CN106701958A - Molecular marker of rice drought-resistant gene and application of molecular marker - Google Patents
Molecular marker of rice drought-resistant gene and application of molecular marker Download PDFInfo
- Publication number
- CN106701958A CN106701958A CN201710025038.8A CN201710025038A CN106701958A CN 106701958 A CN106701958 A CN 106701958A CN 201710025038 A CN201710025038 A CN 201710025038A CN 106701958 A CN106701958 A CN 106701958A
- Authority
- CN
- China
- Prior art keywords
- rice
- nced
- drought
- gene
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a CAPs molecular marker of a rice drought-resistant gene Nced and application of the CAPs molecular marker, and relates to the fields of rice drought-resistant molecular design breeding and molecular genetics. Primer sequences of the molecular marker are characterized in that a positive primer sequence is CACACCCCAAGAAGGACCC, and a reverse primer sequence is AATCACCAGAGCCGACGAGA. The CAPs molecular marker has the advantages that an individual with a land rice ecological differentiation gene (T type Nced) is effectively screened, the drought-resistant allelic gene is selected in a pertinence way, and the drought-resistant rice is quickly and effectively selected and used as a new variety.
Description
Technical field
The present invention relates to a molecular labeling for Rice Drought Resistence functional gene, belong to Rice Drought Resistence Molecular design breeding and divide
Sub- genetic arts, and in particular to a kind of molecular labeling of Rice Drought Resistence gene and its application.
Background technology
Plant drought includes the change of morphology and Physiology and biochemistry, is a considerably complicated process.Come from physiological mechanism
See, plant resists drought stress in the presence of escaping drought, keeping away drought, drought tolerance and restoring the mechanism such as drought resistance, and they are generally with one kind
Based on drought resisting mechanism, various drought resisting mechanism collective effects are finally reached the purpose for resisting arid.Plant drought resistance is mainly plant
In order to adapt to the natural environment of arid, by long-term natural selection and hereditary variation, a set of special adaptation drought environment is formed
Physiological mechanism.
Paddy rice can be by setting up flourishing root system to hide arid soil horizon.Numerous studies show, root system between rice varieties
The difference of growth is often one of major reason of its drought resisting sex differernce.DRO1 is subject to auxin negative regulation, and have impact on
The cell elongation at tip of a root position, so as to cause the asymmetric growth of root system and gravimetric response is bent downwardly, makes its growth side
To more vertical, change root system configuration, so that improving paddy rice keeps away non-irrigated ability (Uga et al., 2013)；OsDSR-1 encodes one
Calbindin, is a gene for participating in boot stage and heading stage drought stress response in paddy rice, while OsDSR-1 is ABA
Suppress the positive regulatory factor of lateral root growth, research it has also been found that OsDSR-1 is probably a Ca in signal transduction path2+Impression
Son, may participate in the development (Yin et al., 2011) of lateral root under the conditions of regulation and control potassium high；OsNAC9 and OsNAC10 encodes a NAC
(NAM, ATAF and CUC) transcription factor, in the specifically expressing of rice root, growing for forward direction regulation rice root increases
Strong drought-resistant ability, and then improve the rice yield under drought condition (Jeong et al., 2010；Redillas et
al.,2012)；OsiSAP8 is a SAP Stress Related Protein family member, and coding one has A20 and AN1 type zinc fingerses
The albumen in domain, may in the signal transduction of various stress response early stages function, the overexpression in tobacco and paddy rice
OsiSAP8 can improve plant pair salt, the tolerance of arid and cold stress, under stress conditions and in stress recovery, transgenosis
The elongation of the chlorophyll holding of plant, germination percentage, plant fresh weight, root and overground part and leaf development are all significantly better than adjoining tree
(Kanneganti and Gupta,2008).Therefore, root system development and improvement are considered as most important raising Rice Drought Resistence ability
One of approach.
