CN117802148A

CN117802148A - Method for regulating rice plant type

Info

Publication number: CN117802148A
Application number: CN202311858445.9A
Authority: CN
Inventors: 周建平; 张勇; 郑雪莲; 唐旭
Original assignee: University of Electronic Science and Technology of China
Current assignee: University of Electronic Science and Technology of China
Priority date: 2023-12-30
Filing date: 2023-12-30
Publication date: 2024-04-02

Abstract

The invention belongs to the technical field of plant biology, and particularly relates to a method for regulating and controlling rice plant types through pri-miRNA coding peptides. The invention aims to provide a new choice for regulating and controlling rice plant types. The technical scheme of the invention is that the method for regulating the rice plant type by the pri-miRNA coding peptide is realized by blocking or weakening the expression of the pri-miRNA coding peptide gene OsmiPEP162a in rice. The invention provides rice pri-miRNA coding peptides (miPEP) which can be used for regulating and controlling plant types; the oryza sativa miPEP gene (OsmiPEP 162 a) was knocked out to obtain an edited mutant with altered strain.

Description

Method for regulating rice plant type

Technical Field

The invention belongs to the technical field of plant biology, and particularly relates to a method for regulating and controlling rice plant types.

Background

The plant type is the comprehensive expression of agronomic characters and mainly comprises plant height, tillering, leaf shape, leaf included angle, spike characteristics and the like. The plant type is one of the core factors for determining the yield of crops such as rice and the like, and is an important index for variety breeding. Especially, the plant height is not only a key factor of adapting crops to different environments, but also the most important factor of crop yield and lodging resistance. At present, 21 rice plant type related genes are recorded/annotated by the national rice data center, wherein 18 genes belong to hormone biosynthesis and signal pathway genes (https:// www.ricedata.cn/gene/gene_sd.htm) of gibberellin, brassinolide, strigolactone and the like.

MicroRNA (miRNA) is an endogenous small RNA of 20-24 nucleotides in length, a very important post-transcriptional regulator that regulates gene expression by inducing target gene mRNA degradation or preventing target gene translation processes. Previous studies considered that the primary transcript pri-miRNA derived from the mature miRNA was a non-protein coding RNA. However, recent studies in arabidopsis have shown that: a small open reading frame exists in the partial miRNA primary transcript pri-miRNA sequence and is capable of encoding a functional polypeptide (mipp). Studies have shown that the expression of miPEP is positively correlated with the expression of miRNAs, which shuttles back from the translated cytoplasm to the nucleus, specifically enhancing the transcription of its pri-miRNAs and thus increasing the accumulation of the corresponding mature miRNAs without affecting the expression of other miRNAs in the other and even the same family. The activity and specificity of the mipp depend on its coding sequence (miORF), and the mipp cannot induce transcription of the pri-miRNA after deletion of the miORF in the pri-miRNA. miPEP changes the expression pattern of a target gene by regulating the expression of the corresponding miRNA, thereby participating in the regulation of the growth and development of plants, the regulation of secondary metabolites and the stress response. Currently, it is known from the public database (miRBase, http:// www.mirbase.org) that there are 600 or more pri-miRNAs in rice genome, and whether these pri-miRNAs have ORFs actually encoding protein peptides and whether rice mipps regulating plant types exist or not has not been studied.

Disclosure of Invention

The invention aims to provide a new choice for regulating and controlling rice plant types.

The technical scheme of the invention is a method for regulating and controlling rice plant types, which is realized by blocking or weakening expression of a pri-miRNA coding peptide gene OsmiPEP162a in rice.

Specifically, the regulation of the rice plant type is to reduce the plant height and/or increase the tiller number.

Furthermore, the blocking or weakening of the expression of the pri-miRNA encoding peptide gene OsmiPEP162a in rice is achieved by knocking out the OsmiPEP162a gene or interfering with the expression of the OsmiPEP162a gene.

