Setting a molecular marker Indel Fls-1 and a molecular marker Indel Fls-2 at the upstream and downstream of the QTL site qTLS-4 respectively.
The primer pair of the molecular marker Indel Tal-1 is as follows:
the upstream primer GCCAGCAGTTTGCATTGTTA is the primer that is used,
a downstream primer TACCCCACATGGGTTGATCT;
the primer pair of the molecular marker Indel Tal-2 is as follows:
the upstream primer GTCAACGCGGATACAACAAC is the primer that is used,
the downstream primer ATAGCACCAATTTGGGTGGA.
Taking parental hot-grinding, Huazhan and rice leaves of F1 generation and RIL group (including 134 strains of F13) of the parental plants, extracting genome DNA, carrying out PCR amplification on the genome DNA by utilizing the molecular markers, and carrying out PCR reaction system: 1. mu.L of forward primer (10. mu.M), 1. mu.L of reverse primer (10. mu.M), 2. mu.L of DNA template (10. mu.M), 5. mu.L of mix enzyme, ddH2O1. mu.L. The reaction program is that DNA is pre-denatured at 94 ℃ for 3min, pre-denatured at 94 ℃ for 30s, annealed at 57 ℃ for 30s, extended at 72 ℃ for 30s, amplified for 38 cycles, and finally extended at 72 ℃ for 10 min. The PCR amplification products were detected by electrophoresis on a 4% agarose gel. The presence of the corresponding marker is determined by banding pattern analysis, if the banding tends to the parental heat research, the size of the rice sword leaf of the strain is larger, and if the banding tends to Huazhan, the size is smaller (fig. 6 and 7). And then comparing the actual angle of the leaf size of the test strain rice sword with the prediction result, and displaying the result that the prediction result is matched with the actual detection result.
The method comprises the following specific steps:
when a primer pair of molecular marker Indel Tal-1 is selected, the obtained electrophoretogram is shown in FIG. 6, the hot ground band is 1, the Huazhan band is 2, and F1The bands for the generations were 3, the bands for the RIL population were 3-11 (tending towards heat lapping);
when a primer pair of molecular marker Indel Tal-2 is selected, the obtained electrophoretogram is shown in FIG. 7, the hot ground band is 1, the Huazhan band is 2, and F1The bands for the generations were 3, the bands for the RIL population were 3-11 (tending towards heat lapping);
and according to the actual detection of the size of the sword leaf of the rice (detection is carried out in the period from the growth stage to the maturity stage of the rice): the area of the hot ground leaf was 31.14cm2The leaf area of Huazhan is 29.21cm2The leaf area of RIL is shown in FIG. 4 and is normally distributed;
therefore, the predicted result matches the actual detection result.
Example 5 application of rice leaf size QTL in rice breeding
The molecular marker set in example 4 can be applied to rice molecular assisted breeding, other rice varieties with smaller leaf size, such as 93-11, are hybridized with hot ground to obtain corresponding F1, and backcross is carried out by taking 93-11 as recurrent parent until BC3F1And (4) generation. Extraction of BC3F1Partial individual DNA generations were then PCR amplified using primers labeled with Indel Fls-1 and Fls-2 by banding patternAnalysis was performed to determine if the corresponding marker (QTL site) was present, indicating that the flag was present in the line with larger blade size (FIG. 8, FIG. 9). The method is used for screening and directional selection, so that the rice with large leaf size and 93-11 excellent characters can be obtained, and the breeding efficiency is greatly improved.
In conclusion, the multi-effect QTLs for regulating the size of the rice leaves can effectively increase the size of the rice sword leaves, effectively improve the photosynthetic efficiency of the rice in the breeding process and accelerate the process of optimizing rice varieties. Meanwhile, the rice with larger leaf size can be cultivated in the rice molecular assisted breeding process, and the rice plant type is optimized. The method is simple, convenient, feasible, safe and effective, is beneficial to improving the economic value of the rice variety, and is suitable for large-scale popularization and application.
Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.
Sequence listing
<110> university of chessman in Zhejiang
<120> molecular marker of multiple-effect QTLs locus qTLS-4 for regulating and controlling rice leaf size and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ccccgtccta taatatagca acc 23
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctctatactc actccgtccc a 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agatcccagg taatgatgcg a 21
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Claims (6)
1. The multiple-effect QTLs for regulating and controlling the size of the leaf of the rice sword leaf is characterized in that: the QTLs locus is positioned on the No. 4 chromosome DNA fragment of the rice and is named as qTLS-4, the genetic distance is 87.1-97.4cM, and the physical distance is 28747360-29507404 bp.
