CN117701584A - OsGSL2 gene and application of mutant OsGSL2-1 thereof in regulation and control of male fertility of rice - Google Patents

Abstract

The invention relates to the technical field of plant biotechnology breeding, in particular to an application of an OsGSL2 gene and a mutant OsGSL2-1 thereof in regulating and controlling male fertility of rice. The invention mutates OsGSL2 gene in a fixed point in wild rice, and the mutant OsGSL2-1 can be formed normally, however, pollen fertility is reduced, and the regulation and control function of the OsGSL2 gene on male reproductive development of rice is discovered for the first time. The gene and the mutant thereof are utilized to realize the regulation and control on the development of the anther of the rice, and the common nuclear male sterile gene and sterile material resources of the rice are rapidly enriched, so that the promotion and the application of sterile breeding and seed production of the rice are promoted, the bottleneck problem that the rice seed industry is short of stable sterile lines of the rice and breakthrough large varieties for a long time can be effectively solved, and the method has important significance for researching the male reproductive development of the rice.

Description

OsGSL2 gene and application of mutant OsGSL2-1 thereof in regulation and control of male fertility of rice

Technical Field

The invention relates to the technical field of plant biotechnology breeding, in particular to an application of an OsGSL2 gene and a mutant OsGSL2-1 thereof in regulating and controlling male fertility of rice.

Background

Rice is one of the most important food crops in the world. With the growth of population and the improvement of life quality, the annual yield of the rice in 2050 is expected to be improved by 1-2 times so as to meet the requirement of human development. Hybrid rice is a child generation obtained after parent-parent hybridization, the yield of the hybrid rice is often improved by more than 15% compared with that of a conventional rice parent, and the resistance and the adaptability are far superior to those of the parent. Therefore, application and popularization of hybrid rice are an important way to increase rice yield.

The male sterile line is a key node of hybrid rice seed production technology. Male sterile line refers to a plant line in which male gametes are dysplastic and lose fertility and female gametes are normal. It can only be used as female parent to accept pollen of male parent, and selfing can not be firm. The male sterile line applied to the production of the hybrid rice at present has two types of nuclear-cytoplasmic interaction type and photo-thermo-sensitive type. The sterile gene of the nuclear-cytoplasmic interactive male sterile line is in cytoplasm and the nucleus has no fertility restoration gene. When the restoring line with fertility restoring gene in cell nucleus is hybridized with its matched group, it can produce the first generation hybrid seed, when the maintaining line without fertility restoring gene in cell nucleus and without sterile gene in cell cytoplasm is hybridized with it, it can reproduce the sterile line seed. The hybrid rice seed production technique is often called a three-line method because of the need of the matching of sterile line, maintainer line and restorer line. Several genes controlling nuclear cytoplasmic interactive sterility and corresponding fertility restoration have been cloned (Chen and Liu,2014,Male sterility and fertility restoration in crops,Annu Re v Plant Biol,65:579-606). The nuclear-cytoplasm interactive sterile line is the first sterile line applied on a large scale in hybrid rice seed production, and lays a material foundation for the establishment and development of hybrid rice industry. However, since the assembly of the cytoplasmic interactive sterile line is limited by the restorer genotype, only about 5% of the germplasm resources can be utilized. While cytoplasmic sterile genes have the potential to cause poor rice quality and the prevalence of specific diseases and pests.

The photo-thermo-sensitive male sterile line is a sterile line with fertility regulated by photo-thermo environment. The sterile line is kept sterile under a certain light temperature condition, and can be used for combined hybridization. When the conditions change, the sterile line restores fertility and can be used for sterile line propagation. Because the photo-thermo-sensitive male sterile line realizes the combination of the sterile line and the maintainer line, only the male parent is matched with the male parent to produce the first filial generation hybrid, so the corresponding breeding technology is often called a two-line method. Genes regulating photo-thermo-sensitive male sterility in nuclei, genes that have been cloned so far include PMS3, TMS5, CS A and TMS10 (Chen and Liu,2014,Male sterility and fertility resto ration in crops,Annu Rev Plant Biol,65:579-606;Zhou H,et al,2014,RNase ZS1 processes UbL40 mRNAs and controls thermosen sitive genic male sterility in rice,Nature Communications,5:4884-4892). Compared with the nuclear-cytoplasmic interactive sterile line, the photo-thermo-sensitive sterile line has simple propagation procedure and more free matching due to the wide existence of the restoring gene. The large-scale application of photo-thermo-sensitive sterile line greatly consolidates and promotes the development of hybrid rice industry. However, the fertility of the sterile line is affected by the light and temperature environment, so that the risk of seed production is high, and the seed production region is limited.