Wherein, the method for knocking out the OsmiPEP162a gene is at least one of a genome editing method, a homologous recombination method or a random insertion mutation method.

Still further, the genome editing method includes at least one of meganuclease method, ZFN method, TALEN method, or CRISPR-Cas method.

In particular, the CRISPR-Cas method comprises the steps of:

a. designing sgRNA aiming at an OsmiPEP162a gene;

b. constructing a Cas editing expression vector for expressing sgRNA;

c. the Cas editing expression vector is transformed into rice.

Wherein the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

In particular, the sgRNA sequence is shown in SEQ ID No. 1.

Preferably, the expression vector is pZHY988.

Specifically, in the step c, the transformed rice adopts an agrobacterium-mediated transformation method.

The invention also provides a method for regulating seed traits by blocking or weakening expression of a pri-miRNA encoding peptide gene OsmiPEP162a in rice.

Further, the negative regulation is achieved by blocking or weakening expression of the pri-miRNA encoded peptide gene OsmiPEP162a in rice.

In particular, the CRISPR-Cas method comprises the steps of:

a. designing sgRNA aiming at an OsmiPEP162a gene;

b. constructing a Cas editing expression vector for expressing sgRNA;

c. the Cas editing expression vector is transformed into rice.

Wherein the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

In particular, the sgRNA sequence is shown in SEQ ID No. 1.

Preferably, the expression vector is pZHY988.

Specifically, the seed traits are seed length and width.

The invention also provides sgRNA aiming at the OsmiPEP162a gene, which is shown as SEQ ID No. 1.

Further, the sgrnas are suitable for use in CRISPR-Cas9 gene editing systems.

The invention also provides a vector for expressing the sgRNA aiming at the OsmiPEP162a gene.

Further, the vector is an expression vector.

Preferably, the expression vector is pZHY988.

The invention also provides application of the sgRNA or a vector expressing the sgRNA aiming at the OsmiPEP162a gene in regulation of rice plant type or seed property.

The invention has the beneficial effects that: the invention provides rice pri-miRNA coding peptides (miPEP) which can be used for regulating plant types. Based on a protoplast transient expression system, the miPEP capable of really encoding the protein is screened and identified, and meanwhile, a gene editing system is used for directionally editing the miPEP gene. The result shows that the rice miPEP gene (OsmiPEP 162 a) is knocked out, and the edited mutant with changed strain type is obtained. The invention provides ideal materials for researching the function of the rice OsmiPEP162a gene. Meanwhile, the invention also provides a basis for providing accurate targets for directional editing and breeding of rice.

Drawings

FIG. 1 analysis of pri-miRNA in rice. There are 380 pri-mirnas without polypeptide annotation in the MSU and RAP-DB databases, 224 pri-mirnas with polypeptide annotation in total.

FIG. 2 is a schematic diagram of a portion of a transient miPEP expression vector. (a) a backbone carrier; (b) a mipp transient expression vector.

FIG. 3 is a partial schematic representation of the transient expression profile of a pri-miRNA fusion fluorescent protein. The negative control is a skeleton carrier pLSD298; positive control pZHZ669 vector (GFP activated by pZmUbi 1).

Fig. 4 is a schematic diagram of CRISPR-Cas9 directed knockout vector structure targeting mipp 162a. (a) a backbone vector pZHY988; (b) A mipp-directed knockout vector constructed based on CRISPR-Cas9 system.

FIG. 5OsmiPEP162a knockout mutant phenotype map. (a) OsmiPEP162a mutant genotype. Underlined refers to sgRNA position, red letter is PAM site, lowercase blue letter is inserted base; (b) An OsmiPEP162a mutant OsmiPEP162a-KO-1 amino acid sequence alignment; (c) osmipp 162a mutant strain height, scale = 20cm; (d) a plant height statistical chart of the OsmiPEP162a mutant; (e) Osmipp 162a mutant seed size plot, scale = 1cm.

