CN105754965A - Wlofberry phytochelatin synthetase as well as coding gene and application thereof - Google Patents
Wlofberry phytochelatin synthetase as well as coding gene and application thereof Download PDFInfo
- Publication number
- CN105754965A CN105754965A CN201610223742.XA CN201610223742A CN105754965A CN 105754965 A CN105754965 A CN 105754965A CN 201610223742 A CN201610223742 A CN 201610223742A CN 105754965 A CN105754965 A CN 105754965A
- Authority
- CN
- China
- Prior art keywords
- plant
- gene
- pcs
- transgenic
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/104—Aminoacyltransferases (2.3.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/02—Aminoacyltransferases (2.3.2)
- C12Y203/02015—Glutathione gamma-glutamylcysteinyltransferase (2.3.2.15), i.e. phytochelatin synthase
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a wolfberry phytochelatin synthetase as well as a coding gene and application thereof. Application of the coding gene in preparation of a transgenic plant comprises the following steps of: extracting total RNA in wolfberry leaves, carrying out touchdown PCR, and cloning a wolfberry phytochelatin synthetase gene Lc PCS, so that a 1506bp sequence containing a complete gene coding region is obtained; constructing an escherichia coli expression vector pET28a Lc PCS, and obtaining expression protein by virtue of an escherichia coli heterogeneous expression system; and constructing a binary plant expression vector pCAMBIA2300 LcPCS, transferring the vector into agrobacterium C58 cells by adopting an electroporation method, transforming tobacco with the cells, testing, wherein results show that resistance of transgenic tobacco on salt, heavy metal cadmium and the like is greatly improved, and modifying gene on corn, soybean, rice, peanut, barley, rose, eustoma grandiflorum, euonymus japonicus, robinia ambigua idahoensis and the like, wherein results show that resistance of the transgenic plants to salt and heavy metal cadmium is greatly improved.
Description
Technical field
The present invention relates in a kind of Fructus Lycii (LyCium Chinense Miller) plant complexation element synzyme and encoding gene thereof and application.
Background technology
In multiple pollution or saline-alkali environment, the metal ion that plant growing containing multiple excess is necessary and nonessential.Under these stress factors effects, cell produces oxidative stress, produces the active oxygen of excess, causes cell membrane lipid, nucleic acid equivalent damage.There is some regulatory mechanism to tackle these adverse circumstances in plant, such as, produce substantial amounts of reducing substances (such as glutathion), organic acid (such as malic acid), antioxidase.Plant is by regulating the glutathion (GSH of reducing condition, Glutathione) ratio and content, or improve the synthesis of antioxidase or plant complexation element (PC that activity such as regulates the expression of plant complexation element synzyme (PCS, phytochelatin synthetase) and increasesn) ratio or content.
GSH is glutamic acid (Glu), cysteine (Cys), the tripeptides that glycine (Gly) forms, and it is divided into oxidized form (GSSG) and reduced form (GSH).Usually said glutathion is reduced form, and it is very important antioxidant in animal and plant body.Under heavy metal, salt etc. stimulate, PCS is under the conditions of being independent of ATP, the N-end of a GSH molecule can be catalyzed occur α-amido bond to be connected with the C-end of the γ-Glu-Cys part of another GSH molecule and form (γ-GluCys) 2-Gly, generate a Gly molecule simultaneously.Other GSH of connection can be catalyzed successively and form PCn+1And Gly.PCn+1For plant complexation element, it can be in conjunction with contents of many kinds of heavy metal ion (such as Cd2+), in conjunction with the activity of product feedback suppression PCS.
The resistant to lodging of plant can be obtained now by breeding technique, disease-resistant, the character such as pest-resistant, but the character aspect that plant resists the oxidative stress ability in multiple adverse circumstance need to improve.
