CN114854786B

CN114854786B - Method for improving corn haploid induction line induction rate through genetic engineering modification of CENH3 protein

Info

Publication number: CN114854786B
Application number: CN202210163415.5A
Authority: CN
Inventors: 孟德璇; 金危危; 罗海山; 黄伟; 董小妹; 朱敏; 杜万里; 钟雪梅
Original assignee: Shenyang Agricultural University
Current assignee: Shenyang Agricultural University
Priority date: 2022-02-22
Filing date: 2022-02-22
Publication date: 2024-05-28
Anticipated expiration: 2042-02-22
Also published as: CN114854786A

Abstract

The invention discloses a method for improving the induction rate of a corn haploid induction line by genetically engineering CENH3 protein, and particularly relates to the field of genetic engineering. The method comprises the steps of replacing the sequence of the N end in a corn CENH3 gene with the N end sequence of a corn H3 gene to obtain a preliminary modified gene 1, cloning the gene 1 into a plant over-expression vector pCAMBIA3301-RFP which takes Ubiquitin (UBI) as a promoter and contains a macromolecular Red Fluorescent Protein (RFP) tag, constructing a vector UBI for over-expressing a centromere specific fusion protein, namely M-tailswap-RFP, and transforming the over-expression vector into a corn receptor to obtain a positive transformant strain LH244 ^{M‑tailswap‑RFP}; hybridizing the positive strain LH244 ^{M‑tailswap‑RFP} with the receptor parent CAU5 for 1 generation, then backcrossing with the CAU5 as the recurrent parent for 2 generation, and selfing for at least 4 generation. The breeding method can obviously improve the induction rate of the corn haploid induction system, and haploid induction is carried out by using the corn haploid induction system containing fluorescent markers, so that the efficiency of identifying haploids in the field can be improved, and the identification process is simplified.

Description

Method for improving corn haploid induction line induction rate through genetic engineering modification of CENH3 protein

Technical Field

The invention relates to the field of genetic engineering, in particular to a method for improving the induction rate of a corn haploid induction line by genetically engineering CENH3 protein.

Background

Corn is a mode crop utilizing heterosis, and more than 97% of corn sowing areas in China are hybrid seeds. In the utilization of heterosis, the most critical link is the selection of pure lines, and two methods are commonly used: the first is pedigree, i.e., by continuous multi-band selfing or backcrossing, usually requiring 5-7 years to obtain a pure line; the other is a double haploid (Double Haploid, DH) breeding technology, and a haploid induced by a haploid induction line is doubled to become a homozygous diploid, so that a pure line can be obtained within 1-2 years. DH breeding plays an increasingly important role in corn commercial breeding processes, and is a core technology of modern corn breeding with molecular breeding technology, transgenic technology and the like.

Haploid refers to an individual having a gamete chromosome number within a cell. The haploid has only one set of chromosome, and both the recessive gene and the dominant gene can be displayed in the current generation, so that the screening of excellent characters can be carried out in the early generation, the bad characters can be eliminated in time, and the rapid aggregation of beneficial alleles such as yield, resistance and the like is facilitated. After doubling the haploid, the homozygous individual can be directly obtained, no gene separation phenomenon exists, and the time for obtaining the pure line is short compared with the conventional breeding pedigree method. In addition, in haploid breeding, no gene interaction exists, and the efficiency and accuracy of breeding can be improved through molecular marker assisted selection. Furthermore, mapping populations, chromosome substitution lines, reverse breeding parents, apomictic engineering, and the like can also be rapidly generated by using DH lines.

Currently, in practical application of corn DH breeding, haploid offspring are obtained mainly by inducing female parent haploids through a haploid induction line derived from corn Stock6 germplasm. Stock6 maize haploid inducer was first reported in 1959 to have a maternal haploid inducer rate of 2.3% -3.2%. In the following decades, maize breeders around the world continuously improve the Stock6 induction line through hybridization or backcrossing, so that the induction rate of the maize haploid induction line is remarkably improved.

In addition to Stock6 germplasm based haploid inducer breeding methods, CENH3 mediated haploid induction techniques are another haploid acquisition means that is most likely to be applied in commercial breeding programs in the future. The CENH3 gene encodes a centromere-specific histone, a variant of nucleosome histone H3, which plays an important role in the localization of centromeres on chromosomes. The current research shows that by utilizing the means of genetic engineering, the CENH3 gene of corn, rice, arabidopsis and other plants is knocked out or mutated, so that gametophyte or sporophyte of the plants has the capacity of inducing generation of haploid offspring, thereby creating a haploid induction system.