Detailed Description

In order to achieve plant type regulation of rice, applicant chooses to achieve this by pri-miRNA in rice. After preliminary analysis of 604 pri-miRNA sites in rice by the public database, 20 subjects were initially identified. In the initial screening, in order to shorten the research period, the applicant constructed a vector suitable for transient expression, and performed protoplast transformation, a clear fluorescent signal was observed in 10 pri-miRNA transformants, indicating that the miPEP could be expressed. According to the result of transient expression, pri-miR162a was selected for subsequent testing.

To confirm its function, the applicant considered knocking out its expression to conduct experiments. The expression mode of knockout can be selected from genome editing method, homologous recombination method or random insertion mutation method. In one embodiment, the CRISPR-Cas9 system is selected to knock out the pri-miR162 a. The constructed knockout expression vector is transformed into rice, the plant height of the obtained mutant plant is reduced, the tillering number, the length and the width of the seed are all increased, but other agronomic characters such as small spike number, fruiting rate and the like are not obviously changed. This suggests that pri-miR162a may be involved in the regulation of rice plant types.

Example 1OsmiPEP transient expression

According to the recorded rice miRNA sites in the miRBase database, the pri-miRNA annotated with the polypeptide in the rice genome is searched in MSU (http:// rice. Uga. Edu /) and RAP-DB (https:// rapdb. Dna affrc. Go. Jp /) databases. There are a total of 604 pri-mirnas in rice, 224 pri-mirnas were found to have polypeptide annotations, accounting for 37% of all pri-mirnas, and 380 pri-mirnas were found to have no polypeptide annotations, accounting for 63% of all pri-mirnas (fig. 1).

Construction of transient expression vector

Transient expression vector construction pLSD298 was used as the backbone vector (fig. 2). The corn ubiquitin promoter ZmUbi1 is a strong expressed constitutive promoter and is used for driving the expression of a target gene; the cauliflower mosaic virus promoter (p 35S) drives the expression of hygromycin resistance genes, and the hygromycin resistance genes are used for screening resistant rice callus.

Rice pri-miRNA sequences are retrieved and downloaded from MSU (http:// price. Uga. Edu /) and RAP-DB (https:// rapdb. Dna. Affrc. Go. Jp /).

Firstly, analyzing all 604 rice pri-miRNAs, and selecting pri-miRNAs with annotated ORFs for further analysis; secondly, the progress of the research on the formation of mature miRNA by the pri-miRNA with the annotated ORF is examined, and finally 21 pri-miRNAs are selected for the next experiment. Primers (MIR 162a-F: gttgtttggtgttacttCTGCAGcctgcaggAGAAAGATTCCTAGTCCTCCTCTC; MIR162a-R: gTGAACAGCTCCTCGCCCTTGCTCACCATACAAGCACCGAGCATATAATTGATA) were synthesized separately for the precursor pri-miRNA (transcription initiation to before the coding peptide termination codon) sequence and GFP (no ATG) sequence of OsMIR162a, and amplified by PCR of a partial sequence of pri-miRNA and GFP sequence without initiation codon ATGThe system (50. Mu.L) was as follows: 10X KOD Plus Neo Buffer. Mu.L, 2mM dNTPs 5. Mu.L, mg ²⁺ 3μL，KOD-Plus-Neo 1μL，Primer-Forward 1μL，Primer-Reverse1μL，template 1μL，ddH ₂ O33. Mu.L. The amplification procedure was 95℃for 3min → (95 ℃,30sec → 57 ℃,30sec → 68 ℃). Times.40 Cycles → 68 ℃,5min → 4 ℃,10min, the extension time being dependent on the amplified fragment length. And (3) carrying out agarose gel electrophoresis on the amplified product, and recovering the target fragment.