The method being usually used in screening and cultivation New Crop Varieties has: conventional cross-breeding technology, induced-mutation technique, molecular marking technique, these breeding techniques are respectively present breeding time length, need abundant experience in breeding, screening operation amount is big, have radiation hazradial bundle, need to build library, and technology requires height.
Summary of the invention
It is an object of the invention to provide a kind of lycium plant complexation element synzyme.
Second object of the present invention is to provide lycium plant complexation element synthetase-coding gene.
Third object of the present invention is to provide recombinant vector, expression vector and the recombinant bacterium containing lycium plant complexation element synthetase-coding gene.
Fourth object of the present invention is to provide lycium plant complexation element synthetase-coding gene and is preparing the application of transgenic plant.
Technical scheme is summarized as follows:
A kind of lycium plant complexation element synzyme, is the aminoacid sequence shown in SEQ ID NO.1.
Lycium plant complexation element synthetase-coding gene, is the deoxynucleotide sequence shown in SEQ ID NO.2.
Recombinant vector, expression vector and recombinant bacterium containing lycium plant complexation element synthetase-coding gene.
Lycium plant complexation element synthetase-coding gene is preparing the application of transgenic plant, is to be imported in purpose plant by lycium plant complexation element synthetase-coding gene, transgenic plant that is that obtain resistance to high NaCl environment stress and that tolerate cadmium ion.
The described preferred corn and soybean of purpose plant, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, Rhizoma Solani tuber osi, Fructus Hordei Vulgaris, Semen Tritici aestivi, Cotton Gossypii, Chinese rose, Lisianthus, Bulbus Lilii, An Zuhua, iris, Euonymus japonicus, Populus euphratica or fragrant flower Chinese scholar tree.
Advantages of the present invention: the lycium plant complexation element synthetase-coding gene of the present invention imports in purpose plant, obtains tolerating the transgenic plant that cadmium ion ability is high and salt resistance ability is high.
Accompanying drawing explanation
Fig. 1 .P1, P2 primer is with the PCR primer electrophoretogram of Fructus Lycii cDNA amplification Lc PCS.
Fig. 2 .pMD18T-Lc PCS converts colibacillus PCR proof diagram.
Fig. 3 .pMD18-T-Lc PCS carrier schematic diagram.
The escherichia coli of Fig. 4 .pET-28a-Lc PCS vector and the PCR primer electrophoretogram of pET-28a-Lc PCS plasmid.
Fig. 5 pET28a-Lc PCS electrophoretogram of expressing protein in e. coli bl21.
Fig. 6 .pCAMBIA2300-Lc PCS carrier digestion verification electrophoretogram.
Fig. 7 .pCAMBIA2300-Lc PCS carrier schematic diagram.
Fig. 8. turn LcPCS genetic tobacco genome and pCAMBIA2300-LcPCS plasmid PCR product electrophoretogram.
Fig. 9. turn LcPCS gene corn, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, Rhizoma Solani tuber osi, Cotton Gossypii, Fructus Hordei Vulgaris, Wheat volatiles PCR primer electrophoretogram.
Figure 10. turn LcPCS gene Chinese rose, Lisianthus, Bulbus Lilii, An Zuhua, iris genome and pCAMBIA2300-LcPCS plasmid PCR product electrophoretogram.
Figure 11. turn LcPCS gene Euonymus japonicus, Populus euphratica, fragrant flower Chinese scholar tree genome and pCAMBIA2300-LcPCS plasmid PCR product electrophoretogram.
Detailed description of the invention
Below by specific embodiment, the present invention is further illustrated.
Embodiment 1
The clone of lycium plant complexation element synzyme Lc PCS gene
Utilize Trizol reagent, total serum IgE is extracted from fresh Fructus Lycii (China Fructus Lycii) blade of 100mg, use Transgentransecript one-step gDNA removal and cDNA synthesis supermix test kit, with Fructus Lycii total serum IgE as template, OligodT18For primer, under the effect of AMV reverse transcriptase, synthesize cDNA the 1st chain.