However, the breeding or creating method of the two haploid induction lines still has obvious defects. For the method for breeding corn haploid induction line by improving Stock6 germplasm, the following disadvantages are mainly existed at present: 1. even through backcross breeding for many years, the induction rate of the haploid induction line is still relatively slow to increase. 2. Due to the limitation of germplasm resources, both the improvement of the agronomic trait of the haploid inducer and the improvement of the haploid inducer rate cannot be fully considered, so that materials with higher inductivity are caused, and the agronomic trait of the materials may be poor and cannot be used for commercial breeding application.

For methods of creating maize haploid inducer lines by engineering CENH3 gene, there are currently the following disadvantages: 1. the induction rate of the haploid induction line is still low, and the haploid induction rate among individual plants is unstable in the created induction line population. 2. Identification of haploids induced by the induction lines created with most maize conventional lines is difficult because the genetic background of these lines does not carry a color marker gene.

Disclosure of Invention

Therefore, the invention provides a method for improving the induction rate of a corn haploid induction line by genetically engineering CENH3 protein, which aims to solve the problems of slow improvement of the induction rate of the existing corn haploid, low haploid identification efficiency, poor agronomic characters of the induction line and the like.

In order to achieve the above object, the present invention provides the following technical solutions:

According to the method for improving the induction rate of the corn haploid induction line by genetically engineering CENH3 protein, the method comprises the following steps:

Firstly, replacing the sequence of the N terminal in a corn CENH3 gene with the N terminal sequence of a corn H3 gene to obtain a preliminary modified gene 1, cloning the gene 1 into a plant over-expression vector pCAMBIA3301-RFP taking Ubiquitin (UBI) as a promoter and containing a large molecular weight tag to construct a vector UBI of over-expression centromere specific fusion protein, namely M-tailswap-RFP, and transforming the over-expression vector into a corn receptor to obtain a positive transformation strain LH244 ^{M-tailswap-RFP};

And step two, crossing the positive strain with a receptor parent maize CAU5 for 1 generation, then backcrossing for 2 generations by taking the CAU5 as a recurrent parent, then selfing for at least 4 generations, and finally forming a novel haploid induction line with high induction rate.

Further, in the first step, the large molecular weight tag is RFP fluorescent protein.

Furthermore, in the first step, the centromere specific fusion protein is specifically a fusion expression protein in which the N-terminal amino acid sequence of the maize centromere specific histone CENH3 is replaced by the N-terminal amino acid sequence of the maize nucleosome histone H3, and a large molecular weight fluorescent tag RFP is connected to the C-terminal of the CENH3 protein.

In the first step, the agrobacterium-mediated embryo leaching method is adopted for transformation.

Further, in the first step, the LH244 strain is adopted as the maize receptor strain.

Further, in the second step, the recipient parent maize is a Stock 6-derived maize haploid inducer CAU5.

The cultivation method of the invention adopts the C end of corn CENH3 to splice the N end of corn H3 gene and connect fluorescent protein, and aims at: the chimeric gene formed by splicing H3 and CENH3 is still specifically expressed in centromere, and can make fluorescent marker stably expressed in cell nucleus by introducing it into corn. In addition, since CENH3 chimeric proteins spliced with the N-terminal sequence of H3 protein may not have a function completely identical to that of wild-type CENH3 protein and the C-terminal thereof is fused with an exogenous macromolecular fluorescent protein tag RFP, which results in a certain influence on the function of centromere when it is integrated into centromere, may be lost due to lag of time node of integration into centromere when competing with native CENH3 protein derived from female parent or native CENH3 protein in female parent which is inferior in competing spindle filament pulling efficiency, chromosome containing spliced CENH3 fusion protein (M-tailwalk-RFP) is more likely to lag in mitosis.

The invention has the following advantages:

The breeding method of the invention obviously improves the induction rate of the corn haploid induction system, and the corn haploid induction system with fluorescent markers not only can be used as a haploid induction system to generate haploids in offspring, but also can stably express fluorescent fusion proteins, thereby greatly simplifying the identification process; improving the efficiency of identifying haploids in the field and simplifying the identification process.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It will be apparent to those of ordinary skill in the art that the drawings in the following description are exemplary only and that other implementations can be obtained from the extensions of the drawings provided without inventive effort.

The structures, proportions, sizes, etc. shown in the present specification are shown only for the purposes of illustration and description, and are not intended to limit the scope of the invention, which is defined by the claims, so that any structural modifications, changes in proportions, or adjustments of sizes, which do not affect the efficacy or the achievement of the present invention, should fall within the ambit of the technical disclosure.

