CN107746846A

CN107746846A - The IbABF4 genes of coding sweet potato bZIP transcription factors and application

Info

Publication number: CN107746846A
Application number: CN201711018018.4A
Authority: CN
Inventors: 边小峰; 禹阳; 贾赵东; 马佩勇; 郭小丁; 谢芝; 谢一芝
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2017-10-26
Filing date: 2017-10-26
Publication date: 2018-03-02
Anticipated expiration: 2037-10-26
Also published as: CN107746846B

Abstract

The invention discloses a kind of coded sequence of positive regulation flowering of plant sweet potato ABF4 genes and its application.The wherein IbABF4 genes of coding sweet potato bZIP transcription factors, it is the nucleotide sequence shown in SEQ ID NO.1.The protein of IbABF4 gene codes is the amino acid sequence shown in SEQ ID No.2.The present invention isolates the global cDNA of coding bZIP transcription factors from sweet potato, is connected on plant expression vector, converts plant using Agrobacterium infestation method, obtains transfer-gen plant, transfer-gen plant is bloomed in advance.This gene can apply to genetic modification of plants.

Description

The IbABF4 genes of coding sweet potato bZIP transcription factors and application

Technical field

The invention belongs to genetic engineering field, and in particular to a kind of IbABF4 genes of coding sweet potato bZIP transcription factors, The degeneration-resistant application of the protein of the gene code and recombinant vector and gene containing the gene.

Background technology

Bloom and determine that higher plant possesses breeding and hereditary ability, have to plant individual and Offspring's deyelopment Important meaning.The florescence control of plant is to participate in by a plurality of approach, the comprehensive molecular genetic knot of blooming constantly updated Fruit, the various endogenous approach bloomed with exogenous signals startup of plant responding are summarized as：The Photoperiod pathway of classics, vernalization way Footpath, autonomous pathway, gibberellin pathway and newer age approach totally 5.In agricultural production process, crop bloom and and production Amount, adaptation zone have the relation of interwoveness, such as rice, wheat, corn, potato.

Transcription factor its important function in flowering of plant approach is regulated and controled, bZIP family genes are that regulation flowering of plant is a kind of Important transcription factor.Wherein, ABF is a kind of bZIP transcription factors that can be combined with ABRE, the basic region of the genoid Amino acid sequence it is very conservative, also containing special MKIK and QAY/Q motifs.The genoid is primarily involved in the anti-non-life of plant Thing stress approach (non-irrigated, cold, salt and oxidative stress etc.) and ABA signal transductions, but the report related to flowering of plant is few.

Sweet potato is not only important cereal crops, but also is important industrial crops and energy crop.Sweet potato is planted extensively The country of 100 in the world more is implanted in, China is largest production state in the world, and sweet potato production accounts for the 80% of world sweet potato. Compared with other cereal crops, sweet potato is comparatively drought-enduring, but Differences are larger, in the world the sweet potato plantation of significant proportion In arid environments, and the world is arid, semiarid zone has accounted for more than 1/3rd of land area, shadow of the arid to plant Sound ranks first in many natural stress factors.Sweet potato full-length genome about 4G, containing abundant genetic resources, is separated in sweet potato ABF class transcription factors are cloned, its functional characteristic is studied, genetic resources can be provided for crop genetic improvement.

The content of the invention

It is an object of the invention to provide a kind of IbABF4 genes of coding sweet potato bZIP transcription factors.

Second object of the present invention is to provide a kind of protein of the gene code.

Third object of the present invention is to provide a kind of expression vector containing the gene.

Fourth object of the present invention is to provide a kind of host cell containing the expression vector.

Final object of the present invention is the purposes for providing the gene.

Technical scheme is summarized as follows：

A kind of IbABF4 genes of coding sweet potato bZIP transcription factors, it is the nucleotide sequence shown in SEQ ID NO.1. Described nucleotide sequence is by 1263 base compositions.

The protein of said gene coding, it is the amino acid sequence shown in SEQ ID No.2.Described sequence is by 420 Individual amino acid residue composition.

A kind of expression vector pCAMBIA1305-IbABF4 containing said gene, it contains shown in SEQ ID NO.1 Nucleotide sequence.

A kind of Agrobacterium host cell EHA105 containing above-mentioned expression vector：pCAMBIA1305-2×35s-IbABF4.