In order to overcome the key defects existing in the current hybrid rice seed production technology, the creation and utilization of a new type of sterile line is an important break. The nuclear male sterility is generated by nuclear gene mutation, and has dominant mutation, recessive mutation, sporophyte gene mutation and gametophyte gene mutation. Dominant mutations and gametophytic gene mutations can only be inherited through female gametes, recessive mutations can be inherited through both female gametes and male gametes, and follow Mendelian's law.

Callose synthases are polysaccharides consisting mainly of beta-1, 3-glucan, providing structural support and protection to plant cells. The deposition of callose occurs in a wide range of biological processes, from the development of plant environmental stress reactions. Callose synthases accumulate in the cell wall of dividing cells prior to cell wall formation, and callose accumulates internally on the surface of the wall adjacent to the plasma membrane during plant stress. Furthermore, callose is present in phloem sieve pores, which is the primary channel that mediates the long-range movement of signaling molecules and nutrients. Callose is also thought to be located in the neck of plasmodesmata and regulates inter-cell communication. The CRISPR/Cas9 gene editing technology is more and more widely applied to the aspects of plant gene function research, crop genetic improvement, breeding and the like due to the characteristics of low cost, simple operation, high mutation induction rate and the like, and has very broad application prospect.

Compared with the mode crop rice, the mode plant arabidopsis thaliana has relatively fewer cloned and identified common nuclear male sterile genes and created male sterile materials in the rice.

Disclosure of Invention

The invention provides a plant fertility regulating gene OsGSL2 and a recessive nuclear sterile type male sterile line based on the gene mutation. The sterile line has stable fertility, is only regulated and controlled by a single gene of nuclear coding, and is not influenced by light temperature environment. The fertility restorer gene of the sterile line is widely existed in rice germplasm resources, and can restore fertility by transferring wild type genes. The gene and the sterile line generated by the mutation of the gene provide elements for developing novel hybrid seed production technology of rice, and lay a foundation for solving the problems existing in the prior art.

Based on this, the following summary is specifically proposed.

In a first aspect, the invention provides a mutant, which is a rice OsGSL2 gene mutant OsGSL2-1, and the nucleotide sequence of the mutant is shown as SEQ ID NO. 4.

The gene mutant OsGSL2-1 is that the wild OsGSL2 gene is deleted from 59 th base to 61 th base from the start codon ATG.

In a second aspect, the invention provides sgRNA of a targeted rice OsGSL2 gene, and the target site sequence of the sgRNA is shown as SEQ ID NO. 3.

In a third aspect, the present invention provides a biological material comprising the rice OsGSL2 gene mutant OsGSL2-1 or sgRNA according to any one of the above aspects.

Preferably, the biological material is at least one of recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, an engineering bacterium, or a non-regenerable plant part.

In some embodiments, the non-regenerable plant portion comprises a plant cell, a plant tissue; the plant cells or plant tissue cannot develop into an intact plant individual.

Preferably, the biological material is a CRISPR/Cas system targeting vector containing sgrnas specifically targeting the target site.

In a fourth aspect, the invention provides a target site (B1 for short) for gene editing of rice OsGSL2 genes by using a CRISPR/Cas system, and the sequence of the target site is shown as SEQ ID NO. 3.

The target site is designed at the 1 st exon of the rice OsGSL2 gene.

In a fifth aspect, the present invention provides uses of a rice OsGSL2 gene and its encoded protein, a rice OsGSL2 gene mutant and its encoded protein, the sgRNA, the biological material, and the target site in at least one of the following:

(1) Regulating and controlling male fertility traits of rice;

(2) Crossbreeding and seed production of rice;

(3) Breeding rice sterile line;

(4) Improving rice germplasm resources;

the amino acid sequence encoded by the rice OsGSL2 gene is any one of the following:

an amino acid sequence shown in SEQ ID NO. 2;

an amino acid sequence of SEQ ID NO.2 which has the same biological function as the SEQ ID NO.2 sequence through the substitution and/or deletion and/or addition of one or more amino acid residues.

