CN104694550B

CN104694550B - Tamarix hispida ThDof genes, its encoding proteins and its promoter sequence and application

Info

Publication number: CN104694550B
Application number: CN201510092850.3A
Authority: CN
Inventors: 高彩球; 王玉成; 王超; 王培龙; 赵玉琳; 张凯敏; 张凤娇
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2014-12-19
Filing date: 2015-03-02
Publication date: 2018-03-27
Anticipated expiration: 2035-03-02
Also published as: CN104694550A

Abstract

Tamarix hispida ThDof genes, its encoding proteins and its promoter sequence and application, it is related to a kind of Dof genes, its encoding proteins and its promoter sequence and application.It is an object of the invention to provide a kind of Tamarix hispida ThDof genes, its encoding proteins and its promoter sequence and application.SEQ ID NO in ThDof gene orders such as sequence table：Shown in 1.The amino acid sequence of encoding proteins such as SEQ ID NO：Shown in 2.Promoter sequence such as SEQ ID NO：Shown in 3.ThDof genes, by arid and the obvious induced expression of salt stress, show that it participates in the reaction of the drought resistance and salt tolerance stress response of Chinese tamarisk in Chinese tamarisk.ThDof genes have obvious drought resistance and salt tolerance ability.For cultivating drought resistance and salt tolerance genetically modified plants.

Description

Tamarix hispida ThDof genes, its encoding proteins and its promoter sequence and application

Technical field

The present invention relates to a kind of Dof genes, its encoding proteins and its promoter sequence and application

Background technology

Transcription factor is also known as trans-acting factor, is to refer to and the cis-acting elements in eukaryotic gene promoter region The protein specifically bound, by the interaction between them, activation or the transcription of suppressor.In plant adverse circumstance In signal transduction, transcription factor is a very crucial factor.When plant is coerced by the external world, stress signal stimulates transcription The factor constantly synthesizes, and transcription factor combines with corresponding cis-acting elements, regulates and controls the transcriptional expression of downstream specific gene, will believe Number transmit and amplification, cause the change of plant physiology and biochemistry, so as to improve the resistance of plant.Therefore, a transcription factor can To regulate and control the expression of multiple genes relevant with similar character, crop is being improved in the molecular breeding of tolerance to environmental stress, with Import or improvement discrete function gene is compared to improve the method for certain resistance, it is to improve to make to import or improve a transcription factor Thing resistance more efficient way and approach.Manipulating a transcription factor can promote multiple functional genes to play work by it With so as to reach the effect for making tree characteristics obtain comprehensive improvement.

Dof (DNA binding with one finger) transcription factor is newfound plant distinctive one in recent years Class transcription regulatory factor.Since identification reports first ZmDof1 (MNB1a) transcription factor from corn within 1993, exist Dof genes are found that in a variety of monocotyledons and dicotyledon.37 Dof genes wherein in arabidopsis gene group be present (Yanagisawa, 2002), exist in rice genome 30 (Lijavetzky et al, 2003), there are 26 in barley (Moreno-Risueno et al, 2007b), have in soybean 28 (Wang et al, 2007), pumpkin (Kisu et al, 1998), tobacco (Baumann et al, 1999), wheat (Chen et al, 2005) and potato (Plesch et al, Etc. 2001) Dof genes also all be present in plant.Dof albumen is typically made up of 200~400 amino acid, has special and height Conservative DNA binding domain, i.e., positioned at the Dof domains that N-terminal is made up of 52 amino acid.Dof albumen with its Dof domain from it is different Plant-specific gene promoter interaction, each Dof albumen DNA binding sequence row in there are AAAG sequences Row.AAAG sequences and its reverse complementary sequence CTTT are the core sequences of Dof albumen identification.In addition to Dof domains, Dof eggs Another the main domain included in vain is the control domain positioned at C-terminal.It is different from conservative Dof domains, transcription The amino acid sequence of control domain is more changeable, does not have conservative, it likely via with different type modulin or thing The reaction of matter, is activated by the regulation and control of different approaches signal or suppressor is transcribed.This species diversity is probably that Dof functions are more One of basis of sample.