The application of above-mentioned expression vector or Agrobacterium host cell in conversion plant obtains transfer-gen plant, especially exists Application in prepare transgenosis arabidopsis.

Advantages of the present invention：

The present invention isolates the global cDNA of coding bZIP transcription factor genes from sweet potato, is connected to plant expression vector On, convert plant, the transfer-gen plant of acquisition, the results showed that IbABF4 genes can promote plant using Agrobacterium infestation method Bloom.

Brief description of the drawings

The Phylogenetic analysis result of Fig. 1 .IbABF4 amino acid sequences；

Fig. 2 .pCAMBIA1305-2 × 35s-IbABF4 carrier schematic diagrames；

The unconverted southern mustard strains of Fig. 3 and turn IbABF4 gene plant root systems and compare.

Embodiment

The invention will now be further described with reference to specific embodiments, advantages of the present invention and feature will be with description and It is apparent.But involved specific experiment method is conventional method or according to system unless otherwise specified in following embodiments The condition for making manufacturers instruction suggestion is implemented.

Embodiment 1

BZIP transcription factors IbABF4 gene orders obtain in sweet potato, specific as follows：

Using OMEGA RNA kits, total serum IgE is extracted from 100mg fresh Sweet Potato Leaf, utilizes Reverse Transcription Box (Bioteke) synthesizes cDNA.

Specific reaction system is as follows：

In PCR instrument reverse transcription reaction is carried out by following condition：1st, 50 DEG C, 45min；2nd, 70 DEG C, 10min；Afterwards on ice Cooling.

Send the total serum IgE of extraction to Hua Da gene (Beijing Genomic Institute, BGI), pass through high-flux sequence Sweet potato transcript profile database is obtained, and is spliced by De novo and obtains sweet potato Unigene databases, wherein CL3260 and NR numbers Find that the gene may participate in ABA approach after being compared according to storehouse.CL3260 is passed through into OFR FINDER (http：// Www.ncbi.nlm.nih.gov/projects/gorf/) the ORF that online software predicted gene is completed, and utilize Primer The designs of Premier 5 expand complete ORF primers：

IbABF4(F)：5′ATGATGGGGTCATACTTGGA 3′

IbABF4(R)：5′TTACCAAGGCCCAGTAAGCG 3′

Expanded, comprised the following steps that using TAKARA companies Primerstar GXL archaeal dna polymerases：

Reaction condition is as follows：94 DEG C, 4min；98 DEG C, 10Sec；55 DEG C, 15Sec；68 DEG C, 1.5min；72 DEG C, 10min； 30 circulations.PCR primer is purified using OMEGA DNA purification kits, PCR primer after purification carries with pEASY-Blunt Body connection (this process uses TransGEN pEASY-Blunt Vector Cloning Kit kits), reaction system is such as Under：The μ L of cDNA fragments 4u1, pEASY-Blunt carrier 1 of IbABF4 genes.Reaction condition：20-30 DEG C, 30min.Connection product Transformed E-Coli.DH5 α competence, is coated on the X-Gal containing 40u125mg/ml, 16ul 50mg/ml IPTG, 100mg/ Cultivated on mL Amp LB Agar Platings, form single bacterium colony.White colony is selected, is confirmed using bacterium colony PCR methods The length scale of Insert Fragment in pEASY-Blunt carriers, with being expected unanimously.The sequencing of Nanjing Jin Sirui biotechnologies company is sent to obtain Obtain gene order SEQ ID NO.1.

Embodiment 2

IbABF4 protein sequence homogeneous assays, it is specific as follows：

It is 1263bp that sequencing, which obtains IbABF4 gene orders, and 421 amino acid of coding will turn over as shown in SEQ ID NO.2 Translate acquisition protein sequence and (http is compared with NCBI protein datas：//blast.ncbi.nlm.nih.gov/ Blast.cgi), the plant species homologous gene similar to IbABF4 protein sequences is obtained.On the basis of Multiple range test analysis On, the systematic evolution tree of each homologous plant kind gene is established, refers to Fig. 1.Including morning glory (Ipomoea nil), tobacco (Nicotiana tabacum), potato (Solauum tuberosum), tomato (Solanum lycopersicum), capsicum (Capsicum annuum), black nightshade (Solanum nigrum), Asiatic cotton (Gossypium arboretum), rice (Oryza Sativa), walnut (Juglans regia), arabidopsis (Arabidopsis thaliana).Carried out using the softwares of MEGA 5.1 The structure of systematic evolution tree, obtains IbABF4 affiliations and arabidopsis and grape affiliation are relatively near (such as Fig. 1).