Preferably, the nucleotide sequence of the rice OsGSL2 gene is shown as SEQ ID NO. 1.

Preferably, the rice OsGSL2 gene mutant is a nucleotide mutation type of which any base mutation of wild rice OsGSL2 gene exon causes amino acid mutation and/or protein dysfunction so as to cause male sterile phenotype.

Preferably, the rice OsGSL2 gene mutant is the above gene mutant OsGSL2-1.

Preferably, the cross breeding and seed production comprises: hybridization is carried out between the OsGSL2 male sterile line serving as a female parent and a male parent of a target material to obtain an F1 generation, and backcross is carried out between the F1 generation and the target material, so that the backcross offspring can obtain the character and the gene mutation of the OsGSL2 male sterile.

In some embodiments, the improvement comprises increasing crop yield, increasing crop quality, increasing crop pest resistance, stress resistance, lodging resistance.

In a sixth aspect, the present invention provides a method for creating a male sterile line of rice, comprising: inhibiting expression and/or activity of a rice OsGSL2 gene in a rice plant;

the amino acid sequence encoded by the rice OsGSL2 gene is any one of the following:

an amino acid sequence shown in SEQ ID NO. 2;

an amino acid sequence of SEQ ID NO.2 which has the same biological function as the SEQ ID NO.2 sequence through the substitution and/or deletion and/or addition of one or more amino acid residues.

Preferably, the method comprises inhibiting expression and/or activity of a rice OsGSL2 gene using a CRISPR/Cas system.

Preferably, the method comprises editing the target region shown in SEQ ID NO.3 of the rice OsGSL2 gene by using a CRISPR/Cas system to inhibit expression and/or activity of the rice OsGSL2 gene.

The CRISPR/Cas system in the present invention is preferably a CRISPR/Cas9 system.

In a seventh aspect, the present invention provides a method for creating a male sterile line of rice, comprising: the rice male sterile line of the gene mutant osgsl2-1 is used as a parent and hybridized with a receptor with normal fertility, and the obtained F1 generation is backcrossed with the receptor with normal fertility to prepare the rice male sterile line.

Compared with the prior art, the invention has the beneficial effects that:

the invention discovers that the rice OsGSL2 (LOC_Os01g 48200) gene and the coded protein thereof can regulate and control the male reproductive development process of rice. The invention utilizes the gene and the mutant thereof to realize the regulation and control of the anther development of the rice, and rapidly enriches the common nuclear male sterile gene and sterile material resources of the rice, thereby promoting the sterile breeding of the rice and the popularization and application of seed production, and finally effectively solving the bottleneck problem of the long-term lack of stable sterile line and breakthrough large variety of the rice in the rice seed industry.

Drawings

FIG. 1 is a structural diagram of OsGSL2 gene.

FIG. 2 is a diagram showing the expression pattern of OsGSL2 gene.

FIG. 3 is a pattern diagram of site-directed mutagenesis target sites.

FIG. 4 is T ₀ Agarose gel electrophoresis diagram for detecting hygromycin of rice.

FIG. 5 is T ₀ Map of generation rice mutation types.

FIG. 6 is T ₀ Generation of rice mutant sequencing peak patterns.

FIG. 7 is T ₀ Anther morphology and pollen iodine staining pattern of the rice mutant.

FIG. 8 is T ₀ Generation of rice mutant spike figure.

FIG. 9 is a molecular marker detection osgsl2-1 offspring isolation diagram.

FIG. 10 is a technical scheme of hybridization transformation.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The examples are not intended to identify the particular technology or conditions, and are either conventional or are carried out according to the technology or conditions described in the literature in this field or are carried out according to the product specifications. The reagents and instruments used, etc. are not identified to the manufacturer and are conventional products available for purchase by regular vendors.

EXAMPLE 1 analysis of OsGSL2 Gene sequence and expression Pattern of Rice

In Ensembl Plants library (http:// Plants. Ensembl. Org/index. Html), the rice OsGSL2 (LOC_Os01g 48200) gene is queried, the nucleotide sequence in japonica rice is shown as SEQ ID NO.1, the gene function annotation is callose synthase (callose synthase), the coding protein of the gene comprises 469 amino acids, and the sequence is shown as SEQ ID NO. 2.