Dof is influenceed and regulates and controls multi-signal material such as auxin, red mould as a kind of important transcription regulatory factor The expression of related gene, participates in various biological in plant growth and development process in element, salicylic acid, ABA etc. responsing reaction Process, such as light response and C N metabolism, seed development and sprouting, phytochrome response and defense reaction.Pass through nearly 20 years Research discloses the numerous characteristics of Dof albumen, and people have had certain understanding to Dof albumen, understood part Dof albumen Biological function.But Dof transcription factors salt resistance ability is studied at present less.Some study the expression for only showing Dof genes Induced by salt stress, the salt tolerant regulation and control of plant may be participated in.And the salt tolerant that xylophyta whether is participated in for Dof transcription factors should Answer researches.

Chinese tamarisk (Tamarix) is a kind of very excellent woody halophytes of anti-adversity ability, can be in soil of the salt content up to 1% Wildwood is formed in earth, therefore is the ideal material studied Mechanism of Salt-tolerant and carry out resistant gene of salt clone.

The content of the invention

The present invention provides a kind of Tamarix hispida ThDof genes, its encoding proteins and its promoter sequence and application.

The cDNA sequence total length 1149bp of Tamarix hispida ThDof genes of the present invention, such as SEQ ID NO in sequence table：1 institute Show.

The encoding proteins of Tamarix hispida ThDof genes of the present invention include 382 amino acid, its amino acid sequence such as SEQ ID NO：Shown in 2.

Application of the Tamarix hispida ThDof genes in drought resistance and salt tolerance genetically modified plants are cultivated.

The long 1874bp of promoter sequence of Tamarix hispida ThDof genes, such as SEQ ID NO in sequence table：Shown in 3.

The present invention studies the ThDof genes of the present invention after arid and salt stress by real-time fluorescence quantitative RT-PCR Expression, the results showed that ThDof genes in Chinese tamarisk by arid and salt stress obvious induced expression, show that it may participate in Gui The drought resistance and salt tolerance stress response reaction of willow.Plant expression vector prokII is arrived by ThDof is gene constructed, mould is transferred to by flower-dipping method In formula plant Arabidopsis thaliana, it is found that the average germination percentage after 100mM NaCl stress is that wild type is intended to transgenosis T3 for arabidopsis seed 1.48 times of southern mustard (control).Average root long after 100mM NaCl stress is 1.3 times of wild type control, and mean fresh is wild 2.32 times of raw type.The average germination percentage of transgenic arabidopsis is 2.15 times of wild type after 200mM mannitol stress, average root Length is 1.29 times of wild type control, fresh weight increase by 47%, shows that ThDof genes have obvious drought resistance and salt tolerance ability.

Brief description of the drawings

Fig. 1 is ThDof genes conserved region prognostic chart；

Fig. 2 is the lower ThDof Gene Expression Profile Analysis figures of 0.4M NaCl stress；

Fig. 3 is the lower ThDof Gene Expression Profile Analysis figures of 20%PEG stress；

Fig. 4 is that 100 μM of ABA handle ThDof Gene Expression Profile Analysis figures；

Fig. 5 is to turn ThDof genes and wildtype Arabidopsis thaliana germination percentage compares figure under condition of salt stress；

Fig. 6 is to turn ThDof genes and wildtype Arabidopsis thaliana germination percentage compares figure under drought stress conditions；

Fig. 7 turns ThDof genes under being coerced for NaCl and wildtype Arabidopsis thaliana root long compares figure；

Fig. 8 turns ThDof genes under being coerced for mannitol and wildtype Arabidopsis thaliana root long compares figure；

Fig. 9 is to turn ThDof genes and wildtype Arabidopsis thaliana fresh weight compares figure under NaCl stress；

Figure 10 turns ThDof genes under being coerced for various concentrations mannitol and wildtype Arabidopsis thaliana fresh weight compares figure.

Figure 11 ThDof gene promoters merge schematic diagram with gus gene

Chinese tamarisk ThDof gene promoters spatial and temporal expression is analyzed in Figure 12 different growth phases and different organ or tissues

Embodiment

Technical solution of the present invention is not limited to act embodiment set forth below, in addition between each embodiment Any combination.

Embodiment one：SEQ ID in the cDNA sequence of present embodiment Tamarix hispida ThDof genes such as sequence table NO：Shown in 1.

Embodiment two：The amino acid sequence such as SEQ of the encoding proteins of present embodiment Tamarix hispida ThDof genes ID NO：Shown in 2.