2. The qTLS-4 molecular marker of the multi-effect QTLs site for regulating the size of the leaf of the xiphoid leaf of rice as claimed in claim 1, wherein the qTLS-4 molecular marker comprises:
the qTLS-4 molecular marker comprises two pairs of molecular markers Indel Fls-1 and Indel Fls-2 which are closely linked;
the primer pair of the molecular marker Indel Fls-1 is as follows:
the upstream primer 5'-CCCCGTCCTATAATATAGCAACC-3' is the primer that is used,
a downstream primer 5'-CTCTATACTCACTCCGTCCCA-3';
the primer pair of the molecular marker Indel Fls-2 is as follows:
the upstream primer 5'-AGATCCCAGGTAATGATGCGA-3' is the primer that is used,
the downstream primer 5'-CGCGCAATCCAAATCCATCA-3'.
3. Use of multi-effect QTLs for regulating the size of the blades of a rice sword as claimed in claim 2 wherein: the molecular marking method is used for detecting whether the rice variety or strain has QTLs for regulating the size of the rice flag leaf, thereby accelerating the breeding process of the excellent rice variety.
4. Use of multi-effect QTLs according to claim 3, wherein: cultivating the rice with enlarged sword leaf blades, and optimizing the plant type of the rice; thereby improving the photosynthetic efficiency and promoting the yield and income increase of the rice.
5. Use of multi-effect QTLs according to claim 3 or 4, wherein:
extracting the genome DNA of the rice to be detected, and carrying out PCR amplification on the extracted genome DNA by using a primer pair of a molecular marker Indel Fls-1 or a primer pair of a molecular marker Indel Fls-2.
6. Use of multi-effect QTLs according to claim 5, wherein:
reaction system of PCR: upstream primer 1 uL, downstream primer 1 u L, DNA template 2 u L, Mix enzyme 5 u L, ddH2O 1μL；
The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min, pre-denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 30s, amplification for 38 cycles, and final extension at 72 ℃ for 10 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011053639.8A CN112126703B (en) | 2020-09-30 | 2020-09-30 | Molecular marker of multi-effect QTLs site qTLS-4 for regulating and controlling rice leaf size and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011053639.8A CN112126703B (en) | 2020-09-30 | 2020-09-30 | Molecular marker of multi-effect QTLs site qTLS-4 for regulating and controlling rice leaf size and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112126703A true CN112126703A (en) | 2020-12-25 |
| CN112126703B CN112126703B (en) | 2023-07-18 |
Family
ID=73843134
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011053639.8A Active CN112126703B (en) | 2020-09-30 | 2020-09-30 | Molecular marker of multi-effect QTLs site qTLS-4 for regulating and controlling rice leaf size and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112126703B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113122653A (en) * | 2021-05-31 | 2021-07-16 | 浙江师范大学 | Main effect QTL for regulating and controlling brown rice rate of rice, molecular marker and application |
| CN113151546A (en) * | 2021-04-02 | 2021-07-23 | 浙江师范大学 | Major QTL for regulating and controlling water potential of rice leaves, molecular marker and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103865925A (en) * | 2014-03-09 | 2014-06-18 | 中国水稻研究所 | Molecular marker of paddy rice flag leaf width controlling gene NAL1 and application thereof |
| CN109777886A (en) * | 2019-04-01 | 2019-05-21 | 浙江师范大学 | The molecular labeling of the main effect QTL site qTLA-9 of adjusting and controlling rice Leaf inclination and its application |
-
2020
- 2020-09-30 CN CN202011053639.8A patent/CN112126703B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103865925A (en) * | 2014-03-09 | 2014-06-18 | 中国水稻研究所 | Molecular marker of paddy rice flag leaf width controlling gene NAL1 and application thereof |
| CN109777886A (en) * | 2019-04-01 | 2019-05-21 | 浙江师范大学 | The molecular labeling of the main effect QTL site qTLA-9 of adjusting and controlling rice Leaf inclination and its application |
Non-Patent Citations (6)
| Title |
|---|
| MCCOUCH-S-R: "Oryza sativa Japonica Group SSR RM6909", 《GRAMENE》 * |
| TEMNYKH-S: "Oryza sativa Japonica Group SSR RM470", 《GRAMENE》 * |