FIG. 1 is a schematic construction diagram of a vector (UBI: M-tailswap-RFP) in which the N-terminus of maize CENH3 protein is replaced by the N-terminus of maize H3 protein and a red fluorescent protein tag (RFP) is attached to the C-terminus of chimeric CENH3 protein;

FIG. 2 shows the identification result of the sequence amplification primer pair transgenic line after splicing the N end of H3 and the C end of CENH 3; wherein, lane 1 and lane 2 are biological repeats of the DNA of two positive plants of LH244 ^{M-tailswap-RFP}, lane 3 is marker, the brightest band points to 750bp;

FIG. 3 shows CENH3 gene expression level comparison of LH244 ^{M-tailswap-RFP} positive over-expression strain and control strain by using real-time fluorescence quantitative PCR (qRT-PCR);

FIG. 4 is a flow chart of the assembled group provided by the invention;

FIG. 5 is a graph showing comparison of data of haploid inductances of each generation in the process of introducing a UBI: M-tailswap-RFP overexpression vector into a maize CAU5 induction line through backcross breeding;

FIG. 6 is a graph comparing pollen viability staining patterns of CAU5 provided by the invention with a newly bred novel induction line CAU5 ^{M-tailswap-RFP};

FIG. 7 is a graph showing the ratio of CAU5 provided by the invention to 5 viable grade pollens of the newly bred novel induction line CAU5 ^{M-tailswap-RFP};

FIG. 8 is a graph comparing the plant photographs of the novel fluorescence induction lines CAU5 ^{M-tailswap-RFP} and CAU5 selected and bred by the invention.

Detailed Description

Other advantages and advantages of the present invention will become apparent to those skilled in the art from the following detailed description, which, by way of illustration, is to be read in connection with certain specific embodiments, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example method for improving the Induction of maize haploid inducer by engineering maize CENH3 Gene

Description:

The nucleotide sequence of the maize CENH3 gene is shown in a sequence table <210>1,NO.1 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-1; the amino acid sequence deduced from the nucleotide sequence of the maize CENH3 gene is shown in sequence table <210>2,NO.2 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-2.

The nucleotide sequence of the maize HISTONE 3.2.2 (H3) gene is shown in a sequence table <210>3,NO.3 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-3; the nucleotide sequence of the maize CENH3 spliced maize H3 gene is shown in a sequence table <210>4,NO.4 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-4.

The nucleotide sequence of the maize CENH3 spliced maize H3 gene is shown in a sequence table <210>5,NO.5 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-5; the deduced amino acid sequence of maize CENH3 spliced maize H3 gene is shown in sequence table <210>6,NO.6 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-6.

The nucleotide sequence of the reporter gene RFP is shown in a sequence table <210>7,NO.7 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-7; the deduced amino acid sequence of the reporter gene RFP is shown in a sequence table <210>8,NO.8 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-8.

Sequence amplification primer after splicing N end of H3 and C end of CENH 3:

F, 5 'ATGGCCCGCACGAAGGACAGCAGA3' (see sequence Listing <210>9,NO.9 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-9)

R5 'CCTCCGGGAAGGACAGCTTC 3' (see sequence Listing <210>10,NO.10 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-10)

ZmPLA 1-primer sequences

F, 5 'ACGGAAGGAGTAAGGATGTTT 3' (see sequence Listing <210>11,NO.11 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-11)

R5 'CGGTAGTCCTCTCCGTTCAC3' (see sequence Listing <210>12,NO.12seq,2 Ambystoma laterale x Ambystoma jeffersonianum-12)

Bar gene primer

F, 5'GCAAAGTCTGCCGCCTTACAAC3' (see sequence Listing <210>13,NO.13 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-13)

R:5 'TGTTATCCGTCTCACATTCCAAC3' (see sequence Listing <210>14,NO.14 seq,2 Ambystoma laterale x Ambystoma jeffersonianum-14)

Vector construction diagram and construction method for splicing C end of CENH3 gene at N end of corn H3 gene and connecting Red Fluorescent Protein (RFP)

The construction schematic diagram of the carrier of splicing the C end of corn CENH3 at the N end of corn H3 and then connecting Red Fluorescent Protein (RFP) is shown in figure 1, and the specific operation steps are as follows:

1. The fresh leaves of the maize inbred line B73 plant are taken to extract total RNA, and the total RNA is reversely transcribed into cDNA;

