CN105255914A - Lycium barbarum mitogen activated protein kinase kinase and application in improving saline-alkaline tolerance of plant - Google Patents

Abstract

The invention relates to lycium barbarum mitogen activated protein kinase kinase and application in improving saline-alkaline tolerance of a plant. By extracting total RNA in fresh lycium barbarum leaves, a mitogen activated protein kinase kinase gene LmMAPKK in lycium barbarum is cloned by using a 3'RACE method, thereby obtaining a complete gene sequence of 1074bp; an escherichia coli expression vector pET28a-LmMAPKK is established, and LmMAPKK expression protein of 39KD is obtained through an escherichia coli heterologous expression system; a binary plant expression vector pCAMBIA2300-LmMAPKK is established, the vector is transferred into agrobacterium C58 cells by using an electroporation method, transgenic tobacco can be obtained when tobacco is transferred by using the cells, tests show that the resistance of transgenic tobacco to salt and alkali, low temperature and pathogenic bacterium infection is greatly improved, and the saline-alkaline tolerance of transgenic plants of crops such as corn, soybean, rice, peanut, sunflower, millet, wheat, triticum aestivum and cotton, flowers such as rose, eustoma grandiflorum, anthurium andraeanum and phalaenopsis and tress such as poplar and robinia pseudoacacia is greatly improved.

Description

Matrimony vine Mitogen activated protein kinase kinases and the application of enhancing plant salt tolerance alkali

Technical field

The present invention relates to a kind of matrimony vine ( lyCiumChinenseMiller) in Mitogen activated protein kinase kinases and strengthening the application in plant salt tolerance alkali ability, be specially the clone of Mitogen activated protein kinase kinase gene (LmMAPKK) in matrimony vine, restructuring and application.

Background technology

Plant constantly suffers various biology and abioticly to coerce in growth and development process.As infecting of arid, saline and alkaline, cold, high temperature and pathogenic bacteria, different from mobile animal, plant has developed a set of signal transduction system improved and be applicable to himself needs with the change that conforms in long-term evolution process, survives better.After plant is upset, physics or chemical signal can be produced, these signals convert intracellular signal to after arriving target cell, and various signal transduction system in active cell, then Cascaded amplification is carried out to original signal, the expression of some genes is regulated and controled by adverse circumstance, finally cause physiological acoustic signals, enhancing body is to the stress resistance of adverse circumstance, wherein mitogen-activated protein kinase (mitogen-activatedproteinkinases, MAPK) cascade pathway is that signal is delivered to the important channel of nucleus inside from cell surface.

MAPK cascade pathway comprises three kinds of protein kinases: i.e. MAPKKK, MAPKK and MAPK.They are formed signal in the mode of phosphorylation step by step and are amplified approach, specificly experience upstream and stimulate, and signal is amplified going down to target protein.In plant, growing and the various response (Popescuetal., 2009) such as pathogen infects, mechanical wounding, touch, low temperature, high salt, osmotic stress and active oxygen are coerced of MAPK cascade pathway involved in plant.

The resistance of plant to adverse circumstances such as arid and high salt is by one of controlled by multiple genes complicated process, and mostly the expression of these adversity genes is by adverse circumstance environment conditioning, when plant experiences extraneous biology, abiotic stress signal, the anti contravariance related gene of the adverse circumstance regulation and control of body just can be expressed, so the stimulus signal in the external world is delivered in cell effectively, it is the committed step improving stress resistance of plant.Extracellular signal can be delivered in cell by MAPK cascade pathway effectively, regulates and controls the expression of adversity gene, as phosphorylation level, transcriptional level, transcribe rear alternative splicing etc. at many levels.Therefore utilize MAPK cascade pathway to strengthen stress resistance of plant and become the important channel of improveing stress resistance of plant.At adversity gene engineering field, MAPK cascade pathway receives much concern always, and the genes involved in MAPK cascade pathway is imported in Plant Genome by transgenic approach by investigators, obtains the transformed variety that many resistances strengthen.

