CN114574507B - Key gene for regulating biosynthesis of zeaxanthin palmitate and application thereof - Google Patents

Abstract

The invention provides a key gene LbPYP1 for regulating and controlling zeaxanthin palmitate synthesis, and the sequence of the key gene LbPYP1 is shown as SEQ ID NO. 1. The LbPYP1 gene has an acyltransferase function, can promote the synthesis of carotenoid, can specifically regulate and control the palmitoylation of zeaxanthin in medlar, is converted into zeaxanthin dipalmitate (lycium red), can be expressed in tobacco, can generate carotenoid compounds which are not contained in wild tobacco, namely zeaxanthin monopalmitate, and can greatly improve the total carotenoid content of tobacco leaves. The LbPYP1 gene can be used for preparing transgenic plant varieties with high carotenoid content and high health care value, and has good application prospect.

Description

Key gene for regulating biosynthesis of zeaxanthin palmitate and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a key gene for regulating and controlling biosynthesis of zeaxanthin palmitate and application thereof.

Background

The genus Lycium (Lycium L.) belongs to the Solanaceae family (Solanaceae), and there are 80 species worldwide, and 7 species and 2 varieties are distributed in China. Wherein, the root system of the red matrimony vine (Lycium bararum.L) is developed, the cold-resistant and drought-resistant capability is strong, the ecological adaptability is wide, and the red matrimony vine is widely planted in Ningxia, qinghai and other places in China. The medlar serving as a traditional rare traditional Chinese medicine in China has wide application in liver clearing, eyesight improving and qi supplementing, has high nutritive value, and has been widely paid attention to researchers for a long time except for the red medlar, such as the black medlar (Lycium ruthenicum Murr.), and varieties of yellow medlar (Lycium barbarum L.var.aurorarum K.F.child) with the same plant phenotype and fruit type as the red medlar.

Researches show that the red wolfberry contains a large amount of carotenoids which cannot be synthesized by human beings, and has high health care value; the carotenoid content of the yellow fruit Chinese wolfberry accounts for only 32% of that of the red Chinese wolfberry, and the carotenoid content in the black Chinese wolfberry is even only 1/10 of that of the yellow fruit Chinese wolfberry. Among them, carotenoids formed by palmitoylation of zeaxanthin, such as zeaxanthin monopalmitate, zeaxanthin dipalmitate (lycine red), and the like, have many excellent effects. For example, the content of the lycium barbarum red is most abundant in the red lycium barbarum, and accounts for more than 56-75% of the total pigment substances, and researches prove that the lycium barbarum red has good liver protection effect. Many reports indicate that the lycium barbarum red can improve liver injury, relieve liver fibrosis and intrahepatic oxidative stress, improve liver fat metabolic disorder and hepatitis, and also has an inhibiting effect on replication of hepatitis B virus.

The cultivation of the wolfberry variety with high zeaxanthin palmitate yield and the transgenic plant capable of producing the zeaxanthin palmitate have good market application value due to the excellent health care effect of the zeaxanthin palmitate.

Disclosure of Invention

The invention aims to provide a key gene for regulating biosynthesis of zeaxanthin palmitate.

The invention provides a gene, the nucleotide sequence of which is shown as SEQ ID NO. 1.

The invention also provides a recombinant vector comprising the nucleotide sequence shown in SEQ ID NO.1, preferably the recombinant vector is a pcambiac2300 vector comprising the nucleotide sequence shown in SEQ ID NO. 1.

The invention provides a recombinant bacterium which comprises the recombinant vector.

Further, the recombinant bacterium is recombinant agrobacterium, preferably recombinant agrobacterium LBA4404.

The invention also provides a construction method of the transgenic plant for producing carotenoid, namely, the gene is taken and transferred into the plant.

Further, the method for transferring the plant is one of an agrobacterium method, a gene gun method, an electrotransfer method, a PEG-mediated method, a liposome method and a calcium phosphate-DNA coprecipitation method; the Agrobacterium method is preferred.

Further, the plant is tobacco.

Further, the above carotenoids comprise zeaxanthin palmitate, preferably the zeaxanthin palmitate comprises zeaxanthin monopalmitate and/or zeaxanthin dipalmitate.