2. Designing a specific primer according to the N-terminal sequence of the corn H3 gene, adding an enzyme cutting site XbaI in front of a forward primer, adding an enzyme cutting site SpeI after a reverse primer, and amplifying the cDNA by using the specific primer through a PCR method to obtain a target fragment of the spliced H3 gene containing the enzyme cutting site; designing a specific primer according to the C-terminal sequence of the corn CENH3 gene, adding an enzyme cutting site SpeI in front of a forward primer, adding an enzyme cutting site KpnI after a reverse primer, and amplifying the cDNA by using the specific primer through a PCR method to obtain a target fragment of the spliced CENH3 gene containing the enzyme cutting site;

3. Double-enzyme digestion is carried out on the H3 and CENH3 gene fragments by using restriction enzymes XbaI/SpeI and SpeI/KpnI, double-enzyme digestion is carried out on pCAMBIA3301-RFP vector by using corresponding restriction enzymes XbaI/KpnI, agarose gel electrophoresis is carried out on enzyme digestion products of each gene fragment and vector, and gel digestion recovery is carried out;

4. The gene fragments of H3 and CENH3 and the digestion recovery product of pCAMBIA3301-RFP vector are connected through T4 ligase, then the connection product is transformed into escherichia coli DH5 alpha strain, and positive monoclonal containing the connection product is screened through PCR technology;

5. The positive monoclonal colony is amplified, plasmid is extracted, the plasmid is sent to a biological company for sequencing target fragments, and bacterial liquid containing the carrier of the required correct target gene fragments is subjected to plasmid extraction by comparing the returned sequencing results so as to be used for the next genetic transformation.

(II) obtaining transgenic lines

Genetic transformation of corn adopts an agrobacterium-mediated embryo method, a corn receptor line adopts an LH244 line, and the specific operation flow is as follows:

1. Transferring the vector plasmid constructed in the step (I) into an agrobacterium EHA105 strain, screening positive monoclonal colonies containing a target vector UBI: M-tailswap-RFP by a PCR technology, and propagating the positive agrobacterium colonies.

2. Selecting clusters of corn LH244 strain 10-12 days after self-pollination as callus induction materials, separating young embryo from seeds on the corn clusters in an ultra-clean bench, and temporarily storing the collected young embryo in a hypertonic culture medium for later use;

3. culturing agrobacterium tumefaciens bacterial solution containing a target vector UBI (UBI) M-tailswap-RFP until the OD value is equal to 0.8, centrifugally collecting bacterial bodies, re-suspending the bacterial bodies by using a re-suspension containing acetosyringone, soaking the collected young embryo in the agrobacterium re-suspension for 5min, transferring to a co-culture medium, and culturing in dark at 25 ℃ for 7 days;

4. transferring the young embryo subjected to the dark culture stage into a gradient screening culture medium containing resistance, transferring once every two weeks, and screening for 3 rounds;

5. transferring the young embryo which is screened and formed into callus into a differentiation medium, and culturing for 2 weeks to obtain a regenerated plant;

6. hardening seedlings of the regenerated plants, and then transferring the regenerated plants into a field or a greenhouse for planting;

7. Leaf sampling is carried out on the transformed plants in a field or a greenhouse, DNA is extracted, and PCR technology is utilized to screen positive transformed plants containing a target vector UBI of M-tailswap-RFP;

8. Extracting total RNA of leaves of a positive transformation plant, reversely transcribing the total RNA into cDNA, screening plants with high CENH3 chimeric gene expression and good plant growth state by combining with the growth state of field plants by using qRT-PCR technology, and carrying out selfing on the selected plants in a flowering pollination period to obtain homozygous transgenic offspring.

(III) construction process of novel corn haploid induction line with high induction rate

After the transgenic lines identified as positive are subjected to three-generation selfing stabilization, pollinating by hybridization respectively with pollen of an induction line CAU5, transgenic positive plants and receptor plants, and respectively counting the variation trend of group induction rate of the generation of the progeny F1, BC1F1, BC2F2, BC2F3 and BC2F 4.

In the breeding process of each generation, two pairs of primers (an N-terminal of H3 and a C-terminal spliced sequence amplification primer of CENH3 and ZmPLA-primer sequence) are utilized by a molecular marker assisted selection method, and a corn haploid induction gene locus ZmPLA and a corn H3 spliced CENH3 overexpression vector (UBI: M-tailwalk-RFP) are screened and reserved in a offspring strain, wherein the identification result is shown in figure 2; meanwhile, in the backcross generation, each generation selects a strain with highest haploid induction rate for backcross, so that a novel corn haploid induction line CAU5 ^{M-tailswap-RFP} is finally obtained; the construction process is shown in fig. 4.