MAPKK(mitogen-activatedproteinkinasekinase) gene is a gene in the middle of MAPK cascade pathway, people have found a large amount of MAPK family member from the various plants such as Arabidopis thaliana, paddy rice, white poplar, research finds, in MAPKKKs, MAPKKs and MAPKs tri-kinds of protein kinases, the minimum number of MAPKKs, close to 1/2nd of MAPKs, and the centre of MAPK cascade pathway residing for MAPKK, play a part very important in cell signaling processes.The function that the characteristic sum guarding subdomain according to Ser/Thr in MAPK aminoacid sequence has disclosed, has worked out a set of systematic nomenclature.Plant MAPKKs is divided into A, B, C, D tetra-groups of (Hameletal., 2006), wherein MKK1, MKK2 and MKK6 of Arabidopis thaliana belong to category-A, and MKK1/MKK2-MPK4/MPK6 level is associated in high salt, coldly coerces and play a big part in the emergent epidemic prevention of pathogenic bacteria.Found by CLUSTALX comparison, LmMAPKK belongs to category-A, by agriculture bacillus mediated transgenic method, verifies its function in transgene tobacco.Find that this gene can improve the ability of the anti-salt of plant, anti-low temperature and pathogen infection effectively.

Summary of the invention

The object of the present invention is to provide a kind of matrimony vine Mitogen activated protein kinase kinase gene (LmMAPKK).

Second object of the present invention is to provide the protein of this genes encoding.

The present invention also aims to provide the recombinant vectors containing this gene and host cell.

Another object of the present invention is the purposes providing this gene.

A kind of matrimony vine Mitogen activated protein kinase kinase gene (LmMAPKK) provided by the invention, the nucleotide sequence as shown in SEQ ID No .1 is formed.

The protein that a kind of matrimony vine Mitogen activated protein kinase kinase gene (LmMAPKK) provided by the invention is encoded, the protein of the aminoacid sequence as shown in SEQ ID No .2.

The recombinant cloning vector pMD18-T-LmMAPKK of a kind of matrimony vine Mitogen activated protein kinase kinase gene (LmMAPKK) provided by the invention.

Recombinant vectors containing above-mentioned matrimony vine Mitogen activated protein kinase kinase gene (LmMAPKK), these recombinant vectorss comprise plasmid.

Described plasmid expression vector coli expression carrier pET28a-LmMAPKK.

Described plasmid expression vector binary plant expression vector pCAMBIA2300-LmMAPKK.

The host cell of the complete coding reading frame sequence containing above-mentioned matrimony vine Mitogen activated protein kinase kinase gene (LmMAPKK), as the host cell containing above-mentioned recombinant vectors also belongs to protection scope of the present invention.

Described host cell is selected from Bacillus coli cells, agrobatcerium cell or tobacco cell.

The invention provides a kind of engineering bacteria containing LmMAPKK gene.

The application of above-mentioned matrimony vine Mitogen activated protein kinase kinase gene (LmMAPKK) comprises the application of albumen in plant of this genes encoding; With described recombinant vectors, as plant expression vector maize transformation cell; Or by the described Agrobacterium and corn, soybean, paddy rice, peanut, Sunflower Receptacle, potato, cotton, millet, barley and the co-culture of cells such as flowers and vegetables that contain this gene, obtain genetically modified regeneration plant; Or obtain above-mentioned species transfer-gen plant with described LmMAPKK genetic transformation.

Technical scheme of the present invention is specifically summarized as follows:

Cloning process of the present invention is made up of following step:

Total serum IgE is extracted from the fresh blade of matrimony vine, according to the nucleotide sequence design upstream primer LmMAPKKF:5 ' ATGAAGAAAGGATCTTTTGCTCCTAATC-3 ' of matrimony vine Mitogen activated protein kinase kinase gene in transcript profile Unigene sequence, then utilizing 3 ' RACE method amplification to obtain complete gene order is 1074bp.

The present invention builds the coli expression carrier pET28a-LmMAPKK and plant expression vector pCAMBIA2300-LmMAPKK that contain Mitogen activated protein kinase kinase gene LmMAPKK, is made up of following step:

1) the intermediate carrier pMD18-T-LmMAPKK containing Mitogen activated protein kinase kinase gene is built.

Design is by the upstream primer P1(P1:atgaagaaaggatcttttgctcctaatc shown in SEQIDNO.3), design is by the downstream primer P2(P2:taccgtcgttccactagtgattt shown in SEQIDNO.4), with matrimony vine cDNA for template, carry out pcr amplification, pcr amplification product is connected to pMD18-T carrier, obtains the intermediate carrier pMD18-T-LmMAPKK containing the LmMAPKK gene shown in SEQ ID NO.1.