As the actual function of the OsGSL2 gene in rice has not been disclosed, in order to study the relation between the gene and the male reproductive development of rice, the invention firstly utilizes a gene expression database to analyze the expression patterns of the gene at different tissue parts of rice (figure 2), and the expression analysis result shows that the OsGSL2 gene is highly expressed in the spike stage of rice.

Example 2 function of Rice OsGSL2 Gene and creation of Rice Male sterile line Using CRISPR/Cas9 method

In order to determine the function of the rice OsGSL2 in rice, the embodiment adopts a CRISPR/Cas9 gene editing method to mutate LOC_Os01g48200 gene sequence in a site-specific manner, and knock out the function of the gene in rice. In this example, the conventional rice flower 11 of rice was selected as a receptor material for gene editing. The sequence shown in SEQ ID NO.3 of the 45 th base to the 64 th base of the coding region of the gene starting from the ATG of the start codon is respectively selected as a target region 1 (B1 for short) for CRISPR/Cas9 gene editing (see figure 1).

1. Construction of CRISPR/Cas9 gene editing vector of OsGSL2

The gene editing vector of this example was pEGCas9Pubi-B-OsGSL2 (see FIG. 3 for vector map), and the basic vector of the vector was pEGCas9Pubi-B. In the embodiment, MT-sgRNA is obtained by designing a target point on a primer and then obtaining the MT-sgRNA by PCR and is further connected into a basic vector by a one-step cloning method, and the specific construction flow is as follows:

(1) Design of target gRNA. The gene sequence of OsGSL2 (LOC_Os01g 48200) is input into https:// zlab. Bio/guide-design-resources for target design, and the PAM sequence is set as NGG. The DNA sequence of the target region selected in this example is shown in SEQ ID NO.3 (GAGCAGAGACGTTTATAGAC).

(2) The sgRNA expression cassette was amplified by overlap PCR and nested PCR. Synthesizing a primer pair containing the sgRNA target sequence, annealing the primer pair, and connecting the primer pair with a binary vector pEGCas9Pubi-B subjected to Bsa I digestion to obtain a recombinant vector pEGCas9Pubi-OsGSL2. The recombinant vector pEGCas9Pubi-OsGSL2 was transformed into escherichia coli dh5α, and positive clones were selected for sequencing, a method in specific step references "Xing, h.l., dong, l., wang, z.p., zhang, h.y., han, c.y., liu, b., wang, x.c., and Chen, q.j. (2014) ACRISPR/Cas9 toolkit for multiplex genome editing in plants.bmc plant biology 14:327.

(3) And (5) sequencing and verification.

2. Agrobacterium-mediated genetic transformation of rice

Transferring the pEGCas9Pubi-OsGSL2 vector into agrobacterium EHA105 by a heat shock method, and adding glycerol to preserve bacterial liquid at-80 ℃ after PCR identification. Taking young embryos of flowers 11 in a freshly stripped rice hybrid of about 1.5mm as a receptor material, placing the stripped rice embryos into 2mL plastic centrifuge tubes containing 1.8mL suspension for not more than 1 hour, and placing about 100 young embryos into each centrifuge tube; the suspension was aspirated and the young embryos were rinsed 2 times with fresh suspension, the bottom of the tube remained a small amount of suspension that could have passed through the young embryos, then heat shock was applied at 43℃for 2 minutes, followed by an additional ice bath for 1 minute, the bottom residual wash was aspirated with a pipette, and 1.0mL of Agrobacterium infestation was added, gently shaken for 30 seconds, and then allowed to stand in the dark for 8 minutes. Pouring the young embryo and the infection liquid in the centrifuge tube into a co-culture medium, shaking uniformly, sucking out excessive infection liquid by using a pipetting gun, and co-culturing in darkness at 23 ℃ for 3 days with scutellum of all young embryos facing upwards. After the co-cultivation is finished, the young embryo is transferred to a recovery culture medium by sterile forceps, and is cultivated for 7-14 days at 28 ℃, and the young embryo growing on the young embryo needs to be removed in time in the middle process. After the recovery culture, the young embryo is placed on 1.5mg/L biamphos screening medium for screening and culturing for 3 rounds, each round of screening for 2 weeks, and then transferred to 2mg/L biamphos screening medium for screening and culturing for 2 rounds, and each round of screening for 2 weeks. The resistant calli were transferred to expansion medium and dark cultured for 2 weeks at 28 ℃. The propagated resistant calli were then transferred to induction medium and incubated for 2 weeks at 28℃in the dark. Then transferred to a differentiation medium, cultured at 25℃and 5000lx under light for 2 weeks. After the cultivation is finished, single seedlings are separated from the differentiated seedling clusters and placed in a rooting medium, and the seedlings are subjected to illumination cultivation at 25 ℃ and 5000lx until rooting; transferring the young seedling into a small nutrition pot for growth, transplanting the young seedling into a greenhouse after the young seedling survives growth, and harvesting offspring seeds after 3-4 months.