Experimental example 1 PCR agarose gel electrophoresis for identifying positive plants

1. And (3) the obtained transgenic line, namely, a positive plant identified by using the Bar gene primer, is subjected to further determination on a target sequence in the positive plant by using the sequence amplification primer after splicing the N end of H3 and the C end of CENH 3.

2. The expression level of the gene in the transgenic line and the control group was identified. The identification method comprises the following steps:

Leaves of transgenic line LH244 ^{M-tailswap-RFP} and control group LH244 were taken in the field, stored in liquid nitrogen, total RNA was extracted and reverse transcribed to obtain cDNA. Designing a primer by using Oligo7 software, and taking an ACTIN gene as a reference gene. TB GREEN FAST QPCR Mix used in the experiments was obtained from Takara (cat# RR 430S) and the reaction system was as shown in Table 1:

TABLE 1 reaction system

Component (A)	Volume/. Mu.L
		TB Green Fast qPCR Mix	15
Primer-F	0.6
		Primer-R	0.6
cDNA	2
		H₂O	10.6
DyeII	1.2
		Total volume of	30

The fluorescent quantitative PCR instrument is ABI7500 of applied biosystems company in the United states.

The reaction procedure was two-step PCR: preheating at 95 ℃ for 30 seconds; the procedure in the cycle is: a total of 40 cycles were set at 95℃for 15 seconds, 60℃for 33 seconds (fluorescence was collected).

The method for calculating the relative expression quantity comprises the following steps: the relative quantification of gene expression was performed using the 2 ^-ΔΔCT method.

The expression level of the action gene in each sample was set to 1.0, and the relative expression level of the gene in the sample was subtracted. The average was taken in triplicate for each sample.

3. Identification result

As a result, as shown in FIGS. 2 and 3, positive transformant strain LH244 ^M ^{-tailswap-RFP} containing the UBI: M-tailswap-RFP vector was amplified by the vector-specific primer to give a nucleic acid electrophoresis band of about 750bp size as shown in FIG. 2, and the CENH3 gene expression amount in positive transformant strain LH244 ^{M-tailswap-RFP} was significantly higher than that in control strain LH244 as shown in FIG. 3.

Experimental example 2 calculation method and comparison of haploid inductivity

1. The identification method of haploids comprises the following steps:

The method used in this experiment to identify haploids is to determine haploids and diploids by color marker selection, i.e., by identifying R-nj markers on the grain. We used this method to determine the induction rate of the novel induction line and control. The specific test method comprises the following steps: when the novel induction line CAU5 ^{M-tailswap-RFP} and the control line CAU5 ^{LH244-Intergressed} are respectively used as male parent and hybridized with the conventional line hybrid Zhengdan 958, purple endosperm purple embryo (diploid) and purple endosperm non-purple embryo (pseudohaploid) are generated on the hybridized clusters. Since color markers may not be well recognized on some kernels, the actual haploid numbers are screened by the field performance of the haploids for the identified anthropomorphic haplotypes to proceed on the next season.

The method for calculating the haploid inductivity comprises the following steps:

induction rate of a certain induction line = number of haploid kernels detected on hybrid ears/total kernels on hybrid ears when the induction line is used as a male parent.

2. The comparison of the induction rate of the novel induction line and the control group is shown in figure 5, wherein the CAU5 ^{LH244-introgressed} strain is obtained by backcross breeding of a transgenic receptor strain LH244 by adopting a breeding strategy identical with that of a spliced CENH3 strain. The results show that the haploid induction rate of the novel induction line CAU5 ^{M-tailswap-RFP} is significantly higher than that of the control induction line CAU5 ^{LH244-introgressed} from the BC2F1 generation; and after the breeding generation of BC4 is entered into the selfing generation (BC 2F 2), the haploid induction rate of the novel induction line CAU5 ^{M-tailswap-RFP} is increased more rapidly, and the group induction rate of the breeding generation of BC4 reaches about 16.3 percent, which is obviously increased by about 6.1 percent compared with the control group.

Experimental example 3 calculation method and comparison of pollen Activity

Pollen vitality calculation method and judgment standard

Preparing TTC solution with concentration of 1%, taking a mature pollen, lightly squeezing pollen content on a glass slide, suspending to drop a drop of TTC solution, slowly covering a cover glass, standing in a 37 ℃ incubator for 5 minutes, and observing under a common phase contrast microscope. The degree of staining of pollen was classified as 5: the first stage is high activity, and is shown by the fact that large-area pollen is dyed red; the second stage is medium activity, and is represented by pollen with pink large area and medium dyeing intensity; the third-stage pollen is low in activity and is represented by pollen with large area of white powder; the fourth level is non-viable pollen, which is expressed as pure white pollen; and the fifth stage is a aborted grain, as shown in fig. 7. The ratio of five pollens of the inducing line CAU5 and the novel inducing line CAU5 ^M ^{-tailswap-RFP} was counted. At least 10 pollen lines were tested at different positions per line. Formulation of TTC solution: 1.0g of chlortriphenyltetrazole is weighed and dissolved in 1000mL of pure water, and after being evenly mixed up and down, the chlortriphenyltetrazole is packaged into a 1mL centrifuge tube, is wrapped by tinfoil paper and stored in a dark place, and is protected from light when in use.