Due to 9- it is cis-epoxy carotenoid dioxygenase (9-cis-epoxycarotenoid dioxygenase,
Nced it is) crucial speed limit enzyme gene in abscisic acid (abscisic acid, ABA) route of synthesis, the gene can regulate and control ABA and exist
The proterties such as root system development, improves the terrestrial adaptability of plant under the conditions of distribution and level in plant body, and then regulation and control nonirrigated farmland, is changing
There is important application value in good conventional Rice Drought-resistant Breeding.At present, the drought resisting problem of reply crop (particularly paddy rice), passes through
The genes such as transgenic approach overexpression some transcription factors, protein kinase, can reach corresponding drought resisting purpose, but commercialization should
Longer time is wanted with still needing, and using the molecular marker assisted selection breeding of gene related to drought tolerance, is targetedly identified anti-
Non-irrigated related gene, fast and effectively can make new varieties by seed selection drought resisting rice.
The content of the invention
In view of the shortcomings of the prior art, the invention provides with dryland rice ecotype differentiation SNP site (Nced genes) inspection
Digestion amplification polymorphism sequence (Cleaved Amplified Polymorphic Sequences, the CAPS) mark of survey, by
The mark can be with individuality of the Effective selection with dryland rice ecotype differentiation (T-shaped) Nced allele, for drought resisting paddy rice new product
The cultivation planted.
The present invention is achieved by the following technical programs：
A kind of molecular labeling primer of Rice Drought Resistence gene, its sequence is：
Forward primer sequence (NCED-SNP-F)：CACACCCCAAGAAGGACCC
Reverse primer sequences (NCED-SNP-R)：AATCACCAGAGCCGACGAGA
The molecule labelling method of the Rice Drought Resistence gene, comprises the following steps：
(1) genomic DNA of paddy rice to be measured is extracted；
(2) enter performing PCR to oryza sativa genomic dna with molecular labeling primer NCED-SNP-F/R to expand；
(3) plant DNA to be measured is expanded with PCR, obtains the fragment that a size is 657bp, through VspI digestions after, if obtaining
Two sizes are respectively the fragment of 200bp and 457bp, then show there is the T-shaped anti-drought gene Nced of dryland rice in sample gene group, if
There was only a banding pattern of 657bp after digestion, then show there is no dryland rice type (T-shaped) drought resisting allele in paddy rice sample gene
Nced。
The present invention also provides a kind of application of molecular labeling of Rice Drought Resistence gene in the cultivation of drought resisting new rice variety.
Beneficial effects of the present invention：The CAPs molecular labelings that the present invention is developed can be to the T-shaped anti-drought gene of dryland rice
(Nced) codominant marker of genotype identification is carried out, compared with prior art with advantages below and effect：
(1) by the screening to genetic marker, can screen what is improved with (T-shaped) ecotype Nced of dryland rice and drought resistance
Breeding material.
(2) molecular labeling of the invention can be used for the genotype selection of breeding population, effectively differentiates and carries T-shaped Nced
The individuality of gene, accelerates breeding process.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
The accompanying drawing to be used needed for having technology description is briefly described, it should be apparent that, drawings in the following description are only this
Some embodiments of invention, for those of ordinary skill in the art, on the premise of not paying creative work, can be with
Other accompanying drawings are obtained according to these accompanying drawings.
Fig. 1:Molecular labeling polyacrylamide gel electrophoresis figure
M：DNA ladder；
1-45：Molecular marker assisted selection breeding transitional population difference individual plant Nced genotype；
A：C-type Nced；
B：T-shaped Nced；
H：Heterozygous Nced.
Fig. 2：Drought-resistant Breeding phenotypic analysis
A：Seed phenotypic analysis；B：Dry land different genotype more light root system phenotypic analysis
1,2：Paddy field more light (c-type)；3,4：Dry land more light (c-type)；5,6：Dry land more light (T-shaped)；7,8：Dry land IRAT104
(T-shaped)；Arrow represents flat grain.
Specific embodiment
To make the purpose, technical scheme and advantage of the embodiment of the present invention clearer, below in conjunction with the embodiment of the present invention,
Technical scheme in the embodiment of the present invention is clearly and completely described, it is clear that described embodiment is the present invention one
Divide embodiment, rather than whole embodiments.Based on the embodiment in the present invention, those of ordinary skill in the art are not making
The every other embodiment obtained under the premise of creative work, belongs to the scope of protection of the invention.