The invention also provides application of the gene, the recombinant vector or the recombinant bacterium in preparing plant varieties for producing carotenoid; preferably, the carotenoid comprises zeaxanthin palmitate; more preferably, the zeaxanthin palmitate comprises zeaxanthin monopalmitate and/or zeaxanthin dipalmitate.

The invention also provides application of the gene, the recombinant vector or the recombinant bacterium in preparing a reagent for promoting carotenoid synthesis; preferably, the carotenoid comprises zeaxanthin palmitate; more preferably, the zeaxanthin palmitate comprises zeaxanthin monopalmitate and/or zeaxanthin dipalmitate.

The invention has the beneficial effects that: the invention discovers that a key gene LbPYP1 gene for regulating and controlling the synthesis of lycium barbarum red in red matrimony vine has an acyltransferase function, can promote the synthesis of carotenoid, can regulate and control the palmitoylation of zeaxanthin in matrimony vine, can be converted into zeaxanthin dipalmitate (lycium barbarum red), and can improve the liver protection and health care value of matrimony vine. In addition, the gene can be expressed in tobacco to generate a carotenoid compound which is not contained in wild tobacco, namely zeaxanthin monopalmitate, and the total carotenoid content of tobacco leaves is greatly improved. The novel gene, the recombinant vector and the recombinant bacterium thereof provided by the invention can be used for preparing transgenic plant varieties with high carotenoid content and high health care value, and have good application prospects.

The invention relates to a lycine, which is also called zeaxanthin dipalmitate, zeaxanthin dipalmitate or zeaxanthin dipalmitate.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

FIG. 1 is a photograph of a transgenic tobacco in differentiation (left) and partially transgenic tobacco in rooting (right) phase.

Detailed Description

The raw materials and equipment used in the invention are all known products and are obtained by purchasing commercial products.

Example 1 determination of the Gene regulating the Synthesis of Lycium barbarum Red according to the invention

By transcriptome analysis of differential expression genes of red matrimony vine and yellow matrimony vine, it is clear that zeaxanthin in yellow matrimony vine fruit is the carotenoid compound with the highest content, and that the matrimony vine red is also precisely to use zeaxanthin as a substrate. The content of the zeaxanthin is increased along with the development of the yellow wolfberry fruits, the content of the lycium barbarum red is increased along with the development of the red wolfberry fruits, and the zeaxanthin is changed from one to another, so that the fact that the zeaxanthin is mainly palmitoylated in the red wolfberry results in a large accumulation of the lycium barbarum red is further proved.

Transcriptome analysis found a new gene: lbPYP1 and is identified as a key gene whose transcription leads to an increase in the conversion of zeaxanthin to zeaxanthin dipalmitate (lycine). The results of screening and statistics of carotenoid structural gene expression levels are shown in Table 1:

TABLE 1 screening statistics of LbPYP1 Gene expression level in Red matrimony vine and yellow matrimony vine

The sequence of the LbPYP1 gene is:

SEQ ID NNO.1：

ATGGGTGATCCAATGAAGATGGCGATGGTTAACATTGATTCCATGCTTCCTCCTGGACAAATTATTCAACGTCTCTCTGACAACCTCACTGGTTTGCTGGCACACCTCTCTGGCTTAGCTGATATCATACCGAAGGAAACTCTTCTCTGGAAGTTGAAGCTTCTTAGATCTGCTTCATCTTATTCAAATTCCCGCCTCCATGCTGTTAATGCTGAAGTACTTGTGATTGCTAGTGGCAAGGATAACATGCTTCCAAGTGGAGATGAAGCTCAGAGGCTTGCAAATTCATTAAGAAACTGCAAAGTACGATACTTCAAAGACAATGGGCATACTATTTTATTGG-AAGATGGTATTAATCTGCTAACCATCATCAAAAGTACTAGCAAATATCGTCGTTCGAAAAGGCACGATTATGTCATGGATTTTCTGCCTCCTAGTGAGTCAGAATTCAAGAACGCACTCAAGGACAATAGATGGTATCTCAATTTTACTAGTCCAGTTATGCTGTCCACAATGGAAAATGGGAAAATTGTAAGAGGTCTAGCAGGGGTCCCATGTGAAGGCCCTGTGTTGTTGGTCGGTTATCACATGCTTATGGGATTAGAAATTACCCCTCTTGTTTCAGAATATTTGAGGCAGAGGAAAATTTTACTTCGTGGTATAGCACATCCGACATTGTTTACTCAGATGACTGAGAGTCAAACTAATGAAAGCTCATTCACTGATGTGCTGAGACTATATGGAGCTACGCCTGTCAGTGCCAGCAACTTCTTTAAGTTGCTTGCAACAAAGTCACATGTTCTGCTGTATCCTGGTGGTGCCCGTGAGGCCTTACATCGTAAGGGAGAAGAGTACAAGGCGATTTGGCCTGATCAACCAGAATTCATCAGAATGGCTGCAAGGTTTGGTGCGACAATTGTGCCATTTGGGGTTGTAGGGGAAGATGATATAGCACAGTTAGTTCTCGACTATGACGACCTAAAAAATATTCCTATAGTGGGTGATCGGATAAGGCGTGATAACGAACAGGCAGCCAGGAGGGGTTTAGCAGTCAGGGCGGACATGGACGGGGAGGTTGCCAACCAAGCGCTGTATCTCCCGGGCCTTTTACCTAAGATACCCGGTCGTTTTTACTACTTGTTTGGAAAACCTATTCATACGAAGGGAAGGAAGGACCTGGTGAAAGACAGAGAGAAAGCAAGAGAATTGTACTTGCGGGTAAAATCTGAAGTTCAAAATAACATGAATTATTTGCTTAAGAAAAGAGAGGAGGATCCTTACCGAAGCGTCATTGATCGGACCGTGCATAAAGCATTTTCTGCAACGTTTAATGATGTCCCAACATTTGATTATTAA。

example 2 preparation of transgenic tobacco

Constructing a plant expression vector pcambiac2300 with a CaMV35S promoter by utilizing a homologous recombination mode, carrying out double enzyme digestion on a target strip and the vector after amplifying the target strip by double enzyme digestion primers F-SacI: GGgagctcATGGGTGATCCAATGAAGAT and R-XbaI: GGtctagaTTAATAATCAAATGTTGGGA, carrying out linking transformation DH5 alpha competence on fragments recovered by two gels by T4 ligase, and picking a positive colony single-spot extraction plasmid to obtain the constructed expression vector pcambiac2300: lbPYP1, transformed with Agrobacterium LBA4404, infested with plant tobacco Samsun, and subjected to differentiation, screening, rooting and seedling hardening to obtain 18 transgenic positive tobacco plants (figure 1).

The total carotenoid in the leaves of wild type tobacco was measured at 160.3ug/g, and the total carotenoid in the leaves of transgenic tobacco reached 207.05ug/g, while zeaxanthin monopalmitate, a carotenoid compound not contained in wild type tobacco, was also detected in 18 transgenic tobacco.

That is, lbPYP1 has the function of regulating palmitoylation, and in tobacco, not only can activate the synthesis of zeaxanthin monopalmitate which is a carotenoid compound not contained in wild tobacco, but also can greatly improve the total carotenoid content of tobacco leaves and improve the health care value.

In conclusion, the invention provides a key gene LbPYP1 for regulating and controlling the synthesis of lycium barbarum, wherein the LbPYP1 gene has an acyltransferase function, can promote the synthesis of carotenoid, can regulate and control the palmitoylation of zeaxanthin in the lycium barbarum, can be converted into zeaxanthin dipalmitate (lycium barbarum), and can improve the liver protection and health care value of the lycium barbarum. In addition, the gene can be expressed in tobacco to generate a carotenoid compound which is not contained in wild tobacco, namely zeaxanthin monopalmitate, and the total carotenoid content of tobacco leaves is greatly improved. The novel gene, the recombinant vector and the recombinant bacterium thereof provided by the invention can be used for preparing transgenic plant varieties with high carotenoid content and high health care value, and have good application prospects.