Comparing the pollen viability staining chart of the CAU5 with that of the newly bred novel induction line CAU5 ^{M-tailswap-RFP}, and the comparison is shown in a figure 6; the ratio of CAU5 to five viable grade pollen of the newly bred novel induction line CAU5 ^{M-tailswap-RFP} is shown in FIG. 7. The results show that the overall pollen viability of the novel inducible CAU5 ^{M-tailswap-RFP} is significantly lower than that of its donor parent CAU5, especially that the proportion of low viable pollen in the pollen of CAU5 ^{M-tailswap-RFP} is significantly increased, indicating that the viability of the inducible pollen may have a certain correlation with haploid inducer capacity.

Experiment example 4 comparison of novel fluorescence-induced line selected and bred with plant photograph of CAU5

The phenotype diagram of the selected novel fluorescence induction line compared with the plant photo of CAU5 is shown in figure 8. The graph shows that the novel haploid induction line CAU5 ^{M-tailswap-RFP} cultivated by the method has obviously improved agronomic characters compared with the donor parent CAU5 except that the haploid induction rate is obviously improved, and has higher plant height and more developed tassel inflorescence.

In conclusion, the method has high operation feasibility, mature technical scheme and capability of remarkably improving the induction rate of the corn haploid induction line in a shorter breeding period, and the method can effectively improve the working efficiency of the current corn haploid breeding technology in production practice and has important guiding significance.

While the invention has been described in detail in the foregoing general description and specific examples, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Shenyang agricultural university

<120> A method for increasing the induction rate of maize haploid inducer by engineering CENH3 protein