The clone of Tamarix hispida ThDof genes and sequence analysis：

1st, the clone of Tamarix hispida ThDof genes

Tamarix hispida seed is seeded in Artificial Soil (peat soil and sand in mass ratio 2:1 is made) in, being placed in relative humidity is 65%~75%, light intensity is 400 μm of olm^-2·s^-1, mean temperature is to be grown in 22 ± 2 DEG C of greenhouses.After 2 months to be grown, Use 0.3molL^-1NaHCO₃Solution pours root, carries out Stress treatment, respectively in processing 0h (before Stress treatment), 12h, 24h After 48h, its leaf and root is taken to be put into the quick-frozen extraction for RNA in liquid nitrogen.

CTAB methods extract the RNA of each toeatment period, and the RNA sample of extraction is delivered into Shenzhen Huada Genetic Technology Co., Ltd Carry out structure and the sequencing in transcript profile library.To result " the Dof transcription factor " after sequencing alignment and assembbly Searched as keyword, confirmation further is compared using BLASTX softwares to the sequence after lookup, with reference to ORF founder(http://www.ncbi.nlm.nih.gov/gorf.html) program determines whether there is complete open reading code Frame.Dof gene of the selection with complete ORF, further designs primer, using Chinese tamarisk cDNA as template, PCR sequence verifications.Through dividing Analyse, final acquisition ThDof genes, SEQ ID NO in its cDNA sequence such as sequence table：Shown in 1.The ThDof gene code heads of district 1149bp, encode 382 amino acid.

BLASTx similarity analysis, ThDof albumen include conservative Dof domains (such as Fig. 1).For Dof family genes, Therefore ThDof genes are named as.

2nd, sequence analysis is carried out to the ThDof genes that clone obtains using bioinformatics software and online Internet resources：

To the ThDof genes ProtParam (http of acquisition://au.expasy.org/tools/ Protparam.html) software calculates the protein molecular weight derived and theoretical isoelectric point.Utilize Blast programs (http:// Www.ncbi.nlm.nih.gov/BLAST/ Sequence homology search) is carried out, selects other 11 kinds high with its similarity degree not With the Dof gene amino acid sequences of plant, joined with multisequencing and carry out Multiple Sequence Alignment with program Clustalx (1.83).It is selected The Dof genes of 11 kinds of plants be respectively：Populus trichocarpa(XP_002310753)、Vitis vinifera (XP_003635142)、Jatropha curcas(KDP31874)、Theobroma cacao(XP_007047150)、 Ricinus communis(XP_002522340)、Malus domestica(XP_008339636)、Pyrus x bretschneideri(XP_009347242)、Citrus clementina(XP_006425821)、Nicotiana sylvestris(XP_009775010)、Glycine max(XP_003550086)、Nelumbo nucifera(XP_ 010255110)。

As a result it is 41.24 to show the gene coded protein molecular weight, and theoretical isoelectric point is 9.47.Further pass through Clustal softwares are to the gene coded protein sequence and the sequence homology of the Dof genes of 11 kinds of high plants of other similarity degrees Property it was found that, the homology of the Dof albumen of Chinese tamarisk Dof (ThDof) protein sequences and other 11 kinds of plants for 34.7%~ 48.2%, wherein the homology highest with grape (V vinifera), is 48.2%.In Chinese tamarisk Dof albumen and other each plants The homology of Dof albumen is not high, but all has conservative Dof domains.

Embodiment three：Present embodiment Tamarix hispida ThDof genes are in drought resistance and salt tolerance genetically modified plants are cultivated Application.

Utilize table of the real-time fluorescence quantitative RT-PCR research ThDof genes after Chinese tamarisk salt, arid and ABA processing Reach.Plant expression vector is built, arabidopsis thaliana transformation, environment stress experiment is carried out to turning ThDof genes arabidopsis, verifies ThDof The function of gene.

First, Chinese tamarisk different tissues ThDof Gene Expression Profile Analysis after environment stress

2 months raw Tamarix hispidas directly pour root with 0.4M NaCl, 20%PEG6000 and 100 μM of ABA solution, point Root, stem and leaf portion tissue are not taken after stress 0h (before processing), 3,6,9,12 and 24h, for gene expression detection.Use CTAB Method extracts total serum IgE, is digested through DNase I (Promega) and removes DNA.Using 1 μ g total serum IgEs as parent material, use PrimeScriptTM RT reagent Kit (TaKaRa), illustrate to carry out cDNA synthesis according to kit.By the first of synthesis The cDNA of chain dilutes 10 times, as quantitative RT-PCR template.