Meanwhile, the backbone vector pLSD298 was digested with the restriction enzyme BsmBI at 50℃for 2 hours, the digestion system was as follows: NEB buffer 3.1. Mu.L, pLSD 298. Mu.L, bsmBI 1. Mu.L, ddH ₂ O 39μL。

The digested product and the GFP gel recovered product were ligated with T4 DNA ligase, and the ligation product was designated pHQQ001. The pHQQ001 and pri-miRNA gel recovery products were assembled using Golden Gate assembly, the Golden Gate system is as follows: 10×T4 DNA Ligase Buffer. Mu.L, T4 DNA Ligase 1. Mu.L, bsaI 1. Mu.L, pHQQ001. Mu.L, pri-miRNA gel recovery product 2. Mu.L, ddH ₂ O13. Mu.L. The assembly conditions were (37 ℃,5 min- > 16 ℃,10 min). Times.15 Cycles- > 37 ℃,5 min- > 65 ℃,10 min- > 12 ℃,10min.

Melting Escherichia coli DH5 alpha competence on ice, adding the above 20 μl of the ligation product, mixing, and ice-bathing for 30min. Heat shock at 42deg.C for 1min, and ice-bathing on ice for 2min. 500. Mu.L of LB liquid medium was added thereto, and incubated at 37℃for 45min with shaking at 200 rpm. After 12000rpm centrifugation for 2min, 400. Mu.L of the supernatant was discarded, and the resuspended cells were gently beaten with a pipetting gun. All bacterial solutions are coated on LB solid medium (containing 50mg/L Kan), and are cultivated for 1h at 37 ℃ in a normal way and then are cultivated for 12-16 h in an inverted way. The resistant single colony is picked, inoculated for expansion culture, and sent to the bacteria solution for delivery to all the department of Optimaceae for sequencing, and the transient expression vector of the miPEP162a is successfully constructed (figure 2). Plasmid was extracted using the plasmid middose extraction kit from AxyPrep plasmid manufactured by Axygen company after sequencing was correct. The other 20 mirep were constructed in the same manner.

Transformation of rice protoplast

Taking yellow rice seedling cultured in dark for 10 days, cutting into 1mm particles with sterile blade, and collecting the yellow rice seedlingTransfer to a petri dish. 10mL of enzyme solution is added, and the enzyme solution is gently shaken to mix with the seedling particles. The petri dishes were placed in a vacuum desiccator and the dish lid was opened and vacuum treated for 30min to allow the seedling particles to be sufficiently contacted with enzyme solution. Sealing the culture dish with sealing film, shaking and digesting the culture dish with tinfoil paper at 60-80 rpm for 6-7 hr. After digestion was complete, a 40 μm filter was removed and wetted with 2mL of W5 Buffer. The seedling particles are extruded for a plurality of times by a gun head, the liquid in the culture dish is carefully sucked by a liquid-transferring gun and is transferred into a filter screen for filtration, and the liquid is slowly and continuously pumped out when being pumped out. 5mL of W5 Buffer was added to the petri dish, the seedling pellet was continuously extruded, transferred to a filter screen and filtered, and repeated three times. 30mL of the filtrate was transferred to a 50mL centrifuge tube, 100 Xg, centrifuged for 5min, and the supernatant was discarded. 2mL of W5 Buffer was added, the cell pellet was resuspended, 8mL of W5 Buffer was added, the mixture was homogenized, 100 Xg was centrifuged for 5min, and the supernatant was discarded. 1mL of W5 Buffer was added, the cell pellet was resuspended, 4mL of W5 Buffer was added, the mixture was homogenized, 100. Mu.L of cell suspension was counted, the remaining cell suspension was 100 Xg, and the supernatant was discarded. Adding 5X 10 ^-7 MMG Buffer, which is a multiple of the number of cells, resuspended cells. A2 mL centrifuge tube was taken, 30ug of plasmid and MMG Buffer were added together in 30. Mu.L, and 200. Mu.L of cell suspension was added. 230. Mu.L of 40% PEG4000 was added, and the mixture was gently mixed and allowed to stand for conversion for 30 minutes. 1mL of W5 Buffer was added, and the reaction was stopped by gentle mixing. 250 Xg, centrifuged for 5min and the supernatant discarded. 1.5mL of W5 Buffer was added to the six-well plate. After sucking 500. Mu.LW 5 Buffer from the six-well plate and blowing the homogenized cells, the whole cell suspension was transferred to the six-well plate. The six pore plates are sealed by sealing films, wrapped by tinfoil paper and placed in a incubator at 32 ℃ for dark culture for 24 hours. Then, observation and Image acquisition were performed by an inverted fluorescence microscope, and fluorescence intensity analysis was performed by Image J pair. The results show that: no obvious fluorescent signal is observed in 11 pri-miRNAs such as pri-miR160a and pri-miR160d, and obvious fluorescent signals are observed in 10 pri-miRNAs such as pri-miR159a and pri-miR162a, which indicates that pri-miRNAs such as pri-miR159a and pri-miR162a can express miPEP (figure 3), and 10 miPEPs which can be expressed are subjected to directional knockout.