2) coli expression carrier pET28a-LmMAPKK is built

Design is by the upstream primer P3(P3:cgcggatccatgaagaaaggatcttttgctcctaatc shown in SEQIDNO.5), design is by the downstream primer P4(P4:acgcgtcgacaattatagctcattgagtgttgcca shown in SEQIDNO.6), take pMD18-T-LmMAPKK as template, carry out pcr amplification, by pcr amplification product BamHI and SalI double digestion, by pET28a empty carrier BamHI and SalI double digestion, connect after purifying respectively, obtain coli expression carrier pET28a-LmMAPKK.

3) plant expression vector pCAMBIA2300-LmMAPKK is built

Design is by the upstream primer P3 shown in SEQIDNO.5, design is by the downstream primer P4 shown in SEQIDNO.6, take pMD18-T-LmMAPKK as template, carry out pcr amplification, by pcr amplification product BamHI and SalI double digestion, by pCAMBIA2300-35S-OCS empty carrier BamHI and SalI double digestion, connect after purifying respectively, obtain plant expression vector pCAMBIA2300-LmMAPKK.

The invention provides a kind of matrimony vine Mitogen activated protein kinase kinase gene and comprise the recombinant vectors of this gene and host cell and application, the global cDNA of coding Mitogen activated protein kinase kinase gene is isolated first from matrimony vine, be connected on coli expression carrier, utilize the expressing protein of heterogenous expression system verification matrimony vine LmMAPKK gene; Then be connected on plant expression vector, utilize Agrobacterium infestation method transformation of tobacco, obtain transfer-gen plant, resistance analysis has been carried out to transfer-gen plant, result shows the saline and alkaline of transgene tobacco, the resistance capacity of low temperature and pathogen infection is greatly improved, and namely the present invention has widespread use in enhancing plant salt tolerance alkali ability etc.

Accompanying drawing explanation

Fig. 1. with the PCR electrophorogram of P1, P2 primer pair matrimony vine cDNA.

Fig. 2 .LmMAPKK connects the PCR the result of pMD18-T carrier.

Fig. 3 .pMD18-T-LmMAPKK carrier schematic diagram.

Fig. 4 .LmMAPKK connects the PCR the result of pET-28a carrier.

Fig. 5 .pET28a-LmMAPKK is protein expression electrophorogram in e. coli bl21

Fig. 6 .pCAMBIA2300-LmMAPKK digestion verification electrophorogram.

Fig. 7 .pCAMBIA2300-LmMAPKK carrier schematic diagram.

Fig. 8. transgene tobacco Genomic PCR.

Fig. 9. transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cotton gene group PCR.

Figure 10. transgenosis Chinese rose, Lisianthus, An Zuhua, butterfly orchid Genomic PCR.

Figure 11. transgenic poplar, fragrant flower Chinese scholar tree Genomic PCR.

Embodiment

Embodiment 1

The clone of Mitogen activated protein kinase kinases LmMAPKK gene in matrimony vine

Utilize Trizol reagent, totalRNA is extracted from the fresh matrimony vine blade of 100mg, according to the Unigene sequences Design upstream primer of transcript profile, in matrimony vine, the upstream primer of Mitogen activated protein kinase kinases LmMAPKK gene is: LmMAPKK:5-' ATGAAGAAAGGATCTTTTGCTCCTAATC-3 ', 3 ' FULLRACECoreSetVer.2.0 (TaKaRa, Japan) test kit amplification is utilized to obtain complete gene order.Concrete steps: be 1. template with totalRNA, utilize 3 ' RACEAdaptor primer to carry out reverse transcription reaction, synthesis 1stStrandcDNA, reaction system is as follows:

Reaction conditions: 42 DEG C, 60min; 70 DEG C, 15min.

According to downstream primer 3 ' the RACEoutprimer:5 '-TACCGTCGTTCCACTAGTGATTT-3 ' that upstream primer and the test kit of gene provide, be template with 1stStrandcDNA, carry out PCR reaction, reaction system is as follows:

Configuration 4 tube reaction liquid altogether, reaction conditions is as follows: 94 DEG C, 4min; 94 DEG C, 30Sec; 56 DEG C, 30Sec; 72 DEG C, lmin20Sec; 72 DEG C, 10min; 30 circulations.Utilize the common DNA Product Purification Kit of Tian Gen company to carry out purifying to PCR reaction product after reaction, obtain the LmMAPKKPCR fragment of purifying, operate according to test kit specification sheets.