According to sequence-specific analysis, real-time quantitative RT-PCR primer is designed, primer sequence is shown in Table 1.

The real-time quantitative RT-PCR gene of table 1 and internal control primer sequence

Real-time quantitative RT-PCR reaction kit is SYBR Green Realtime PCR Master mix (Toyobo). With 3 genes of Chinese tamarisk α-tubulin (FJ618518), Actin (FJ618517) and β-tubulin (FJ618519) as internal reference Gene.Reaction system is：10 μ L 2 × SYBR premix ExTaq, P1, P2 (10 μm of olL^-1) each 1 μ L, 2 μ L dilution it is each The cDNA templates of toeatment period, deionized water is added to supply 20 μ L.Quantitative PCR reaction condition is：94 DEG C of pre-degeneration 30s；94 DEG C of changes Property 12s, 60 DEG C annealing 30s, 72 DEG C extension 40s；81 DEG C of read plate 1s, totally 45 circulations, 55 DEG C~99 DEG C, at interval of 0.2 DEG C of reading Plate 1s draws solubility curve.The relative quantitative assay of gene is carried out using 2- △ △ Ct methods.The expression quantity of all genes during mapping Log2 conversions are all carried out, ＞ 0 represents gene expression up-regulation, and ＜ 0 represents down regulation of gene expression, and=0 represents gene expression amount not Become.Real-time fluorescence quantitative RT-PCR testing result is shown, after NaCl and PEG Stress treatments, no matter in root, stem or leaf, The expression of ThDof genes is all by obvious up-regulated expression (as shown in Figures 2 and 3, in Fig. 2 and Fig. 3Represent root,Represent stem,Represent leaf), show that ThDof genes may participate in salt and the drought stress response of Chinese tamarisk.100 μM of ABA handle ThDof genes Expression pattern analysis figure is as shown in figure 4, in Fig. 4Represent root,Represent stem,Represent leaf.

2nd, the acquisition and resistance of reverse identification of ThDof gene arabidopsis are turned

Primer is designed according to ThDof gene orders, and XbaI and SacI restriction enzyme sites, F are introduced respectively in its upstream and downstream： 5 '-ATCGTCTAGAATGATCCAAGAATTGTTAGGTG-3 ' and R：5’-ATCGGAGCTCTCAAGGGTAAGCACCATTAGG- 3’.Performing PCR amplification is entered with Chinese tamarisk cDNA and obtains ThDof coding sequences.PCR reaction volumes are 20 μ L, and reaction system is： The μ L of cDNADof 2 (equivalent to 0.1 μ g total serum IgEs), 10 μm of olL^-1Primer each 1 μ L, 10 × Buffer 2 μ L, 10mmolL^- ¹DNTP 0.4 μ L, Taq archaeal dna polymerase (Takara) 1U.PCR response procedures are：94 DEG C of pre-degenerations 3min, 94 DEG C of denaturation 30s, 58 DEG C of annealing 30s；72 DEG C of extension 1min30s, circulate 35 times, are finally incubated 7min at 72 DEG C.Amplified production is coagulated through agarose Glue DNA purification kits (OMEGA) after purification, with XbaI and SacI (Promega) double digestion, after recovery purifying, are used with same XbaI connects with the ProKII carriers of SacI (Promega) double digestion.Connection product conversion Escherichia coli Top10 bacterial strains (Beijing White bio tech ltd of Yuanping City), after PCR checkings and sequencing identification are correct, by the plasmid (ProkII-ThDof) of restructuring It is transferred to conductance method in Agrobacterium tumefaciems EHA105 bacterial strains, obtains positive restructuring bacterium.

With the Agrobacterium EHA105 bacterial strains (positive restructuring bacterium) for carrying plant expression vector ProkII-ThDof and carry empty Plant expression vector ProkII Agrobacterium (as control), wild type is converted respectively using agriculture bacillus mediated flower-dipping method and intends south Mustard Columbia is environmental, to obtain overexpression strain.After the arabidopsis seed (T0 generations) of harvest is sterilized sowing containing Screening obtains resistant plant on the MS culture mediums of 50mg/L kanamycins.After 5~10 days, the resistant plant filtered out is moved into training Support and normally cultivated in soil, take its blade, extract blade STb gene using CTAB methods, take 1 μ L STb genes to make template, with vector construction Primer carries out Standard PCR checking, wherein using unconverted wild arabidopsis as negative control, plasmid ProKII-ThDof is the positive Control.Positive plant seed is harvested, i.e., T1 is for seed；T1 is continued to screen as stated above for seed, then the seed harvested is T2 is for seed.Continue to screen, until obtaining T3 for transgenic homozygous strain.