Embodiment 1：
The 1 CAPs molecular labeling primers for designing and developing Rice Drought Resistence gene Nced, its sequence is：
Forward primer sequence (NCED-SNP-F)：CACACCCCAAGAAGGACCC
Reverse primer sequences (NCED-SNP-R)：AATCACCAGAGCCGACGAGA
The CAPs molecular labelings of the 2 Rice Drought Resistence gene Nced provided using the present invention, cultivate drought resisting rice new strain
(kind), comprises the following steps：
(1) with dryland rice IRAT104 as male parent, with cultivated rice more light as maternal, hybridized, be returned, obtained different generations
Segregating population；
(2) genomic DNA of the above-mentioned single plant of segregating population is extracted, with it as template, primer NCED-SNP-F/R is used
Expanded, obtained the fragment that a size is 657bp；
(3) VspI digestion PCR primers are utilized, by 8% non denatured polyacrylamide gel electrophoresis isolated fragment, then is used
Cma staining, band is cut with reference to the amplification enzyme of parents, and the genotype to per generation breeding material differentiates.
Experimental result：After electrophoretic separation, silver staining, 3 kinds of genotype banding patterns are obtained, respectively dryland rice is environmental (T-shaped
Nced), comprising two bands of 200bp and 457bp, these individual plants then show stronger drought resistance in proterties；Other two point
Not Wei paddy rice type (c-type Nced) a 657bp banding pattern and the heterozygosis banding pattern with above-mentioned three band.
With reference to genotype identification result and field general performance, screening obtains Drought-resistant more light, is temporarily named as T- more light (figure
1)。
Wild type more light (C- more light) is tested with the performance comparison of the Drought-resistant more light rice (T- more light) cultivated：
1st, field test is carried out to C- more light, T- more light according to RANDOMIZED BLOCK DESIGN on paddy field and nonirrigated farmland.
2nd, interpretation of result
Phenotypic evaluation is found, under the conditions of paddy field, control C- more light and T- more light setting percentages are acted normally, and yield is suitable；
Under the conditions of nonirrigated farmland, control C- more light setting percentages are abnormal (58%), and T- more light setting percentages are normal (87%), and T- more light is produced
Amount (per mu yield 459kg) is significantly higher than control C- more light (per mu yield 379kg) (Fig. 2A)；Root system phenotypic analysis finds, under the conditions of nonirrigated farmland,
T- more light root systems are substantially than control C- more light prosperity (Fig. 2 B), thus it is speculated that (c-type Nced replaces with T-shaped the replacement of Nced allele
Nced root system development) can be promoted and then drought resistance is improved.
3rd, experiment conclusion：The CAPs molecular labelings developed using Nced genes land and water differentiation SNP site cultivate Drought-resistant water
Rice has realistic meaning in Drought-resistant Breeding, practical.
The gene numbering of Nced in the present invention (9- cis-epoxy carotenoid dioxygenase) is Os12g0435200, water
The gene of rice type is C in the base of 1009, therefore is c-type (complementary base is G) by the Nced unnamed genes of paddy rice type, is passed through
Nced genes in paddy rice are replaced with the T-shaped Nced allele of dryland rice with drought resistance function by MAS technologies, and impart paddy rice
Stronger drought-resistant ability.
To sum up, the present invention has the advantages that：The present invention can be carried by the CAPs molecular labelings with Effective selection
The individuality of dryland rice Ecological differentiation type (T-shaped) Nced genes, targetedly selects the gene related to drought tolerance, fast and effectively seed selection
Drought resisting rice makees new varieties.
It should be noted that herein, such as first and second or the like relational terms are used merely to a reality
Body or operation make a distinction with another entity or operation, and not necessarily require or imply these entities or deposited between operating
In any this actual relation or order.And, term " including ", "comprising" or its any other variant be intended to
Nonexcludability is included, so that process, method, article or equipment including a series of key elements not only will including those
Element, but also other key elements including being not expressly set out, or also include being this process, method, article or equipment
Intrinsic key element.In the absence of more restrictions, the key element limited by sentence "including a ...", it is not excluded that
Also there is other identical element in process, method, article or equipment including the key element.