<141> 2022-02-17

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 471

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-1

<400> 1

atggctcgaa ccaagcacca ggccgtgagg aagacggcgg agaagcccaa gaagaagctc 60

cagttcgagc gctcaggtgg tgcgagtacc tcggcgacgc cggaaagggc tgctgggacc 120

gggggaagag cggcgtctgg aggtgactca gttaagaaga cgaaaccacg ccaccgctgg 180

cggccaggga ctgtagcgct gcgggagatc aggaagtacc agaagtccac tgaaccgctc 240

atcccctttg cgcctttcgt ccgtgtggtg agggagttaa ccaatttcgt aacaaacggg 300

aaagtagagc gctataccgc agaagccctc cttgcgctgc aagaggcagc agaattccac 360

ttgatagaac tgtttgaaat ggcgaatctg tgtgccatcc atgccaagcg tgtcacaatc 420

atgcaaaagg acatacaact tgcaaggcgt atcggaggaa ggcgttgggc a 471

<210> 2

<211> 157

<212> PRT

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-2

<400> 2

Met Ala Ala Thr Leu His Gly Ala Val Ala Leu Thr Ala Gly Leu Pro

1 5 10 15

Leu Leu Leu Leu Gly Pro Gly Ala Ser Gly Gly Ala Ser Thr Ser Ala

20 25 30

Thr Pro Gly Ala Ala Ala Gly Thr Gly Gly Ala Ala Ala Ser Gly Gly

35 40 45

Ala Ser Val Leu Leu Thr Leu Pro Ala His Ala Thr Ala Pro Gly Thr

50 55 60

Val Ala Leu Ala Gly Ile Ala Leu Thr Gly Leu Ser Thr Gly Pro Leu

65 70 75 80

Ile Pro Pro Ala Pro Pro Val Ala Val Val Ala Gly Leu Thr Ala Pro

85 90 95

Val Thr Ala Gly Leu Val Gly Ala Thr Thr Ala Gly Ala Leu Leu Ala

100 105 110

Leu Gly Gly Ala Ala Gly Pro His Leu Ile Gly Leu Pro Gly Met Ala

115 120 125

Ala Leu Cys Ala Ile His Ala Leu Ala Val Thr Ile Met Gly Leu Ala

130 135 140

Ile Gly Leu Ala Ala Ala Ile Gly Gly Ala Ala Thr Ala

145 150 155

<210> 3

<211> 411

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-3

<400> 3

atggcccgca cgaagcagac ggcgcgcaag tcgacgggcg gcaaggcgcc ccgcaagcag 60

ctggccacca aggcggcgcg caagtcggcg ccggcaaccg gtggcgtgaa gaagcctcac 120

cgcttccgcc ccggcaccgt cgcgctccgg gagattcgca agtaccagaa gagcacggag 180

ctgctcatcc gcaagctgcc cttccagcgc ctcgtccgtg agatcgcgca ggatttcaag 240

accgacctcc gcttccagtc ctccgctgtc gccgcgctgc aggaggccgc cgaggcctac 300

ctcgtggggc tcttcgagga caccaacctc tgcgccatcc acgccaagcg cgtcaccatc 360

atgcccaagg acatccagct cgcgcgccgc atcaggggcg agagggcttg a 411

<210> 4

<211> 136

<212> PRT

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-4

<400> 4

Met Ala Ala Thr Leu Gly Thr Ala Ala Leu Ser Thr Gly Gly Leu Ala

1 5 10 15

Pro Ala Leu Gly Leu Ala Thr Leu Ala Ala Ala Leu Ser Ala Pro Ala

20 25 30

Thr Gly Gly Val Leu Leu Pro His Ala Pro Ala Pro Gly Thr Val Ala

35 40 45

Leu Ala Gly Ile Ala Leu Thr Gly Leu Ser Thr Gly Leu Leu Ile Ala

50 55 60

Leu Leu Pro Pro Gly Ala Leu Val Ala Gly Ile Ala Gly Ala Pro Leu

65 70 75 80

Thr Ala Leu Ala Pro Gly Ser Ser Ala Val Ala Ala Leu Gly Gly Ala

85 90 95

Ala Gly Ala Thr Leu Val Gly Leu Pro Gly Ala Thr Ala Leu Cys Ala

100 105 110

Ile His Ala Leu Ala Val Thr Ile Met Pro Leu Ala Ile Gly Leu Ala

115 120 125

Ala Ala Ile Ala Gly Gly Ala Ala

130 135

<210> 5

<211> 444

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-5

<400> 5

atggcccgca cgaagcagac ggcgcgcaag tcgacgggcg gcaaggcgcc ccgcaagcag 60

ctggccacca aggcggcgcg caagtcggcg ccggcaaccg gtggcgtgaa gaagcctcac 120

cgcttccgcc ccggcaccac tagtcaccgc tggcggccag ggactgtagc gctgcgggag 180

atcaggaagt accagaagtc cactgaaccg ctcatcccct ttgcgccttt cgtccgtgtg 240

gtgagggagt taaccaattt cgtaacaaac gggaaagtag agcgctatac cgcagaagcc 300

ctccttgcgc tgcaagaggc agcagaattc cacttgatag aactgtttga aatggcgaat 360

ctgtgtgcca tccatgccaa gcgtgtcaca atcatgcaaa aggacataca acttgcaagg 420

cgtatcggag gaaggcgttg ggca 444

<210> 6

<211> 148

<212> PRT

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-6

<400> 6

Met Ala Ala Thr Leu Gly Thr Ala Ala Leu Ser Thr Gly Gly Leu Ala

1 5 10 15

Pro Ala Leu Gly Leu Ala Thr Leu Ala Ala Ala Leu Ser Ala Pro Ala

20 25 30

Thr Gly Gly Val Leu Leu Pro His Ala Pro Ala Pro Gly Thr Thr Ser

35 40 45

His Ala Thr Ala Pro Gly Thr Val Ala Leu Ala Gly Ile Ala Leu Thr

50 55 60

Gly Leu Ser Thr Gly Pro Leu Ile Pro Pro Ala Pro Pro Val Ala Val

65 70 75 80

Val Ala Gly Leu Thr Ala Pro Val Thr Ala Gly Leu Val Gly Ala Thr

85 90 95

Thr Ala Gly Ala Leu Leu Ala Leu Gly Gly Ala Ala Gly Pro His Leu

100 105 110

Ile Gly Leu Pro Gly Met Ala Ala Leu Cys Ala Ile His Ala Leu Ala

115 120 125

Val Thr Ile Met Gly Leu Ala Ile Gly Leu Ala Ala Ala Ile Gly Gly

130 135 140

Ala Ala Thr Ala

145

<210> 7

<211> 711

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-7

<400> 7

atgttgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60

gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120

cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180

ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240

cccgccgaca tccccgacta cctcaagctg tccttccccg agggcttcaa gtgggagcgc 300

gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360

ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgtc 420

atgcagaaga agaccatggg ctgggaggcc tcctccgagc gcatgtaccc cgaggacggc 480

gccctgaagg gcgagatcaa gcagcgcctg aagctgaagg acggcggcca ctacgacgct 540

gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600

aacatcaagc tcgacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgaa 660

cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaagta a 711

<210> 8

<211> 236

<212> PRT

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-8

<400> 8

Met Leu Ser Leu Gly Gly Gly Ala Ala Met Ala Ile Ile Leu Gly Pro

1 5 10 15

Met Ala Pro Leu Val His Met Gly Gly Ser Val Ala Gly His Gly Pro

20 25 30

Gly Ile Gly Gly Gly Gly Gly Gly Ala Pro Thr Gly Gly Thr Gly Thr

35 40 45

Ala Leu Leu Leu Val Thr Leu Gly Gly Pro Leu Pro Pro Ala Thr Ala

50 55 60

Ile Leu Ser Pro Gly Pro Met Thr Gly Ser Leu Ala Thr Val Leu His

65 70 75 80

Pro Ala Ala Ile Pro Ala Thr Leu Leu Leu Ser Pro Pro Gly Gly Pro

85 90 95

Leu Thr Gly Ala Val Met Ala Pro Gly Ala Gly Gly Val Val Thr Val

100 105 110

Thr Gly Ala Ser Ser Leu Gly Ala Gly Gly Pro Ile Thr Leu Val Leu

115 120 125

Leu Ala Gly Thr Ala Pro Pro Ser Ala Gly Pro Val Met Gly Leu Leu

130 135 140

Thr Met Gly Thr Gly Ala Ser Ser Gly Ala Met Thr Pro Gly Ala Gly

145 150 155 160

Ala Leu Leu Gly Gly Ile Leu Gly Ala Leu Leu Leu Leu Ala Gly Gly

165 170 175

His Thr Ala Ala Gly Val Leu Thr Thr Thr Leu Ala Leu Leu Pro Val

180 185 190

Gly Leu Pro Gly Ala Thr Ala Val Ala Ile Leu Leu Ala Ile Thr Ser

195 200 205

His Ala Gly Ala Thr Thr Ile Val Gly Gly Thr Gly Ala Ala Gly Gly

210 215 220

Ala His Ser Thr Gly Gly Met Ala Gly Leu Thr Leu

225 230 235

<210> 9

<211> 20

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-9

<400> 9

atggcccgca cgaagcagar 20

<210> 10

<211> 20

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-10

<400> 10

cctcggggaa ggacagcttc 20

<210> 11

<211> 23

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-11

<400> 11

acggaaggag taagaggatg ttt 23

<210> 12

<211> 20

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-12

<400> 12

cggtagtcct tcccgttcac 20

<210> 13

<211> 22

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-13

<400> 13

gcaaagtctg ccgccttaca ac 22

<210> 14

<211> 24

<212> DNA/RNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum-14

<400> 14

tgttatccgc tcacaattcc acac 24

Claims

1. A method for increasing the induction rate of a maize haploid inducer line by genetically engineering a CENH3 protein, the method comprising the steps of:

The method comprises the steps of firstly, replacing the sequence of the N end in a corn CENH3 gene with the N end sequence of a corn H3 gene to obtain a preliminary modified gene 1, wherein the modified gene 1 is shown as SEQ ID NO.5, cloning the gene 1 into a plant overexpression vector pCAMBIA3301-RFP taking a Ubiquitin as a promoter and containing a large molecular weight tag, constructing a vector UBI for over-expressing a centromere specific fusion protein, namely M-tailswap-RFP, and transforming the overexpression vector into a corn receptor to obtain a positive transformant strain LH244 ^{M-tailswap-RFP};

Step two, hybridizing the positive transformant line with a corn receptor parent CAU5 to obtain a hybrid generation 1, then continuously backcrossing 2 generations by taking the CAU5 as a recurrent parent, then selfing for at least 4 generations, and finally forming a novel induction line with high induction rate;

In the first step, the specific fusion protein of the centromere is specifically a fusion expression protein which is formed by replacing the N-end amino acid sequence of the specific histone CENH3 of the maize centromere with the N-end amino acid sequence of the small histone H3 of the maize kernel and connecting a large molecular weight fluorescent tag RFP at the C end of the CENH3 protein; the transformation adopts an agrobacterium embryo leaching method; the corn receptor line adopts LH244 line;

In the second step, the acceptor parent corn is a Stock 6-derived corn haploid induction line CAU5.

2. The method for increasing the induction rate of a maize haploid inducer by genetically engineering a CENH3 protein of claim 1, wherein in step one, the large molecular weight tag is RFP fluorescent protein.