Embodiment 2

The building process of cloning vector pMD18-T-LmMAPKK

Be connected with pMD18-T carrier by LmMAPKK gene shown in sequence table, reaction system is as follows:

LmMAPKKPCR fragment is that the purifying in embodiment 1 reclaims product.

Reaction conditions: 16 DEG C, 30min.Connect product conversion E-Coli.DH5 α, the LB Agar Plating being coated on IPTG, the 100mg/LAmp of X-Gal, the 16ml50mg/ml containing 40ml25mg/ml is cultivated, forms single bacterium colony.Select white colony, bacterium colony PCR method confirms the length scale of Insert Fragment in carrier T, as Fig. 2, consistent with expection, this carrier is sent to the order-checking of Hua Da genome company, we obtain this gene base sequence of 1074bp, carry out blast at NCBI, high with Solanaceae homology, be indicated as this gene clone success.

Embodiment 3

The building process of coli expression carrier pET28a-LmMAPKK

First with pMD18-T-LmMAPKK plasmid for template, P3, P4 for being respectively upstream and downstream primer, amplification LmMAPKK gene, its reaction conditions is: 94 DEG C, 4min; 94 DEG C, 30Sec; 56 DEG C, 30Sec; 72 DEG C, lmin20Sec; 72 DEG C, 10min, 30 circulations, in P3, introduce BamHI restriction enzyme site (GGATCC), introduce SalI restriction enzyme site (GTCGAC) in P4, then PCR primer and pET28a empty carrier plasmid use BamHI and SalI double digestion respectively, connected by the digestion products of the two, linked system is as follows:

LmMAPKKPCR fragment is that the purifying in embodiment 1 reclaims product.

Reaction conditions: 16 DEG C, 30min.Connect product conversion E-Coli.DH5 α, the LB Agar Plating being coated on IPTG, the 100mg/LAmp of X-Gal, the 16ml50mg/ml containing 40ml25mg/ml is cultivated, forms single bacterium colony.Select white colony, bacterium colony PCR method confirms the length scale of Insert Fragment in carrier T, as Fig. 2, consistent with expection, this carrier is sent to the order-checking of Hua Da genome company, we obtain this gene base sequence of 1074bp, carry out blast at NCBI, high with Solanaceae homology, be indicated as this gene clone success.

Embodiment 3

The building process of coli expression carrier pET28a-LmMAPKK

First with pMD18-T-LmMAPKK plasmid for template, P3, P4 for being respectively upstream and downstream primer, amplification LmMAPKK gene, its reaction conditions is: 94 DEG C, 4min; 94 DEG C, 30Sec; 56 DEG C, 30Sec; 72 DEG C, lmin20Sec; 72 DEG C, 10min, 30 circulations, in P3, introduce BamHI restriction enzyme site (GGATCC), introduce SalI restriction enzyme site (GTCGAC) in P4, then PCR primer and pET28a empty carrier plasmid use BamHI and SalI double digestion respectively, connected by the digestion products of the two, linked system is as follows:

LmMAPKKPCR fragment is that the purifying in embodiment 1 reclaims product.

Reaction conditions: 16 DEG C, 30min.Connect product conversion E-Coli.DH5 α, the LB Agar Plating being coated on IPTG, the 100mg/LAmp of X-Gal, the 16ml50mg/ml containing 40ml25mg/ml is cultivated, forms single bacterium colony.Select white colony, bacterium colony PCR method confirms the length scale of Insert Fragment in carrier T, as Fig. 2, consistent with expection, this carrier is sent to the order-checking of Hua Da genome company, we obtain this gene base sequence of 1074bp, carry out blast at NCBI, high with Solanaceae homology, be indicated as this gene clone success.

Embodiment 3

The building process of coli expression carrier pET28a-LmMAPKK

First with pMD18-T-LmMAPKK plasmid for template, P3, P4 for being respectively upstream and downstream primer, amplification LmMAPKK gene, its reaction conditions is: 94 DEG C, 4min; 94 DEG C, 30Sec; 56 DEG C, 30Sec; 72 DEG C, lmin20Sec; 72 DEG C, 10min, 30 circulations, in P3, introduce BamHI restriction enzyme site (GGATCC), introduce SalI restriction enzyme site (GTCGAC) in P4, then PCR primer and pET28a empty carrier plasmid use BamHI and SalI double digestion respectively, connected by the digestion products of the two, linked system is as follows:

connect product conversion E-Coli.DH5 α, coat on the LB flat board containing 100mg/Lkana resistance, 37 DEG C of cultivations.After 12h, picking list bacterium colony carries out bacterium colony PCR checking, as Fig. 4, bacterium colony PCR is verified positive bacterium, and shake bacterium and extract plasmid, enzyme is cut qualification and obtained object band, finally send Hua Da gene sequencing company to check order, and it is correct that result shows that carrier pET28a-LmMAPKK builds.