The above embodiments are merely illustrative of the technical solutions of the present invention, rather than its limitations；Although with reference to the foregoing embodiments
The present invention has been described in detail, it will be understood by those within the art that：It still can be to foregoing each implementation
Technical scheme described in example is modified, or carries out equivalent to which part technical characteristic；And these modification or
Replace, do not make the spirit and scope of the essence disengaging various embodiments of the present invention technical scheme of appropriate technical solution.
Claims (3)
1. a kind of CAPs molecular labelings of Rice Drought Resistence gene Nced, it is characterised in that the sequence of the molecular labeling primer is：
Forward primer sequence (NCED-SNP-F)：CACACCCCAAGAAGGACCC
Reverse primer sequences (NCED-SNP-R)：AATCACCAGAGCCGACGAGA.
2. CAPs molecular labelings of Rice Drought Resistence gene Nced as claimed in claim 1, it is characterised in that the molecular labeling
Using comprising the following steps：
(1) genomic DNA of paddy rice to be measured is extracted；
(2) enter performing PCR to oryza sativa genomic dna with primer NCED-SNP-F/R to expand；
(3) plant DNA to be measured is expanded with PCR, obtains the fragment that a size is 657bp, through VspI digestions after, if obtaining two
Size is respectively the fragment of 200bp and 457bp, then show there is the T-shaped drought resisting allele Nced of dryland rice in sample gene group, if
There was only a banding pattern of 657bp after digestion, then show there is no dryland rice type (T-shaped) drought resisting allele in paddy rice sample gene
Nced。
3. the application of the CAPs molecular labelings of the Rice Drought Resistence gene Nced as described in power requires 1 or 2, it is characterised in that described
Application of the CAPs molecular labelings of Rice Drought Resistence gene Nced in the cultivation of drought resisting new rice variety.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710025038.8A CN106701958A (en) | 2017-01-13 | 2017-01-13 | Molecular marker of rice drought-resistant gene and application of molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710025038.8A CN106701958A (en) | 2017-01-13 | 2017-01-13 | Molecular marker of rice drought-resistant gene and application of molecular marker |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106701958A true CN106701958A (en) | 2017-05-24 |
Family
ID=58907555
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710025038.8A Pending CN106701958A (en) | 2017-01-13 | 2017-01-13 | Molecular marker of rice drought-resistant gene and application of molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701958A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107630103A (en) * | 2017-10-13 | 2018-01-26 | 华南农业大学 | A kind of CAPS molecule labelling methods for identifying rice varieties and application |
| CN108048597A (en) * | 2018-01-22 | 2018-05-18 | 中国农业科学院作物科学研究所 | SNP marker relevant with Rice Drought Resistence and its application |
| CN117051036A (en) * | 2023-08-29 | 2023-11-14 | 云南大学 | Application of OsDTRF1 gene in regulation and control of drought resistance and yield of plants |
| CN118006822A (en) * | 2024-01-24 | 2024-05-10 | 上海市农业生物基因中心 | Probe combination, detection system and application of water-saving drought-resistant rice breeding chip (WDR 6K) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003020015A2 (en) * | 2001-08-30 | 2003-03-13 | Purdue Research Foundation | Methods to produce transgenic plants resistant to osmotic stress |
| CN103233024A (en) * | 2013-03-07 | 2013-08-07 | 中国科学院昆明动物研究所 | Paddy rice lateral root density-related coding gene and use thereof |
| CN105368849A (en) * | 2015-11-25 | 2016-03-02 | 天津大学 | Lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with function of stress resistance and application of lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with function of stress resistance |
-
2017
- 2017-01-13 CN CN201710025038.8A patent/CN106701958A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003020015A2 (en) * | 2001-08-30 | 2003-03-13 | Purdue Research Foundation | Methods to produce transgenic plants resistant to osmotic stress |