Downstream primer P2:5 ' CTAAAAGGGAGGT GCAGTCA 3 ' shown in the forward primer P1:5 ' ATGGCGATGGCGGGTT 3 ' and SEQ ID NO.4 shown in Unigene sequential design SEQ ID NO.3 according to Fructus Lycii transcript profile data base obtains PCR primer (see Fig. 1 .) by touchdown PCR (TD-PCR), then utilize Tian Gen company common DNA product purification kit that PCR product is purified, obtain the Lc PCS PCR fragment of purification, operate according to test kit description.
PCR primer sequence is verified, it is thus achieved that a length of 1506bp sequence.With the PCS deoxynucleotide sequence comparison of other species, it is the discovery that ORF (the open reading frame) sequence of LcPCS.Its protein sequence is predicted, as shown in SEQ ID NO.1 in the ORF Finder website of NCBI.Its deoxynucleotide sequence is as shown in SEQ ID NO.2.
Embodiment 2
The building process of recombinant vector pMD18-T-Lc PCS
Lc PCS gene shown in sequence table SEQ ID NO.2 is connected with pMD18-T carrier,
Reaction condition: 16 DEG C, 30min.Connect product Transformed E .Coli.Top10.Select white colony, bacterium colony PCR method confirms the length scale of Insert Fragment in carrier T, such as Fig. 2, consistent with expection, this carrier is sent to the order-checking of Hua Da genome company, we have obtained this gene deoxynucleotide sequence of 1506bp, blast is carried out at NCBI, with Fructus Lycopersici esculenti, the homology such as Rhizoma Solani tuber osi is high, is shown to be this gene and clones successfully.Lc PCS deoxynucleotide sequence and pMD18-T sequence assembly are assembled into cloning vehicle pMD18-T-Lc PCS, as shown in Figure 3.
Embodiment 3
The building process of escherichia coli RT-PCR expression vector pET28a-Lc PCS
First with pMD18-T-Lc PCS plasmid as template, the P3 (CGC shown in SEQ ID NO.5GGATCCATGGCGATGGCGGGTT), the P4 (ACGC shown in SEQ ID NO.6GTCGACCTA AAAGGGAGGTGCAGTCA) it is respectively upstream and downstream primer, expand Lc PCS gene.Its reaction condition is: 94 DEG C, 4min；(94 DEG C, 30Sec；56 DEG C, 30Sec；72 DEG C, l min50Sec) 32cycles；72 DEG C, 8min.BamHI restriction enzyme site (GGATCC) is had in P3, SalI restriction enzyme site (GTCGAC) is had in P4, then PCR primer and pET28a empty carrier plasmid are respectively with BamHI and SalI double digestion, the digestion products of the two is connected, connect product Transformed E .Coli DH5 α, coat on the LB flat board containing 200mg/L kana resistance, 37 DEG C of cultivations.After 12h, picking list bacterium colony carries out bacterium colony PCR checking, such as Fig. 4, by bacterium positive for bacterium colony PCR checking, shakes bacterium and extracts plasmid, and enzyme action is identified and obtained purpose band, finally send the order-checking of Hua Da gene sequencing company, and it is correct that result shows that carrier pET28a-Lc PCS builds.
The prokaryotic expression carrier pET28a-Lc PCS built is converted e. coli bl21.Carry out protein expression checking, obtain the Lc PCS expressing protein of expection size (55.64KD), such as Fig. 5. shown.Be followed successively by tropina after pET28a empty carrier bacterium does not induces tropina, the induction of pET28a empty carrier bacterium from left to right, pET28a-Lc PCS expression vector bacterium does not induces tropina, pET28a-Lc PCS expression vector bacterium induction tropina, the Lc PCS tropina of purification.