By the plant expression vector pET28a-LmMAPKK transformation of E. coli BL21 built.Carry out protein expression checking, obtain the LmMAPKK expressing protein of expection size (39KD), as Fig. 5: 1. albumen Marker; (2.pET28a-LmMAPKK IPTG induction); (3.pET28a-LmMAPKK induction); 4.pET28a empty carrier (IPTG induction) 5.pET28a empty carrier (induction).

Embodiment 4

The structure of binary plant expression vector pCAMBIA2300-LmMAPKK

First with pMD18-T-LmMAPKK plasmid for template, P3, P4 for being respectively upstream and downstream primer, amplification LmMAPKK gene, its reaction conditions is: 94 DEG C, 4min; 94 DEG C, 30Sec; 56 DEG C, 30Sec; 72 DEG C, lmin20Sec; 72 DEG C, 10min, 30 circulations, BamHI restriction enzyme site (GGATCC) is introduced in P3, SalI restriction enzyme site (GTCGAC) is introduced in P4, then PCR primer and pCAMBIA2300 empty carrier plasmid use BamHI and SalI double digestion respectively, and connected by the digestion products of the two, linked system is as follows:

Connect product conversion E-Coli.DH5 α, coat on the LB flat board containing 100mg/L concentration kana resistance.37 DEG C of cultivations, after 12h, picking list bacterium colony carries out bacterium colony PCR checking, and bacterium colony PCR is verified positive bacterium, shake bacterium and extract plasmid, enzyme is cut qualification and is obtained object band, as Fig. 6, finally send Hua Da gene sequencing company to check order, it is correct that result shows that carrier pCAMBIA2300-LmMAPKK builds.

Embodiment 5

For the structure of the Agrobacterium engineering strain C58:pCAMBIA2300-LmMAPKK of plant transgene.

Prepared by Agrobacterium competent cell

1. by mono-for Agrobacterium C58 colony inoculation in 5mLYEP liquid nutrient medium, 28 DEG C, 180r/min shaking culture.

2. proceed in l00mLYEP liquid nutrient medium by above-mentioned bacterium liquid, 28 DEG C, 180r/min, shaking culture is to (OD ₆₀₀value is about 0.5).

3., after ice bath 30min, 4 DEG C, the centrifugal l0min of 4000r/min, collects thalline, is resuspended in the H of 20mL precooling ₂in O.

4.4 DEG C, the centrifugal 10min of 4000r/min, collect thalline, be resuspended in 10% glycerine of precooling, often pipe 200 μ L quick-frozen, be stored in-80 DEG C for subsequent use.

Plant expression vector electroporated

1. the C58 competent cell that-80 DEG C are taken out is placed on ice, makes it slowly melt;

2. add 4 μ L plasmids, mixing, ice bath 5min;

3. be transferred in electric shock cup;

4. electroporated instrument parameter is set: 1500V, 0.2s, electroporated;

5. room temperature adds 500 μ LYEB liquid nutrient mediums after leaving standstill 2min, 28 DEG C, 180r/min shaking culture 3h;

6. the centrifugal 10min of room temperature 4000r/min, sucking-off 400 μ L supernatant liquor, by the mixing of remaining bacterium liquid, coat on the YEB flat board containing 100mg/L kantlex and 100mg/L rifampicin resistance, be inverted dull and stereotyped, 28 DEG C of cultivations, 48h, until see single bacterium colony clearly.

7. picking list bacterium colony, bacterium colony PCR verifies.

Embodiment 6

Agriculture bacillus mediated tobacco genetic transformation

The sterile culture of tobacco seedling: select full, healthy tobacco seed, with 75% alcohol immersion lmin, peace tiformin (available chlorine 2.5%) aqueous solution sterilizing 8min of 25%, rinsed with sterile water three times, be placed on by seed in MS substratum, 25 DEG C of light are cultivated, the 16h/8h photoperiod.