In order to analyze the influence for being overexpressed ThDof gene pairs arabidopsis anti-adversity abilities, ThDof gene arabidopsis T3 generations will be turned Strain is overexpressed (OE8-3), pK II and wild type seeds and carried out disinfection, and is then seeded in 1/2MS and contains 100mM respectively NaCl, 200mM Manntiol and 10 μM of ABA 1/2MS culture mediums on, be placed on 10~15d of culture in phjytotron, statistics Germination rate.

Under conditions of non-stress normal growth, find transgenosis T3 for arabidopsis with compareing the growth of non-transgenic arabidopsis And phenotype does not have difference, illustrate that the growth of ThDof gene pairs plants and phenotype are not disturbed significantly and in 100mM NaCl bars Under part, the germination percentage of transgenic line is 1.48 times of WT strain germination percentage.After 200mM mannitol stress, wild type is intended The average germination percentage of southern mustard only has 16.8%, but the germination percentage of transgenic line is 36.1% (shown in Fig. 5 and Fig. 6, in Fig. 5 Represent that 0mM NaCl, are represented in 100mM NaCl, Fig. 60mM mannitol is represented, represents 200mM mannitol).

, will simultaneously in order to determine the influence that salt and drought stress grow to transgenosis and non-transgenic (wild type) arabidopsis The big arabidopsis seedlings of 3d are grown on normal incubation medium and are transplanted to 1/2MS and NaCl containing 100mM and 200mM respectively On Manntiol 1/2MS culture mediums, growth counts root long and fresh weight after 14 days.Salt stress (100mM NaCl) transgenic line afterwards The average root long of system is 1.3 times of wild type control, and fresh weight is 2.32 times of wild type.After drought stress (200mM mannitol), The average root long of transgenic arabidopsis is 1.29 times to non-transgenic reference, and fresh weight increase by 47% (as shown in Fig. 7~10, Fig. 7 InRepresent that 0mM NaCl, are represented in 100mM NaCl, Fig. 80mM mannitol is represented, represents 200mM mannitol, Fig. 9 InRepresent that 0mM NaCl, represent 100mM NaCl, Tu10Zhong0mM mannitol is represented, represents 200mM mannitol).

Embodiment four：SEQ in the promoter sequence of present embodiment Tamarix hispida ThDof genes such as sequence table ID NO：Shown in 3.

ThDof gene promoters are cloned and expression analysis

Using Chinese tamarisk DNA as template, according to ThDof gene orders, 3 primer (P1 are designed：5′-TAC TGATGAAACGCCACAACTG-3′；P2：5′-TGCACCCACCTCCAATAG GCAC-3′；P35′- ACCTTTAGTCCAGTAACGACG-3 '), using Genomic walking kits, clone obtains ThDof gene promoter sub-pieces Section, length 1874bp.

The ThDof gene promoters obtained using the online sequence analysis tools of PLACE promoters to clone are included suitable Formula functional element is analyzed, the results showed that, it is basic that ThDof gene promoters do not comprise only TATA-box, CAAT-box etc. Transcription initiation elements；Also comprising hormone, salicylic acid response element ASF；MYBCORE elements：It is relevant with the generation of hydrogen silicic acid, adjust Anti- stress, the element ANAERO1CONSENSUS of survival ability under section anaerobic environment；Adjust sugar decomposition and anaerobic reaction element ANAER；Mediate the W-box that the responsive transcription of the exciton induction in the sources such as pathogen and environment stress is related.Illustrate ThDof bases Because may be induced by hormone signals such as abscisic acid, salicylic acids, regulated and controled by various plants adverse circumstance.

In order to analyze the expression characterization of ThDof genes, ThDof gene promoters are oriented and replace carrier pCAMBIA1301 The 35S promoter of plasmid, (such as Figure 11) is recombinated with gus gene, structure plant over-express vector pCAMBIA1301- proThDof::GUS, Escherichia coli and Agrobacterium are converted, detect sequence verification through PCR, it was demonstrated that structure obtains promoter proThDof::GUS plant expression vector.