3、T ₀ CRISPR/Cas9 mutation result detection of generation plants

To determine T ₀ The CRISPR/Cas9 mutation result of the generation plant is carried out by adopting the following steps:

firstly, extracting rice leaf DNA by adopting a CTAB method, and specifically comprises the following steps: the DNA extraction method is carried out with reference to the conventional CTAB method (Rogers and Bendich, 1985). Placing 3cm rice leaf into a sterilized 2mL centrifuge tube, adding 6mm steel ball, performing tissue disruption with cell disruption instrument, performing CTAB extraction, and adding 200 μl of sterilized water (ddH) ₂ O), dissolving the air-dried sample DNA for later use. After complete DNA solubilization, 2. Mu.L of the sample was aspirated and the OD (A260/A280) and concentration of nucleic acid was determined using an ultraviolet spectrophotometer (Nanodrop 2000) and the DNA sample was diluted to 50 ng/. Mu.L for use.

Positive detection primer: hn; product size: 561bp; the primer sequences were as follows:

Hn-F(SEQ ID NO.9):5’CTTAGCCAGACGAGCGGGTTC 3’；

Hn-R(SEQ ID NO.10):5’GCTTCTGCGGGCGATTTGT 3’；

the positive detection result is shown in FIG. 4, negative control H ₂ O and ZH11 are free of bands, positive plasmid is controlled to amplify 561bp fragment, T ₀ The detection results of the generation plants are positive, so that the genotypes can be further detected. The mutant genotypes were amplified and detected according to the following PCR parameters:

PCR was performed using a2 XPCR premix of Biomiga (Mg-containing ²⁺ The method comprises the steps of carrying out a first treatment on the surface of the Taq DNA Polymerase;2.5mM dNTPs;10 XPCR Buffer) 5. Mu.L, 1. Mu.L of primers (containing 0.5. Mu.L of forward and reverse primers, 10. Mu. Mol/L each), 1. Mu.L of template DNA, ddH ₂ O makes up 10. Mu.L. The PCR amplification procedure was a conventional SSR procedure (94 ℃ C.Pre-denaturation for 5min, denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 72℃for 30s, amplification for 35 cycles, and extension at 72℃for 5 min. The amplified product was subjected to 6% non-denaturing polyacrylamide gel electrophoresis, 0.1% AgNO ₃ After dyeing, formaldehyde and NaOH chromogenic photographing, genotype statistics is carried out, and finally 3T's are found ₀ The sequence of the transformation event target region is changed, the phenotype is different, the sequence before and after editing is shown in figure 5, corresponding to 3OsGSL2 mutants: osgsl2-1, osgsl2-2 and osgsl2-3.

Comparing the nucleotide sequences in 3OsGSL2 mutants (shown in figures 5 and 6), compared with the unedited WT, the mutated strains OsGSL2-1, osGSL2-2 and OsGSL2-3 have the deletion of the coded nucleotide at the target, and the sequence of the OsGSL2-1 is shown as SEQ ID NO.4 from the 59 th base to the 61 th ATA base of the initiation codon ATG; the osgsl2-2 is deleted from the 59 th base to the 63 th base of the ATG of the initiation codon, and the 55 th base to the 64 th base of the complementary strand GTTTATAGAC is deleted, and the sequences are shown as SEQ ID NO.5 and SEQ ID NO. 6; the osgsl2-3 is deleted from the 42 th base to the 60 th base TTTGAGCAGAGACGTTTAT from the ATG of the initiation codon, and the base A of the complementary strand 62 is deleted, and the sequences are shown as SEQ ID NO.7 and SEQ ID NO. 8.