The substratum that this experiment is used is as shown in the table

the Agrobacterium-mediated Transformation of tobacco

Infect the preparation of bacterium liquid

1. the single bacterium colony of the positive Agrobacterium of picking, is inoculated into 5ml containing in the YEP liquid nutrient medium of 100mg/L kantlex, in 28 DEG C, the shaker overnight of 200r/min cultivates.

2. next day, get 3ml bacterium liquid, be inoculated in the 50mlYEP liquid nutrient medium containing 100mg/L kantlex, when bacterium liquid is in vigorous period (OD ₆₀₀=0.6-0.9) time, pour bacterium liquid into 50ml centrifuge tube, at 3500r/min, at 4 DEG C, centrifugal 10min, abandons supernatant liquor, collects thalline.Resuspended with the MS liquid nutrient medium of equivalent, make OD ₆₀₀=0.9-1.

Explant is contaminated

1. tobacco leaf is removed master pulse and limb edge, then blade is cut into 0.5cm × 0.5cm size, immerse the Agrobacterium bacterium liquid prepared, soak 15-20min, shake 2-3 time therebetween, make blade fully contact bacterium liquid, take out blade, the bacterium liquid exhausting unnecessary with aseptic filter paper, blade face down, blade back is inoculated in common training substratum upward, about 25 DEG C light culture 2 days.

2. be transferred in screening culture medium by blade, within about 20 days, change a subculture, induction of resistance bud produces, and when resistant buds grows to about 1cm from callus, cuts resistant buds from callus, is inoculated in resistance seedling rooting substratum.

Transgenic seedling is transplanted

The tobacco tissue cultured seedling that root growth is good, vitality is vigorous takes out from tissue culture bottle, with tap water substratum (reducing root system damage) as far as possible, be planted in frog stone and compost humous, coating film heat and moisture preserving 15 days, then film is opened, regularly water, apply fertilizer, make it normal growth in greenhouse.

Embodiment 7

Transgene tobacco Molecular Detection and salt resistance detect

The PCR of transgene tobacco genomic dna detects: 1.CTAB method extracts tobacco STb gene; 2. be that template performing PCR detects with genomic dna, primer is P3, P4, reaction conditions:: 94 DEG C, 4min; 94 DEG C, 30Sec; 56 DEG C, 30Sec; 72 DEG C, lmin20Sec; 72 DEG C, 10min; 30 circulations.

Get above-mentioned PCR primer 5 μ l and carry out electrophoresis detection, Fig. 8, illustrate that LmMAPKK gene successfully proceeds to tobacco.

At greenhouse normal growth, 5-7cm transgene tobacco seedling and wild type control seedling, water the water of the NaCI containing 300mmol/L and 500mmol/L concentration respectively, keeps the humidity of 85% in greenhouse.Detect and find, under the growth conditions of 300mmol/LNaCI, WT lines growth phase is to slowly, biomass is relatively less, and transgene tobacco can normal growth, biomass is large, can blossom and bear fruit, under the condition of the NaCI of 500mmol/L concentration, after growing one week, wild-type tobacco yellow leaf, wilts, tissue necrosis, can not normal growth.Although the growth of transgene tobacco is also by suppression to a certain extent, obvious unlike wild-type tobacco, substantially can normal growth.

Embodiment 8

Vegetative point infestation method is passed through to crop maturity embryo transgenosiss (LmMAPKK) such as corn, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cottons in this laboratory, successfully obtain transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cotton plants, Genomic PCR electrophorogram, as Fig. 9, be followed successively by the Genomic PCR of corn, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cotton from left to right.

At greenhouse normal growth, 5-7 true leaf transgenic seedlings and wild type control seedling, water the water of the NaCI containing 300mmol/L and 500mmol/L concentration respectively, keeps the humidity of 85% in greenhouse.Detect and find, under the growth conditions of 300mmol/LNaCI, WT lines growth phase is to slowly, biomass is relatively less, and transgenic seedlings can normal growth, biomass is large, can blossom and bear fruit, under the condition of the NaCI of 500mmol/L concentration, after growing one week, wild type seedlings yellow leaf, wilts, tissue necrosis, can not normal growth.Although the growth of transgenic seedlings is also by suppression to a certain extent, obvious unlike wild type seedlings, substantially can normal growth.