Further by pCAMBIA1301-proThDof8::GUS transgenic arabidopsis, T3 is obtained for transgenic arabidopsis Afterwards, it will uniformly be seeded on 1/2MS culture mediums after transgenic seed surface sterilization, cultivated under normal growing conditions.Take respectively not The plant of same growth and development stage (1d, 2d, 3d, 4d, 5d, 6d, 1w, 2w, 3w, 4w, 5w, 6w etc.) and the tissue of different parts (leaf, flower, inflorescence, pod, seed etc.) carries out GUS dyeing.As a result show, ThDof genes high expression, spire in radicle and root In expression be higher than climax leaves, and expression quantity is very low (such as Figure 12) in seed and pod.

Sequence table

<110>Northeast Forestry University

<120>Tamarix hispida ThDof genes, its encoding proteins and its promoter sequence and application

<160> 16

<210> 1

<211> 1149

<212> cDNA

<213>Chinese tamarisk (Tamarix)

<220>

<223>Tamarix hispida ThDof genes

<400> 1

atgatccaag aattgttagg tggtagagca acaggattag tcggtggtgc aggagagaga 60

aaaatctcca ttaataccga tcaaggtcct cgcagtcatc cttcaaaccc ccttcccctt 120

cttcttcttc ttctccatca ctaccatctt caactactac taatactact gctgccacca 180

ccaccactac tgctactaca aatatctcca ccactactac aacaagctcg gccgaaaacc 240

agacaaaacc tgagatgccc gagatgcgat tcaacaaaca caaagttctg ttactacaac 300

aactacaacc tcacccaacc tcgccatttc tgtaaaacat gccgtcgtta ctggactaaa 360

ggtggcgcgt tgaggaacgt gcctattgga ggtgggtgca ggaagaacaa gggtggtagt 420

aatagcagtt gtggcgtttc atcagtaact gctggttgtg ctggcaagtc aattgctgcg 480

aaggctagga cagtgctgtc tatatccgac tttgataagc gaggaagtga tttagcaaac 540

ggttttgttc aagatcattt ccaccaacaa caacattcga acccatttgt ttggaattct 600

ccatctcaga gcacttctca catcttagcc ttacttagag cggcacaaaa ccctaaccct 660

aaccccagtc ctaaccctct ttctaatgct tttggcctta tgaagagcga ggggctgatg 720

atgaataccg ctataaatgg tagcaatcca gggttggatt catatagcag ggctccttcc 780

cctctcggcc tttgcagcag cactggaacc aacttctgga aaaacaacga tagccaacaa 840

caagggcacc agcagcaaag tggcaacggc cttatgatgg gagaggttgt ccaaaatagt 900

ggtcttcagg agctgtttca gaagctgaaa tcatcatcac cgtcacgtaa ttactatggc 960

gatcatcatc ctggagccat gttcttaagc aacaatagta gcgccgtcac ttgttcaagt 1020

tctccaaatt cgactatgtt agagtcagcg gtaccagcgg ctgcaaatca tgattttggc 1080

tacttcactt ctccttctct tttaaccagc tggtctgacc tcccaactcc taatggtgct 1140

tacccttga 1149

<210> 2

<211> 258

<212> PRT

<213>Chinese tamarisk (Tamarix)