| 刘丹等: "水稻第4号染色体上株型性状相关基因研究进展", 《种子》 * |
| 席同等: "基于籼稻RIL群体的剑叶形态QTL定位", 《华中农业大学学报》 * |
| 肖珂等: "控制水稻剑叶形态相关性状的数量基因位点(QTL)的定位", 《上海师范大学学报(自然科学版)》 * |
| 邵高能等: "水稻剑叶形态与稻米粒形QTL 分析及相应剩余杂合体衍生群体的构建", 《分子植物育种》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151546A (en) * | 2021-04-02 | 2021-07-23 | 浙江师范大学 | Major QTL for regulating and controlling water potential of rice leaves, molecular marker and application |
| CN113151546B (en) * | 2021-04-02 | 2023-05-16 | 浙江师范大学 | Main effect QTL for regulating and controlling water potential of rice leaves, molecular marker and application |
| CN113122653A (en) * | 2021-05-31 | 2021-07-16 | 浙江师范大学 | Main effect QTL for regulating and controlling brown rice rate of rice, molecular marker and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112126703B (en) | 2023-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| CN107129993B (en) | Modified glyphosate-resistant gene and cultivation method of glyphosate-resistant rice | |
| CN105695478B (en) | Gene for regulating plant type and yield of plant and application thereof | |
| CN112126703B (en) | Molecular marker of multi-effect QTLs site qTLS-4 for regulating and controlling rice leaf size and application thereof | |
| CN115843674A (en) | Breeding method of corn haploid induction line and application thereof | |
| CN108085320B (en) | Dominant early maturing gene Ef-cd of rice and application thereof | |
| CN107557437B (en) | Primer pair and method for identifying genotype of tobacco low-nicotine-content mutant filial generation | |
| JP4892648B1 (en) | New varieties, methods for distinguishing plant varieties, and methods for rapid development of rice individuals | |
| CN112501341B (en) | Major QTL for regulating heading stage of rice, molecular marker and application | |
| CN113122653B (en) | Main effect QTL for regulating and controlling brown rice rate of rice, molecular marker and application | |
| CN112375840B (en) | Major QTL for regulating and controlling resistance of rice sogatella furcifera, molecular marker and application | |
| CN116926117A (en) | Method for cultivating early maturing rice variety through gene editing | |
| CN106191263B (en) | QTL (quantitative trait locus) linked molecular marker for controlling corn female parent haploid to generate and application thereof | |
| Irish et al. | Rejuvenation by shoot apex culture recapitulates the developmental increase of methylation at the maize gene Pl-Blotched | |
| CN113462807B (en) | SNP molecular marker and application thereof in improving barley salt tolerance | |
| CN116694811B (en) | Molecular marker closely linked with wheat seedling stage seed root number QTL and application thereof | |
| CN115976045B (en) | Cotton GaTFL1 gene and application and identification method thereof | |
| CN110184383B (en) | Serial molecular markers and application thereof in wheat head germination gene molecular markers | |
| CN117512188A (en) | Molecular marker linked with major QTL for regulating and controlling rice seed setting rate and application | |
| CN116751808A (en) | Method for regulating and controlling flowering and maturation time of plant, biological material and application thereof | |
| Phuong et al. | Qtl analysis for flowering time using backcross population between Oryza sativa IR 36 and oryza rufipogon | |
| Yan et al. | High-Throughput Base Editing-Mediated Artificial Evolution Streamlines Trait Gene Identification in Rice | |
| CN117625832A (en) | Molecular marker linked with major QTL for regulating thousand grain weight of rice and application | |
| CN117016372A (en) | Method for creating excellent corn germplasm and application thereof | |
| CN116162646A (en) | Application of NtAITRs transcription factor family genes in regulation and control of stress resistance of tobacco |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20240119 Address after: 518000 1104, Building A, Zhiyun Industrial Park, No. 13, Huaxing Road, Henglang Community, Longhua District, Shenzhen, Guangdong Province Patentee after: Shenzhen Hongyue Enterprise Management Consulting Co.,Ltd. Address before: 321004 No. 688 Yingbin Avenue, Wucheng District, Zhejiang, Jinhua Patentee before: ZHEJIANG NORMAL University |