SEQUENCE LISTING

<110> national academy of sciences northwest high Protozoa institute

<120> key gene regulating zeaxanthin palmitate biosynthesis and use thereof

<130> GY417-2022P0114821CC

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1356

<212> DNA

<213> LbPYP1

<400> 1

atgggtgatc caatgaagat ggcgatggtt aacattgatt ccatgcttcc tcctggacaa 60

attattcaac gtctctctga caacctcact ggtttgctgg cacacctctc tggcttagct 120

gatatcatac cgaaggaaac tcttctctgg aagttgaagc ttcttagatc tgcttcatct 180

tattcaaatt cccgcctcca tgctgttaat gctgaagtac ttgtgattgc tagtggcaag 240

gataacatgc ttccaagtgg agatgaagct cagaggcttg caaattcatt aagaaactgc 300

aaagtacgat acttcaaaga caatgggcat actattttat tggaagatgg tattaatctg 360

ctaaccatca tcaaaagtac tagcaaatat cgtcgttcga aaaggcacga ttatgtcatg 420

gattttctgc ctcctagtga gtcagaattc aagaacgcac tcaaggacaa tagatggtat 480

ctcaatttta ctagtccagt tatgctgtcc acaatggaaa atgggaaaat tgtaagaggt 540

ctagcagggg tcccatgtga aggccctgtg ttgttggtcg gttatcacat gcttatggga 600

ttagaaatta cccctcttgt ttcagaatat ttgaggcaga ggaaaatttt acttcgtggt 660

atagcacatc cgacattgtt tactcagatg actgagagtc aaactaatga aagctcattc 720

actgatgtgc tgagactata tggagctacg cctgtcagtg ccagcaactt ctttaagttg 780

cttgcaacaa agtcacatgt tctgctgtat cctggtggtg cccgtgaggc cttacatcgt 840

aagggagaag agtacaaggc gatttggcct gatcaaccag aattcatcag aatggctgca 900

aggtttggtg cgacaattgt gccatttggg gttgtagggg aagatgatat agcacagtta 960

gttctcgact atgacgacct aaaaaatatt cctatagtgg gtgatcggat aaggcgtgat 1020

aacgaacagg cagccaggag gggtttagca gtcagggcgg acatggacgg ggaggttgcc 1080

aaccaagcgc tgtatctccc gggcctttta cctaagatac ccggtcgttt ttactacttg 1140

tttggaaaac ctattcatac gaagggaagg aaggacctgg tgaaagacag agagaaagca 1200

agagaattgt acttgcgggt aaaatctgaa gttcaaaata acatgaatta tttgcttaag 1260

aaaagagagg aggatcctta ccgaagcgtc attgatcgga ccgtgcataa agcattttct 1320

gcaacgttta atgatgtccc aacatttgat tattaa 1356

<210> 2

<211> 28

<212> DNA

<213> F-SacI

<400> 2

gggagctcat gggtgatcca atgaagat 28

<210> 3

<211> 28

<212> DNA

<213> R-XbaI

<400> 3

ggtctagatt aataatcaaa tgttggga 28

Claims (14)

1. A gene is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.

2. A recombinant vector comprising the nucleotide sequence shown in SEQ ID No. 1.

3. The recombinant vector of claim 2, wherein the recombinant vector is a recombinant pcambiac2300 vector comprising the nucleotide sequence of SEQ ID No. 1.

4. A recombinant bacterium comprising the recombinant vector of any one of claims 2-3.

5. The recombinant bacterium according to claim 4, which is a recombinant agrobacterium.

6. The recombinant bacterium of claim 5, wherein the recombinant bacterium is agrobacterium tumefaciens LBA4404.

7. A method for constructing a transgenic plant producing carotenoid, which is characterized in that the gene of claim 1 is taken and transferred into the plant; the plant is tobacco.

8. The method of claim 7, wherein the method of transferring into a plant is one of agrobacterium, biolistic, electrotransfer, PEG-mediated, liposome, and calcium phosphate-DNA co-precipitation.

9. The method of claim 8, wherein the method of transferring plants is agrobacterium.

10. The method of claim 7, wherein the carotenoid is zeaxanthin palmitate.

11. Use of the gene of claim 1, the recombinant vector of any one of claims 2-3 or the recombinant bacterium of any one of claims 4-6 in the preparation of a carotenoid-producing plant variety; the plant is tobacco.

12. The use according to claim 11, wherein the carotenoid is zeaxanthin palmitate.

13. Use of the gene of claim 1, the recombinant vector of any one of claims 2-3 or the recombinant bacterium of any one of claims 4-6 for the preparation of a medicament for promoting carotenoid synthesis.

14. The use according to claim 13, wherein the carotenoid is zeaxanthin palmitate.