Embodiment 9

This laboratory utilizes Agrobacterium infestation method to carry out transgenosis (LmMAPKK) to flowers such as Chinese rose, Lisianthus, An Zuhua, butterfly orchides, obtain transgenosis Chinese rose, Lisianthus, An Zuhua, Phalaenopsis plants, Genomic PCR electrophorogram, as Figure 10, is followed successively by the Genomic PCR of Chinese rose, Lisianthus, An Zuhua, butterfly orchid from left to right.

At greenhouse normal growth, 5-7cm transgenic seedlings and wild type control seedling, water the water of the NaCI containing 300mmol/L and 500mmol/L concentration respectively, keeps the humidity of 85% in greenhouse.Detect and find, under the growth conditions of 300mmol/LNaCI, WT lines growth phase, to slowly, can not normally be bloomed, and transgenic seedlings can normal growth, can bloom, under the condition of the NaCI of 500mmol/L concentration, after growing one week, wild type seedlings yellow leaf, wilt, tissue necrosis, can not normal growth.Although the growth of transgenic seedlings is also by suppression to a certain extent, obvious unlike wild type seedlings, substantially can bloom by normal growth.

Embodiment 10

This laboratory utilizes Agrobacterium infestation method to carry out transgenosis (LmMAPKK) to the arbor such as willow, fragrant flower Chinese scholar tree trees, obtain transgenic poplar, fragrant flower Chinese scholar tree plant, Genomic PCR electrophorogram, as Figure 11, is followed successively by the Genomic PCR of willow, fragrant flower Chinese scholar tree from left to right.

At transgenosis sapling and the wild type control seedling of greenhouse normal growth, water the water of the NaCI containing 300mmol/L and 500mmol/L concentration respectively, in greenhouse, keep the humidity of 85%.Detect and find, under the growth conditions of 300mmol/LNaCI, WT lines growth phase is to slowly.And transgenosis sapling can normal growth.Under the condition of the NaCI of 500mmol/L concentration, after growing one week, wild-type seedling leaf turns to be yellow, and wilt, tissue necrosis, can not normal growth.Although turn the growth of base sapling also by suppression to a certain extent, obvious unlike wild type seedlings, substantially can normal growth.

Sequence table

<110> University Of Tianjin

<120> matrimony vine Mitogen activated protein kinase kinases and the application of enhancing plant salt tolerance alkali

<130>2013420

<160>6

<170>PatentInversion3.3

<210>1

<211>1074

<212>DNA

<213> artificial sequence

<220>

<221>gene

<222>(1)..(1074)

<400>1

atgaagaaaggatcttttgctcctaatcttaaactttctcttccacctcctgatgaagtt60

aatctctccaaattcctgactgaatcagggacatttaaggatggagatcttttggtgaat120

agagatggagttcgaattgtctcgcagagtgaagttgcagctcctacagttatacagcca180

tcagacaaccagttatgcttagctgattttgaagcagttaaagttattggaaagggaaat240

ggtggtattgtgcggctggttcagcataaatggactgggcaatttttcgctctcaaggtt300

attcagatgaatattgaagagtccatgcgcaagcatatagctcaagaactgagaattaat360

cagtcatcccagtgtccatatgttgtcgtatgctatcagtcattctttgataatggtgct420

atctcaatcattttggagtatatggacggtggttccctagcagattttctgaaaaaagtg480

aatacaatacccgaacggtatcttgctgccatctgcaaacaggttctcaaaggcttgtgg540

tatcttcatcatgagaagcatattattcacagggatttgaaaccttcgaatttgctaatc600

aatcacagaggtgatgtcaaaatcaccgactttggtgtgagtgcagtactggcaagcaca660

tctggactggctaataccttcgtcggcacatacaactatatgtctccagagagaatttca720

ggaggtgcctatggttacaaaagtgacatttggagcttgggtttagttttgctcgagtgt780

gcaacaggtcatttcccatataccccacccgagggagatgaaggatgggttaatgtttat840

gaacttatggaaactatagttgaccaaccagcaccttgtgcacctcctgaccaattttct900

cctcacttctgctcattcatatctgcatgtgtccagaaggaccaggaggacagattgtca960

gcaaatgaactcatgagtcaccctttcatcaccatgtacgatgacctggatgttgatctt1020

ggatcgtacttcacatccgcaggacctccattggcaacactcaatgagctataa1074

<210>2

<211>357

<212>PRT

<213> is manually serial

<220>

<221>MUTAGEN

<222>(1)..(357)