Embodiment 3

Binary plant expression vector pCAMBIA1305-2 × 35s-IbABF4 structure, it is specific as follows：

PCAMBIA1305-2 × 35s-IbABF4 carriers schematic diagram is as shown in Fig. 2 first with pEASY-Blunt-IbABF4 Plasmid is template, using primer

IbABF4-PstI(F)：5′aaCTGCAG ATGGCTGCCACTATTGAT3′

IbABF4-BamHI(R)：5′ccGGATCCTTATGACCCGCCCGAACCTG 3′

Introduce restriction enzyme site PstI and BamHI respectively before and after IbABF4, institute in its reaction system and condition such as embodiment 1 State.Then PCR primer and pCAMBIA1305 empty carriers plasmid use BamHI and PstI double digestions respectively, by the digestion products of the two Connection, linked system are as follows：

Connection product Transformed E-Coli.DH5 α, be coated on the card of concentration containing 100mg/ml receive chloramphenicol resistance LB flat boards on.37 DEG C culture, picking single bacterium colony carries out bacterium colony PCR checkings after 12h, and bacterium colony PCR is verified to positive bacterium, shakes bacterium extraction plasmid, digestion Identification obtains purpose band, finally send Hua Da gene sequencing company to be sequenced, the results showed that carrier pCAMBIA1305-2 × 35s- IbABF4 structures are correct.

Embodiment 4

Agrobacterium strain EHA105 for plant transgene：PCAMBIA1305-2 × 35s-IbABF4 structure, specifically It is as follows：

The agrobacterium strains that the present invention uses are EHA105.The expression vector built is turned using frozen-thawed method Enter Agrobacterium.Detailed process is：1) ice bath melted EHA105 competent cells, the expression for adding at least 100ng recovery purifyings carry Constitution grain, is gently mixed, 20~30min of ice bath；2) liquid nitrogen flash freezer 5min, 37 DEG C of thermal shock 5min, be immediately placed on ice 1~ 2min；3) the LB culture mediums of 800 μ L antibiotic-frees of addition, 28 DEG C, 200rpm recoveries 3.5h；4) 4000rpm centrifuges 3min, sops up Culture medium；5) remaining bacterium solution is mixed, addition 100mg/ml cards is applied to and receives the solid LB of mycin and 100mg/ml rifampins and train base On；6) it is inverted 30~48h of culture for 28 DEG C；7) PCR detects positive colony, and 4 DEG C save backup.

Embodiment 5

IbABF4 converts Col wildtype Arabidopsis thalianas, specific as follows：

The positives clone of embodiment 4 is inoculated into the training of 50ml YEP (containing 100 μ g/ml Rif, 100 μ g/ml Kan) liquid Support in base, 28 DEG C of 180rpm continue culture to OD600=0.8.4000rpm centrifuges 10min, abandons culture medium, collects thalline.With plan Southern mustard penetrates into buffer solution by mycelium dilution OD600=0.6, is prepared into arabidopsis and infects liquid.As arabidopsis bolting 4-5cm Preparation is infected, and the preceding 3d infected removes its terminal inflorescence, to utilize the growth of axillary inflorescence.After axillary inflorescence is grown, under it The flowers are in blossom in portion begins to be converted during pollination.Largely watered before conversion, and the bud pollinated and pod are extractd.Prepare altogether 50ml arabidopsis infects liquid (5% sucrose, 0.05%SilwetL-77), pours into culture dish, the inflorescence of arabidopsis is immersed 30s, notice that lotus throne leaf not be infected with bacterium solution.Plant is taken out, is disposed across in pallet, dark treatment 24h.Square plate is uprightly placed afterwards Normal illumination culture.T0 is harvested when Fruit pod maturation for seed.