EXAMPLE 2 construction of OsmiPEP directed knockout vector

Preparation of sgRNA

Aiming at the pri-miR162a, designing sgRNA in a gene coding region according to the recognition and shearing rule of a CRISPR-Cas9 system to a target site; the mismatch and off-target sites of the sgrnas were then predicted using the CRISPR-P website online (http:// CRISPR. Hzau. Edu. Cn/CRISPR2 /) to select the optimal sgrnas (shown in SEQ ID No. 1) for knockdown of mipp 162a. According to the cleavage site of the knockout vector pZHY988 used in the invention, the cleavage site of BsaI is added to the 5' end of sgRNA, and two single-stranded nucleotide sequences (the sequences of which are shown as SEQ ID No.2 and SEQ ID No. 3) annealed to form an adhesive end are respectively designed and synthesized and delivered to Shanghai Biotechnology company for synthesis.

The sgRNA sequence (CRISPR-Cas 9 guide RNA for editing and knocking out the OsmiPEP162a coding gene) GCACAAUGUCUCUAUUGCUG designed by SEQ ID No. 1;

SEQ ID No.2 Single-stranded nucleotide sequence (construction of OsmiPEP162a knockout vector)

sg162a-F:GTGTGCACAATGTCTCTATTGCTG；

SEQ ID No.3 Single-stranded nucleotide sequence (construction of OsmiPEP162a knockout vector)

sg162a-R:aaacCAGCAATAGAGACATTGTGC。

Connection reaction and plasmid transformation Escherichia coli competence

Respectively diluting the paired single-stranded nucleotide sequences by 10 times, respectively taking 10 mu L of the paired single-stranded nucleotide sequences, mixing, denaturing for 5min at 98 ℃, naturally cooling, and diluting an annealing product by 20 times for later use. The annealed product was assembled by Golden gate onto vector pZHY988, golden gate reaction system and procedure as in example 1. Plasmid transformation E.coli competence was the same as in example 1.

Third step colony PCR and plasmid extraction, namely sequencing verification

The monoclonal on LB plate was picked up with sterile toothpick and placed in 50. Mu.L ddH ₂ In O water, 1. Mu.L of the bacterial liquid was used as a template for PCR amplification. A25 uL system was used as follows: 10 XPCR Buffer 2.5. Mu.L, dNTP 0.5. Mu.L, sg162 a-F0.5. Mu.L, ZY065-RB (SEQ ID No. 8) 0.5. Mu.L, taq DNAenzyme 0.2. Mu.L, template 1. Mu.L, ddH ₂ O19.8. Mu.L. The PCR procedure was: 94 ℃,2min →(94 ℃,30 s- & gt 55 ℃,30 s- & gt 72 ℃ C., 30 s) 35 cycles- & gt 72 ℃,5 min- & gt 4 ℃ C., 10min (Taq DNA enzyme, dNTP, etc. are purchased from Tiangen biosystems). After the PCR was completed, 5. Mu.L of 6 Xbromophenol blue was added thereto, and the mixture was electrophoretically detected in a 1% agarose gel at 130V for 30min.