Deletion of the nucleotides encoded in the mutated lines osgsl2-1, osgsl2-2 and osgsl2-3 results in a frame shift of the amino acids and in premature termination of the amino acid translation. Thus, the LOC_Os01g48200 protein functions of the transformants were deleted.

EXAMPLE 3 phenotypic analysis of OsGSL2 sterile lines

Observation of tassel, anther and pollen Activity of OsGSL2 sterile line

Plants of the OsGSL2 sterile lines (OsGSL 2-1, osGSL2-2 and OsGSL 2-3) were substantially unchanged from the wild type in terms of vegetative growth and tassel development; in the aspect of tassel development, wild type can normally perform tassels, anthers can normally crack and scatter powder, and can normally set after selfing, while an OsGSL2 sterile line can normally perform tassels and can also perform normal flowering, but OsGSL2-1 anthers are shrunken, lean and white, osGSL2-2 and OsGSL2-3 anthers are shrunken, lean and white (figure 7); further to wild type and mutantPollen process I ₂ KI staining, normal development of wild type pollen, black after pollen grain staining, while 99% of the mutant osgsl2-1 pollen grains failed to stain, 100% of the osgsl2-2 pollen grains failed to stain, osgsl2-3 no pollen grains (fig. 7). The seed setting rate is counted by taking the snapping seeds in the mature period, the wild ZH11 seed setting is normal, and the seed setting rate is more than 90%; the selfing setting rate of the mutant osgsl2-1 is about 1%; the selfing rates of the mutants osgsl2-2 and osgsl2-3 were about 0% (FIG. 8). This suggests that the OsGSL2 (LOC_Os01g 48200) gene controls male development of rice by affecting male gamete development of anthers.

Example 4 Co-segregating molecular marker development and application of OsGSL2 sterile line identification

1. Development of co-segregating molecular markers

Aiming at the mutation sites of the three obtained OsGSL2 sterile lines, a pair of co-segregation molecular markers are developed: GSL2-F1 (SEQ ID NO. 11) and GSL2-R1 (SEQ ID NO. 12) are combined with PCR, agarose and non-denaturing polyacrylamide gel electrophoresis (PAGE) and agarose gel electrophoresis detection methods, and the genotypes of the mutants can be separated according to the obtained bands and sizes.

As shown in FIG. 9, the coseparation molecular marker GSL2-F1/R1 can specifically detect mutant gene OsGSL2 in rice OsGSL2-1 homozygous mutant and rice sterile material transformed by the same, and can distinguish wild type OsGSL2 gene and mutant type OsGSL2 gene at the same time; a233 bp band was amplified for the mutant gene OsGSL2, while a 236bp band was amplified for the wild-type OsGSL2 gene.

2. Application of co-separation molecular marker

In theory, GSL2-F1/R1 can amplify 236bp band in OsGSL2/OsGSL2 homozygous wild type (AA) DNA, 233bp band in OsGSL2-1/OsGSL2-1 homozygous mutant material (AA) DNA, and two corresponding bands in OsGSL2/OsGSL2-1 heterozygous material (AA) can be amplified simultaneously. The result of the T clone verification of the GSL2-F1/R1 molecular marker is shown in figure 9, and the result shows that the detection result of the designed functional molecular marker on the segregating population completely accords with the expectation, and the corresponding size strips are respectively amplified in the OsGSL2/OsGSL2 homozygous wild type (AA), the OsGSL2/OsGSL2-1 heterozygous type (AA) and the OsGSL2-1/OsGSL2-1 homozygous mutant type material (AA), and can be used as ideal markers for the detection of the OsGSL2 allele.

EXAMPLE 5 sterile line transfer of OsGSL2 mutant Gene

Hybridization, backcrossing and selfing are carried out by using the OsGSL2 mutant and receptors with normal fertility, such as Bo II B and wild incense B, and molecular markers are used for carrying out OsGSL2 gene and genetic background selection in the process, so that the recessive nuclear sterile line with homozygous OsGSL2 mutant genes under the background of Bo II B and wild incense B is finally obtained. The technical route of hybridization transformation is shown in fig. 10, and the specific implementation steps are as follows:

1. hybridization of acceptor parents, such as Bo II B and wild incense B, as male parent and female parent OsGSL2 to obtain F ₁ 。

2. By F ₁ Obtaining BC by backcrossing the female parent and the receptor parent, such as Bo II B and Ledebouriella sessilifolia B ₁ F ₁ 。

3. Planting BC ₁ F ₁ Detecting the genotype of the OsGSL2 by using primer pairs with primer sequences shown as SEQ ID No.11-12 respectively, and selecting the heterozygous genotype of the OsGSL2, namely, simultaneously generating 233bp and 236bp bands of PCR amplified products.