<400>2

MetLysLysGlySerPheAlaProAsnLeuLysLeuSerLeuProPro

151015

ProAspGluValAsnLeuSerLysPheLeuThrGluSerGlyThrPhe

202530

LysAspGlyAspLeuLeuValAsnArgAspGlyValArgIleValSer

354045

GlnSerGluValAlaAlaProThrValIleGlnProSerAspAsnGln

505560

LeuCysLeuAlaAspPheGluAlaValLysValIleGlyLysGlyAsn

65707580

GlyGlyIleValArgLeuValGlnHisLysTrpThrGlyGlnPhePhe

859095

AlaLeuLysValIleGlnMetAsnIleGluGluSerMetArgLysHis

100105110

IleAlaGlnGluLeuArgIleAsnGlnSerSerGlnCysProTyrVal

115120125

ValValCysTyrGlnSerPhePheAspAsnGlyAlaIleSerIleIle

130135140

LeuGluTyrMetAspGlyGlySerLeuAlaAspPheLeuLysLysVal

145150155160

AsnThrIleProGluArgTyrLeuAlaAlaIleCysLysGlnValLeu

165170175

LysGlyLeuTrpTyrLeuHisHisGluLysHisIleIleHisArgAsp

180185190

LeuLysProSerAsnLeuLeuIleAsnHisArgGlyAspValLysIle

195200205

ThrAspPheGlyValSerAlaValLeuAlaSerThrSerGlyLeuAla

210215220

AsnThrPheValGlyThrTyrAsnTyrMetSerProGluArgIleSer

225230235240

GlyGlyAlaTyrGlyTyrLysSerAspIleTrpSerLeuGlyLeuVal

245250255

LeuLeuGluCysAlaThrGlyHisPheProTyrThrProProGluGly

260265270

AspGluGlyTrpValAsnValTyrGluLeuMetGluThrIleValAsp

275280285

GlnProAlaProCysAlaProProAspGlnPheSerProHisPheCys

290295300

SerPheIleSerAlaCysValGlnLysAspGlnGluAspArgLeuSer

305310315320

AlaAsnGluLeuMetSerHisProPheIleThrMetTyrAspAspLeu

325330335

AspValAspLeuGlySerTyrPheThrSerAlaGlyProProLeuAla

340345350

ThrLeuAsnGluLeu

355

<210>3

<211>28

<212>DNA

<213> artificial sequence

<220>

<221>gene

<222>(1)..(28)

<400>3

atgaagaaaggatcttttgctcctaatc28

<210>4

<211>23

<212>DNA

<213> artificial sequence

<220>

<221>gene

<222>(1)..(23)

<400>4

taccgtcgttccactagtgattt23

<210>5

<211>37

<212>DNA

<213> artificial sequence

<220>

<221>gene

<222>(1)..(37)

<400>5

cgcggatccatgaagaaaggatcttttgctcctaatc37

<210>6

<211>35

<212>DNA

<213> artificial sequence

<220>

<221>gene

<222>(1)..(35)

<400>6

acgcgtcgacaattatagctcattgagtgttgcca35。

Claims (8)

1. a matrimony vine Mitogen activated protein kinase kinase gene, is characterized in that this gene is for the nucleotide sequence shown in SEQIDNO.1.

2. the protein of matrimony vine Mitogen activated protein kinase kinase gene coding according to claim 1, is characterized in that described protein is for the aminoacid sequence shown in SEQIDNO.2.

3. a recombinant vectors, is characterized in that the complete sequence containing matrimony vine Mitogen activated protein kinase kinase gene according to claim 1 or Partial Fragment.

4. a recombinant vectors according to claim 3, is characterized in that it is plasmid expression vector coli expression carrier pET28a-LmMAPKK.

5. a recombinant vectors according to claim 3, is characterized in that it is recombinant plant expression vector pCAMBIA2300-LmMAPKK.

6. a host cell, is characterized in that containing Mitogen activated protein kinase kinase gene complete sequence according to claim 1 or Partial Fragment.

7. a host cell according to claim 6, is characterized in that it is agrobatcerium cell, tobacco cell, maize cell or soya cells.

8. an application for gene described in claim 1, is characterized in that it is for the preparation of farm crop such as transgenic corns, soybean, paddy rice, peanut, Sunflower Receptacle, millet, barley, wheat, cottons; The flowers such as Chinese rose, Lisianthus, An Zuhua, butterfly orchid; Willow, fragrant flower Chinese scholar tree.