SEQ ID No.8 for colony positive detection

ZY065-RB：TTCTAATAAACGCTCTTTTCTCT

The colony PCR was verified to be correct, 50. Mu.L of the bacterial liquid was inoculated into LB containing 50mg/LKan for 12 to 16 hours, and plasmids were extracted. The extraction of plasmid DNA was performed according to the AXYGEN AxyPrepTM Plasmid Miniprep Kit instructions. The extracted plasmid was sent to the department of biotechnology, inc. for sequencing verification. The directed editing expression vector pHQQ042 (FIG. 4) for the rice OsmiPEP162a encoding gene was obtained. The other 9 mipps were knocked out in the same manner.

EXAMPLE 3 Agrobacterium-mediated genetic transformation of Rice

Agrobacterium-mediated transformation of Rice references Tang X, lowder LG, zhang T, malzahn A, zheng X, voytas DF, zhong Z, chen Y, ren Q, li Q, kirkland ER, zhang Y, qi Y.2017.ACRISPR-Cpf1 system for efficient genome editing and transcriptional repression in Plants Nature Plants, 3:17018).

The genetic transformation steps of the rice are specifically as follows: removing husk from mature seeds of rice (Nippon Temminck.) and sterilizing; inoculating the sterilized seeds on an N-6-D solid culture medium containing 0.4% gellan gum, and continuously culturing for 1-5 days under illumination at 32 ℃; transferring the plasmid pHQQ042 into rice by agrobacterium-mediated transformation, and continuously culturing the transformed rice seeds in an induction selection medium at 32 ℃ under illumination for 2 weeks; transferring the callus generated by proliferation into RE-III culture medium; transfer of young plants produced from callus to HF medium induces root production. When the obtained resistant regenerated seedlings grow to about 15cm, cleaning root culture medium with clear water, transplanting into nutrient soil, and culturing in a greenhouse.

EXAMPLE 4 identification of Rice OsmiPEP mutant

Extraction of genomic DNA of rice seedlings

The rice seedling DNA extraction adopts a CTAB method, and the specific operation steps are as follows:

the CTAB extract was preheated in a 65℃water bath. About 2cm of plant leaves are taken out in a 2mL centrifuge tube containing two steel balls, quickly frozen in liquid nitrogen and then shaken to be powder. 600. Mu.L of the preheated CTAB extract was added and the mixture was shaken upside down at 65℃in a water bath for 30min and 15min to thoroughly lyse the plant leaves. 500 μl chloroform was added: isoamyl alcohol (24:1), and centrifuging at 12000rpm for 10min. Transferring the supernatant after centrifugation into a new 1.5mL centrifuge tube, adding 500 mu L of isopropanol, uniformly mixing, and standing at-20 ℃ for more than 1 hour. Centrifuge at 12000rpm for 10min, discard supernatant. Air-drying the DNA. Add 50. Mu.L ddH ₂ O dissolves DNA and is preserved in a refrigerator at-20 ℃ for standby.

Transgenic positive detection of rice seedlings

The specific primers dcas9-F (primer sequence is shown as SEQ ID No. 4) and dcas9-R (primer sequence is shown as SEQ ID No. 5) are used for amplifying target fragments to detect transgene positivity, the amplified fragments are 684bp, and the PCR amplification system and the reaction program are the same as those of colony PCR.