4. And (3) carrying out genetic background identification on the single plants selected in the step (3) by using a group of genotypes (such as 200) with polymorphism between the OsGSL2 mutant and recurrent parent and uniformly distributed molecular markers (including but not limited to SSR, SNP, INDEL, EST, RFLP, AFLP, RAPD, SCAR type markers), and selecting plants with high similarity (such as more than 88% similarity or 2% medium selection rate) with the recurrent parent genotypes.

5. Backcrossing the plant selected in step 4 with recipient parents, such as Bo II B and Ledebouriella sessilifolia B, to obtain BC ₂ F ₁ 。

6. Planting BC ₂ F ₁ Repeating the steps 3 and 4, selecting plants with high recovery rate (such as more than 98% or 2% selection rate) of the genetic background by heterozygous OsGSL2 genotype, and collecting the selfing seeds BC ₂ F ₂ 。

7. Planting BC ₂ F ₂ Repeating the step 3 and the step 4, and selecting the plant with highest homozygous rate of the genetic background and heterozygous OsGSL2 genotypeSelfing seed BC ₂ F ₃ 。BC ₂ F ₃ The homozygous strain of the OsGSL2 separated in the offspring is the sterile line of the OsGSL2 gene.

The above embodiment only uses Bo II B and wild incense B as transformation examples, but is not limited to Bo II B and wild incense B, and can be any rice material.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims (10)

1. A mutant is characterized in that the mutant is a rice OsGSL2 gene mutant OsGSL2-1, and the nucleotide sequence of the mutant is shown as SEQ ID NO. 4.

2. The sgRNA of the targeted rice OsGSL2 gene is characterized in that the target site sequence is shown as SEQ ID NO. 3.

3. A biological material comprising the rice OsGSL2 gene mutant OsGSL2-1 of claim 1 or the sgRNA of claim 2.

4. The biomaterial of claim 3, wherein the biomaterial is at least one of a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, an engineering bacterium, or a non-renewable plant part.

5. A target site for carrying out gene editing on a rice OsGSL2 gene by using a CRISPR/Cas system is characterized in that the sequence of the target site is shown as SEQ ID NO. 3.

6. Use of a rice OsGSL2 gene and its encoding protein, a rice OsGSL2 gene mutant and its encoding protein, a sgRNA according to claim 2, a biological material according to claim 3 or 4, a target site according to claim 5 in at least one of the following:

(1) Regulating and controlling male fertility traits of rice;

(2) Crossbreeding and seed production of rice;

(3) Breeding rice sterile line;

(4) Improving rice germplasm resources;

the amino acid sequence encoded by the rice OsGSL2 gene is any one of the following:

an amino acid sequence shown in SEQ ID NO. 2;

an amino acid sequence of SEQ ID NO.2 which has the same biological function as the SEQ ID NO.2 sequence through the substitution and/or deletion and/or addition of one or more amino acid residues.

7. A method for creating a male sterile line of rice, comprising: inhibiting expression and/or activity of a rice OsGSL2 gene in a rice plant;

the amino acid sequence encoded by the rice OsGSL2 gene is any one of the following:

an amino acid sequence shown in SEQ ID NO. 2;

an amino acid sequence of SEQ ID NO.2 which has the same biological function as the SEQ ID NO.2 sequence through the substitution and/or deletion and/or addition of one or more amino acid residues.

8. A method for creating a male sterile line of rice, comprising: the rice male sterile line of the gene mutant osgsl2-1 is used as a parent and hybridized with a receptor with normal fertility, and the obtained F1 generation is backcrossed with the receptor with normal fertility to prepare the rice male sterile line.

9. The method according to claim 7, comprising: the CRISPR/Cas system is utilized to edit a target area shown in SEQ ID NO.3 of the rice OsGSL2 gene so as to inhibit the expression and/or activity of the rice OsGSL2 gene.

10. The method of claim 9, wherein the CRISPR/Cas system is a CRISPR/Cas9 system.