<220>

<223>Tamarix hispida ThDof gene coded proteins

<400> 2

Met Ile Gln Glu Leu Leu Gly Gly Arg Ala Thr Gly Leu Val Gly

5 10 15

Gly Ala Gly Glu Arg Lys Ile Ser Ile Asn Thr Asp Gln Gly Pro

20 25 30

Arg Ser His Pro Ser Asn Pro Leu Pro Leu Leu Leu Leu Leu Leu

35 40 45

His His Tyr His Leu Gln Leu Leu Leu Ile Leu Leu Leu Pro Pro

50 55 60

Pro Pro Leu Leu Leu Leu Gln Ile Ser Pro Pro Leu Leu Gln Gln

65 70 75

Ala Arg Pro Lys Thr Arg Gln Asn Leu Arg Cys Pro Arg Cys Asp

80 85 90

Ser Thr Asn Thr Lys Phe Cys Tyr Tyr Asn Asn Tyr Asn Leu Thr

95 100 105

Gln Pro Arg His Phe Cys Lys Thr Cys Arg Arg Tyr Trp Thr Lys

110 115 120

Gly Gly Ala Leu Arg Asn Val Pro Ile Gly Gly Gly Cys Arg Lys

125 130 135

Asn Lys Gly Gly Ser Asn Ser Ser Cys Gly Val Ser Ser Val Thr

140 145 150

Ala Gly Cys Ala Gly Lys Ser Ile Ala Ala Lys Ala Arg Thr Val

155 160 165

Leu Ser Ile Ser Asp Phe Asp Lys Arg Gly Ser Asp Leu Ala Asn

170 175 180

Gly Phe Val Gln Asp His Phe His Gln Gln Gln His Ser Asn Pro

185 190 195

Phe Val Trp Asn Ser Pro Ser Gln Ser Thr Ser His Ile Leu Ala

200 205 210

Leu Leu Arg Ala Ala Gln Asn Pro Asn Pro Asn Pro Ser Pro Asn

215 220 225

Pro Leu Ser Asn Arg Phe Gly Leu Met Lys Ser Glu Gly Leu Met

230 235 240

Met Asn Thr Ala Ile Asn Gly Ser Asn Pro Gly Leu Asp Ser Tyr

245 250 255

Ser Arg Ala Pro Ser Pro Leu Gly Leu Cys Ser Ser Thr Gly Thr

260 265 270

Asn Phe Trp Lys Asn Asn Asp Ser Gln Gln Gln Gly His Gln Gln

275 280 285

Gln Ser Gly Asn Gly Leu Met Met Gly Glu Val Val Gln Asn Ser

290 295 300

Gly Leu Gln Glu Leu Phe Gln Lys Leu Lys Ser Ser Ser Pro Ser

305 310 315

Arg Asn Tyr Tyr Gly Asp His His Pro Gly Ala Met Phe Lys Ser

320 325 330

Asn Asn Ser Ser Ala Val Thr Cys Ser Ser Ser Pro Asn Ser Thr

335 340 345

Met Lys Glu Ser Ala Val Pro Ala Ala Ala Asn His Asp Phe Gly

350 355 360

Tyr Phe Thr Ser Pro Ser Leu Leu Thr Ser Trp Ser Asp Leu Pro

365 370 375

Thr Pro Asn Gly Ala Tyr Pro

380 382

<210> 3

<211> 1874

<212> cDNA

<213>Chinese tamarisk (Tamarix)