SEQ ID No.4 upstream primer for transgene positive detection

dcas9-F：GGGCTGATCCTAAGAAGAAGAGGAA；

SEQ ID No.5 downstream primer for transgene positive detection

dcas9-R：CGCAGTAATGCCAACTTTGTAC。

(3) Mutant genotype and phenotype identification

And (3) carrying out PCR on the positive plants obtained by detection by using specific primer pairs (primer sequences are shown as SEQ ID No.6 and SEQ ID No. 7), and carrying out Sanger sequencing on PCR products. PCR amplification system and reaction procedure are the same as before. The OsmiPE162a knockout mutant, the genotype of which is +1bp/+1bp (figure 5 a), was obtained, the amino acid length was changed from 71 to 43, and only 8 corresponding amino acids were identical (figure 5 b). The agronomic trait observation of the mutant shows that the plant height of the OsmiPEP162a mutant is reduced, the tillering number, the length and the width of the seeds are all increased (figures 5 c-e), but other agronomic traits such as the spike number, the fruiting rate and the like are not obviously changed. The other 9 mipps have not yet observed agronomic traits.

Upstream primer sequence of SEQ ID No.6 for mutant detection

22-162a-F：GACATTATTCGATGCTTCCTACAGG；

SEQ ID No.7 downstream primer sequence for mutant detection

22-162a-R：CGGCAGATCCACTTAACTTCAC。

Claims

1. The method for regulating the rice plant type is characterized by comprising the following steps: by blocking or weakening the expression of the pri-miRNA encoding peptide gene OsmiPEP162a in rice.

2. The method according to claim 1, wherein: the regulation of the rice plant type is to reduce the plant height and/or increase the tiller number.

3. The method according to claim 2, characterized in that: the blocking or weakening expression mode of the pri-miRNA encoding peptide gene OsmiPEP162a in the rice is to knock out the OsmiPEP162a gene or interfere the expression of the OsmiPEP162a gene;

further, the method for knocking out the OsmiPEP162a gene is at least one of a genome editing method, a homologous recombination method or a random insertion mutation method;

still further, the genome editing method includes at least one of meganuclease method, ZFN method, TALEN method, or CRISPR-Cas method;

specifically, the CRISPR-Cas method comprises the steps of:

a. designing sgRNA aiming at an OsmiPEP162a gene;

b. constructing a Cas editing expression vector for expressing sgRNA;

c. the Cas editing expression vector is transformed into rice.

4. A method according to claim 3, characterized in that: the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b;

in particular, the sgRNA sequence is shown as SEQ ID No. 1;

preferably, the expression vector is pZHY988;

5. The method for regulating and controlling the seed characters is characterized in that: by blocking or weakening the expression of the pri-miRNA encoding peptide gene OsmiPEP162a in rice.

6. The method according to claim 5, wherein: the blocking or weakening expression mode of the pri-miRNA encoding peptide gene OsmiPEP162a in the rice is to knock out the OsmiPEP162a gene or interfere the expression of the OsmiPEP162a gene;

in particular, the method for knocking out the OsmiPEP162a gene is at least one of a genome editing method, a homologous recombination method or a random insertion mutation method;

further, the genome editing method includes at least one of meganuclease method, ZFN method, TALEN method, or CRISPR-Cas method.

Specifically, the CRISPR-Cas method comprises the steps of:

a. designing sgRNA aiming at an OsmiPEP162a gene;

b. constructing a Cas editing expression vector for expressing sgRNA;

c. the Cas editing expression vector is transformed into rice.

7. The method according to claim 6, wherein: the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b;

in particular, the sgRNA sequence is shown as SEQ ID No. 1;

preferably, the expression vector is pZHY988;

8. The method according to claim 5, wherein: the seed traits are seed length and width.

9. An sgRNA directed against the osmipp 162a gene characterized by: the nucleotide sequence is shown as SEQ ID No. 1.

10. A vector expressing the sgRNA for the osmidpe 162a gene of claim 9.

11. Use of the sgRNA of claim 9 or the vector of claim 10 for regulating rice plant type or seed traits.