Before T0 is sowed for seed after 4 DEG C of refrigerator vernalization 3d, 0.5%NaClO surface sterilizations, 1/2MS solids are seeded in (a great number of elements, trace element halve, hygromycin containing 20mg/L) is cultivated on culture medium.Transformant is selected after 7~14d, there is tide The transformed plant physical efficiency of chloramphenicol resistance grows on containing hygromycin culture medium, and root substantially extends, rather than transformant yellow gradually It is dead.When plant to be planted grows 4-5 piece leaves, extraction leaf DNA enters performing PCR identification, and primer and PCR programs are the same as in embodiment 1 The clone of segment among IbABF4 genes.1% agarose gel electrophoresis detects PCR primer.Purpose piece can be obtained by crossing PCR amplifications It is disconnected for arabidopsis positive transformant, continued culture and treat the ripe harvest T1 of Fruit pod for seed.PCR is accredited as to the plant of the positive The T1 that strain is harvested continues to sow for seed, also passes through hygromycin resistance screening, counts its trait segregation ratio.Through Chi-square Test Meet 3: 1 segregation ratio in mendel's law.Partial resistance seedling is implanted into soil, the transgenosis kind of harvest T2 generation homozygosis Son.

The phenotype for turning IbABF4 gene arabidopsis is identified

IbABF4 overexpression arabidopsis strains (OV-1, OV-2) and wild type (WT) plant point for conversion is taken to be sowed at 1/ Grown on 2MS culture mediums, observation phenotype (Fig. 3) is overexpressed IbABF4 in arabidopsis can be with positive regulation plant when blooming Between.

Sequence table

<110>Jiangsu Province Agriculture Science Institute

<120>The IbABF4 genes of coding sweet potato bZIP transcription factors and application