<220>

<223>Tamarix hispida ThDof gene promoters

<400> 3

attcgttgga tggataaaga tgagaatatt ggaagaggag tagcaaaggt ttgtgtgaca 60

tgttgtgtta ggagtagaga gatcctctta cattacatat tagtgagaag tgactaggaa 120

aatgtttgca tgtaggggac ttggtactat cttgagtgaa aggttgagat ttgatcaatc 180

aaatcttgag cataattgtg agaaggtgac aaaactcctt gcattgagtt tgagtacctc 240

ataagtttag gatgacaaat cgatctttag ctaaaagatc aatatattag aagcatggcg 300

gtaaagattt tagaaataaa ggacctttat tgtatttttt tcatccatct cctaggatag 360

taaaattcca tcacttctca ctgtttcgaa ccatataaat cttatgttct ccgttttata 420

atacaaaaga tgtaattttt ccaactttat ttcattatgt aaggtatttt atgacaaata 480

aaaaaatgct acattttcat ttttcttatt ccatcctctt tcttatgttt tttctagccc 540

atgccatcaa tgggtaaatg agtgtttgtt taaaggtaaa tatattaggc cttatttttc 600

ctaataatta ttttaacttt ctaatatatt tgcagaaacc attaaagtct tatattttga 660

aacattcagc ccttaaatat atcaggactg gaagagatgc gattttgtgc atttaagtgg 720

tttggtactt atcatgtatg agaagtcaag attctatcaa ccaaatctta agcctaattg 780

tgagttaata ttagatgtaa acatctgcct aactggttaa gattttagac atagattgcc 840

tttattgtta tttttttcct tccatcttta agtaaaattt cacccgaatc tatagagcgt 900

tgggtgatat gcactagtat tgagattccc aaattctctg caaacctctc attgcaaatt 960

tgaaatatta aacgacgata atgacaactc gtgatattaa ttaattaacc tagttttgta 1020

tttgtcactc acattaggcg cgtttctaat aggcctagag aaattttgct aaaataatct 1080

ttgtattttt cgtttaatag gttagtcagc gtaccgcatt aaacgattga ggtttgtcac 1140

ataccatgta acttgccagc tccggtgaag atacatgctc tgtttctaat ttgtcattta 1200

gttgttgtta ttttgcttga gtgctgtcgt caaaatcatg aggatagtga tgtggtcttt 1260

atcatcatta atccgacatc agaaaaacat atagaaagta ttagcaagga ccgattgaga 1320

aagaatagtc aagagagaag aaacaagaga gagagagaga gagagctatt gcattcacgt 1380

attccacttc cctccaaaaa agtacaaccc acagccaaat gccaaatcga agaccaaccc 1440

cctttttttt tctttttttt ttgttcccct cctcctcttc atcacttatt ttattcaatc 1500

gacaaagtgg gagtctttaa attcgtggga atatatatca tatgtgcgtc ttatgtctat 1560

attataaaag cccatcatcc gctcctcctc tcccaatatt ctcatcttta tccatccaac 1620

gaataccaga aaatatgcag tcaaagtagt taggcatcca agctagctag ctttacgatc 1680

tctttctctc catctccact aaggatatca tcaaaccaag aaccacatca gaccactttc 1740

tctttcttgc tacttttcct acaagaaaaa aaaaaaaaca tcctcattgc tcgaacgatc 1800

ttctttgctt ttccttgttt ttggattgtt gtcgatctag cttgaaaaag ttttttgctt 1860

aagcaaaaga aaaa 1874

<210> 4

<211> 14

<212> DNA

<213>Artificial sequence

<220>

<223>ThDof gene real-time quantitative RT-PCR forward primers

<400> 4

tgagatgcccgaga 14

<210> 5

<211> 16

<212> DNA

<213>Artificial sequence

<220>

<223>ThDof gene real-time quantitative RT-PCR reverse primers

<400> 5

gaacaagggtggtagt 16

<210> 6

<211> 14

<212> DNA

<213>Artificial sequence

<220>

<223>Actin gene real-time quantitative RT-PCR forward primers

<400> 6

aaacaatggctgat 14

<210> 7

<211> 17

<212> DNA

<213>Artificial sequence

<220>

<223>Actin gene real-time quantitative RT-PCR reverse primers

<400> 7

acaataccgtgctcaat 17

<210> 8

<211> 15

<212> DNA

<213>Artificial sequence

<220>

<223>α-tubul gene real-time quantitative RT-PCR forward primers

<400> 8

cacccaccgttgttc 15

<210> 9

<211> 17

<212> DNA

<213>Artificial sequence

<220>

<223>α-tubul gene real-time quantitative RT-PCR reverse primers

<400> 9

accgtcgtcatcttcac 17

<210> 10

<211> 14

<212> DNA

<213>Artificial sequence

<220>

<223>β-tubul gene real-time quantitative RT-PCR forward primers

<400>10

ggaagccatagaaa 14

<210> 11

<211> 17

<212> DNA

<213>Artificial sequence

<220>

<223>β-tubul gene real-time quantitative RT-PCR reverse primers

<400> 11

caacaaatgtgggatgc 17

<210> 12

<211> 32

<212> DNA

<213>Artificial sequence

<220>

<223>Primers F

<400>12

atcgtctagaatgatccaagaattgttaggtg 32

<210> 13

<211> 31

<212> DNA

<213>Artificial sequence

<220>

<223>Primer R

<400> 13

atcggagctctcaagggtaagcaccattagg 31

<210> 14

<211> 22

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P1

<400> 14

tactgatgaaacgccacaactg 22

<210> 15

<211> 22

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P2

<400> 15

tgcacccacctccaataggcac 22

<210> 16

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<223>Primer P3

<400> 16

acctttagtccagtaacgacg 21

Claims

1. Tamarix hispida ThDof genes, it is characterised in that SEQ ID NO in the cDNA sequence of the gene such as sequence table：Shown in 1.

2. the encoding proteins of Tamarix hispida ThDof genes, it is characterised in that the amino acid sequence of the encoding proteins such as SEQ ID NO：Shown in 2.

3. the promoter sequence of Tamarix hispida ThDof genes, it is characterised in that the promoter sequence such as SEQ ID NO：Shown in 3.

4. application of the Tamarix hispida ThDof genes as claimed in claim 1 in drought resistance and salt tolerance genetically modified plants are cultivated.