| CN103233024A (en) * | 2013-03-07 | 2013-08-07 | 中国科学院昆明动物研究所 | Paddy rice lateral root density-related coding gene and use thereof |
| CN105368849A (en) * | 2015-11-25 | 2016-03-02 | 天津大学 | Lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with function of stress resistance and application of lycium 9-cis-epoxy-carotenoid dioxygenase enzyme gene with function of stress resistance |
Non-Patent Citations (3)
| Title |
|---|
| NEB: "REBASE Enz Num 2124", 《REBASE》 * |
| SHINOBU NASU 等: "Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers", 《DNA RESEARCH》 * |
| 李园园 等: "作物响应干旱胁迫应答的分子机制", 《化学与生物工程》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107630103A (en) * | 2017-10-13 | 2018-01-26 | 华南农业大学 | A kind of CAPS molecule labelling methods for identifying rice varieties and application |
| CN107630103B (en) * | 2017-10-13 | 2021-03-12 | 华南农业大学 | CAPS molecular marker method for identifying rice varieties and application |
| CN108048597A (en) * | 2018-01-22 | 2018-05-18 | 中国农业科学院作物科学研究所 | SNP marker relevant with Rice Drought Resistence and its application |
| CN117051036A (en) * | 2023-08-29 | 2023-11-14 | 云南大学 | Application of OsDTRF1 gene in regulation and control of drought resistance and yield of plants |
| CN118006822A (en) * | 2024-01-24 | 2024-05-10 | 上海市农业生物基因中心 | Probe combination, detection system and application of water-saving drought-resistant rice breeding chip (WDR 6K) |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gramazio et al. | Development and genetic characterization of advanced backcross materials and an introgression line population of Solanum incanum in a S. melongena background | |
| Dixit et al. | Multiple major QTL lead to stable yield performance of rice cultivars across varying drought intensities | |
| Septiningsih et al. | Applying genomics tools for breeding submergence tolerance in rice | |
| Uga | Challenges to design-oriented breeding of root system architecture adapted to climate change | |
| Ye et al. | A QTL controlling low temperature induced spikelet sterility at booting stage in rice | |
| Onodera et al. | Mapping of the genes for dioecism and monoecism in Spinacia oleracea L.: evidence that both genes are closely linked | |
| CN105349684B (en) | With the molecular labeling of the anti-rough dwarf disease main effect QTL compact linkage of corn | |
| CN105695478A (en) | Gene for regulating plant types and yield of plants and application of gene | |
| CN106701958A (en) | Molecular marker of rice drought-resistant gene and application of molecular marker | |
| CN109897909A (en) | One kind molecular labeling relevant to corn kernel size and its application | |
| Azarin et al. | Molecular breeding of submergence-tolerant rice | |
| Peiro et al. | Evaluation of the genetic diversity and root architecture under osmotic stress of common grapevine rootstocks and clones | |
| CN110257546A (en) | One rice seedling salt tolerant new gene cluster qST12PokkaliAnd application | |
| CN104711254B (en) | The low-phosphorous responsive genes ZmARF31 of corn INDEL molecular labelings and its application | |
| Hu et al. | QTL analysis of nitrogen content of plant shoot under two nitrogen conditions in rice ('Oryza sativa'L.) | |
| CN106701895A (en) | Haplotype relating to drought resistance of zea mays l. and molecular marker thereof | |
| JPWO2012127558A1 (en) | New varieties, methods for distinguishing plant varieties, and methods for rapid development of rice individuals | |
| Lang et al. | Breeding rice (Oryza sativa. L) for salt tolerance and grain quality traits. | |
| CN106480061B (en) | Recombinant nucleic acid fragment RecCR023411 and detection method thereof | |
| Ujiie et al. | Identification of chromosome regions affecting leaf area with rice chromosome segment substitution lines | |
| CN106609276B (en) | Recombinant nucleic acid fragment RecCR020260 and detection method thereof | |
| CN106480047B (en) | Recombinant nucleic acid fragment RecCR020325 and detection method thereof | |
| CN106609273B (en) | Recombinant nucleic acid fragment RecCR020127 and detection method thereof | |
| CN106480054B (en) | Recombinant nucleic acid fragment RecCR020322 and detection method thereof | |
| CN116694811B (en) | Molecular marker closely linked with wheat seedling stage seed root number QTL and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170524 |