<130> 2017

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1263

<212> DNA

<213> Ipomoea batatas

<400> 1

atgatggggt catacttgga cttcaagaac tttgtggaga caccacagcc agaaggtaat 60

ggagggaagc cagccagtct tttccctttg gctcgacaat cttcgatata ctccttgaca 120

tttgatgagc tccagacaac atttagcgga cttgggaagg atttcgggtc tatgaatatg 180

gaggatctgt tgaagagcat ttggactgcc gaggaatctc aacccttcca ggcatgttgt 240

gttggtgcag gagataatgg tagtgtccct ggtgggaact tgcagagaca aggctctcta 300

acgctgccca ggacgctcag tcagaaaact gtggatgaag tgtggaaaga ctttcagaaa 360

gacactggtg ccaccaaaga ttgtggctat ggtggatcaa gctttggcca aagacaatct 420

actttggggg aaatgacatt ggaggagttt ttgttcaaag caggggttgt aagggaagaa 480

atggttccaa atagtgttgg atttggcagc agtgtgactc agctgaatag tatgggattt 540

caagaaatca cagataataa cagtgctgcc attcctggtg catcatctaa ttcaatgctt 600

agtgcaggag ccaccagatc tacccagcaa caacctttgc agcatcatca acagcttcag 660

cttcaccaac cactttttcc taagcagaca accttgacct ttgcctctcc aatgcaatta 720

caaaacaatg ctcagcaggc taggtcagga gcaaggcgtc ctgctcttgg aatgccaagt 780

cctccacata acactaatca agttcaggga gaacttatcc aaggcagtgc gaatagcatg 840

gcaggattac gccaaaatgg ggctgcagga ggaggaggag gaggatcccc tggaattcca 900

ttgtcttcag atgtggctct taatagtaat ctgggcatgt catccctatc cccttcgcct 960

tatgcattta acgaaggcgg gagagggagg agagcatgta actctataga aaaggtggtg 1020

gagcggaggc gtaggagaat gattaagaac agagagtctg ctgcaagatc acgagccagg 1080

aagcaggcct ataccataga gttggaagcg gaagtagaaa agcttaaaga aatcaaccaa 1140

gaattgatga aaaaacaggc tgaatttctg gagaagcgga aaaatcagat gagggagaaa 1200

atgtttgtgc catgggaaag taaaccaaga tgcttgaaga ggacgcttac tgggccttgg 1260

taa 1263

<210> 2

<211> 420

<212> PRT

<213> Ipomoea batatas

<400> 2

Met Met Gly Ser Tyr Leu Asp Phe Lys Asn Phe Val Glu Thr Pro Gln

1 5 10 15

Pro Glu Gly Asn Gly Gly Lys Pro Ala Ser Leu Phe Pro Leu Ala Arg

20 25 30

Gln Ser Ser Ile Tyr Ser Leu Thr Phe Asp Glu Leu Gln Thr Thr Phe

35 40 45

Ser Gly Leu Gly Lys Asp Phe Gly Ser Met Asn Met Glu Asp Leu Leu

50 55 60

Lys Ser Ile Trp Thr Ala Glu Glu Ser Gln Pro Phe Gln Ala Cys Cys

65 70 75 80

Val Gly Ala Gly Asp Asn Gly Ser Val Pro Gly Gly Asn Leu Gln Arg

85 90 95

Gln Gly Ser Leu Thr Leu Pro Arg Thr Leu Ser Gln Lys Thr Val Asp

100 105 110

Glu Val Trp Lys Asp Phe Gln Lys Asp Thr Gly Ala Thr Lys Asp Cys

115 120 125

Gly Tyr Gly Gly Ser Ser Phe Gly Gln Arg Gln Ser Thr Leu Gly Glu

130 135 140

Met Thr Leu Glu Glu Phe Leu Phe Lys Ala Gly Val Val Arg Glu Glu

145 150 155 160

Met Val Pro Asn Ser Val Gly Phe Gly Ser Ser Val Thr Gln Leu Asn

165 170 175

Ser Met Gly Phe Gln Glu Ile Thr Asp Asn Asn Ser Ala Ala Ile Pro

180 185 190

Gly Ala Ser Ser Asn Ser Met Leu Ser Ala Gly Ala Thr Arg Ser Thr

195 200 205

Gln Gln Gln Pro Leu Gln His His Gln Gln Leu Gln Leu His Gln Pro

210 215 220

Leu Phe Pro Lys Gln Thr Thr Leu Thr Phe Ala Ser Pro Met Gln Leu

225 230 235 240

Gln Asn Asn Ala Gln Gln Ala Arg Ser Gly Ala Arg Arg Pro Ala Leu

245 250 255

Gly Met Pro Ser Pro Pro His Asn Thr Asn Gln Val Gln Gly Glu Leu

260 265 270

Ile Gln Gly Ser Ala Asn Ser Met Ala Gly Leu Arg Gln Asn Gly Ala

275 280 285

Ala Gly Gly Gly Gly Gly Gly Ser Pro Gly Ile Pro Leu Ser Ser Asp

290 295 300

Val Ala Leu Asn Ser Asn Leu Gly Met Ser Ser Leu Ser Pro Ser Pro

305 310 315 320

Tyr Ala Phe Asn Glu Gly Gly Arg Gly Arg Arg Ala Cys Asn Ser Ile

325 330 335

Glu Lys Val Val Glu Arg Arg Arg Arg Arg Met Ile Lys Asn Arg Glu

340 345 350

Ser Ala Ala Arg Ser Arg Ala Arg Lys Gln Ala Tyr Thr Ile Glu Leu

355 360 365

Glu Ala Glu Val Glu Lys Leu Lys Glu Ile Asn Gln Glu Leu Met Lys

370 375 380

Lys Gln Ala Glu Phe Leu Glu Lys Arg Lys Asn Gln Met Arg Glu Lys

385 390 395 400

Met Phe Val Pro Trp Glu Ser Lys Pro Arg Cys Leu Lys Arg Thr Leu

405 410 415

Thr Gly Pro Trp

420

Claims

1. a kind of IbABF4 genes of coding sweet potato bZIP transcription factors, it is characterised in that it is the core shown in SEQ ID NO.1 Nucleotide sequence；The IbABF4 genes have the function of positive regulation flowering of plant.

2. the protein of IbABF4 gene codes described in claim 1, it is characterised in that it is the ammonia shown in SEQ ID No.2 Base acid sequence.

A kind of 3. expression vector pCAMBIA1305-2 × 35s-IbABF4 containing gene described in claim 1.

A kind of 4. Agrobacterium host cell EHA105 containing expression vector described in claim 3：pCAMBIA1305-2×35s- IbABF4。

5. Agrobacterium host cell described in the expression vector or claim 4 described in claim 3 obtains in conversion plant turns base Because of the application in plant.

6. application according to claim 5, it is characterised in that described plant is arabidopsis.