Embodiment 4
Microorganism, the structure of plant eukaryotic recombinant expression carrier pCAMBIA2300-Lc PCS
First with pMD18-T-Lc PCS plasmid as template, P3, P4 are respectively upstream and downstream primer, expand Lc PCS gene, and its reaction condition is: 94 DEG C, 4min；(94 DEG C, 30Sec；56 DEG C, 30Sec；72 DEG C, l min50Sec) 32cycles；72 DEG C, 8min.BamHI restriction enzyme site (GGATCC) is had in P3, SalI restriction enzyme site (GTCGAC) is had in P4, then PCR primer and pCAMBIA2300 empty carrier plasmid are respectively with BamHI and SalI double digestion, the digestion products of the two is connected, connect product Transformed E .Coli DH5 α, coat on the LB flat board containing 100mg/L concentration kana resistance.37 DEG C of cultivations, after 12h, picking list bacterium colony carries out bacterium colony PCR checking, by bacterium positive for bacterium colony PCR checking, shake bacterium and extract plasmid, enzyme action is identified and is obtained purpose band, such as Fig. 6 (being followed successively by pCAMBIA2300-Lc PCS carrier, pCAMBIA2300-Lc PCS digestion products from left to right), finally sending the order-checking of Hua Da gene sequencing company, it is correct that result shows that carrier pCAMBIA2300-Lc PCS builds.As shown in Figure 7.
Embodiment 5
Structure for the Agrobacterium engineering strain C58:pCAMBIA2300-Lc PCS of plant transgene.
Prepared by Agrobacterium competent cell
1. by mono-for Agrobacterium C58 colony inoculation in 5mLYEP fluid medium, 28 DEG C, 180r/min shaken cultivation 36h.
2. above-mentioned bacterium solution 2ml is proceeded in l00mLYEP fluid medium, 28 DEG C, 180r/min, shaken cultivation to (OD600Value is about 0.4-0.5).
3., after ice bath 30min, 4 DEG C, 5000r/min is centrifuged l0min, collects thalline, is resuspended in the ddH of 20mL pre-cooling2In O.
4.4 DEG C, 5000r/min is centrifuged 10min, collects thalline, is resuspended in 15% glycerol of pre-cooling, often after pipe 200 μ L liquid nitrogen flash freezer, be stored in immediately-80 DEG C standby.
Plant expression vector electroporated
1. the C58 competent cell that-80 DEG C are taken out is placed on ice so that it is slowly melt；
2. add 2-5 μ L pCAMBIA 2300-Lc PCS plasmid, mixing, ice bath 5min；
3. it is transferred in the electric shock cup of pre-cooling；
4. electroporated instrument parameter is set: 1500V, 5-6ms, electroporated；
5. room temperature stands and adds 500 μ LYEP fluid mediums after 2min, 28 DEG C, 180r/min shaken cultivation 3-4h；
6. room temperature 4000r/min is centrifuged 10min, sucking-off 400 μ L of supernatant liquid, remaining bacterium solution is mixed, coats on the YEP flat board containing 100mg/L kanamycin and 100mg/L rifampicin resistance, is inverted flat board, 28 DEG C of cultivations, 36-48h, until seeing single bacterium colony clearly.
7. picking list bacterium colony, bacterium colony PCR verifies.
Embodiment 6
Agriculture bacillus mediated Nicotiana tabacum L. genetic transformation
The aseptic culture of tobacco seedling: select full, healthy tobacco seed, with containing 25%NaOCl (effective chlorine >=10%) 20ml, the aqueous solution of concentrated hydrochloric acid 4ml, suffocating sterilization 1.5h, seed is placed in MS culture medium, 16h/8h light dark cycles, 25 ± 1 DEG C of cultivations.
The culture medium that this experiment is used is as shown in the table
The Agrobacterium-mediated Transformation of Nicotiana tabacum L.
Infect the preparation of bacterium solution
1. picking positive Agrobacterium list bacterium colony, is inoculated in the 5ml YEP fluid medium containing 100mg/L kanamycin and 100mg/L rifampicin, in 28 DEG C, cultivate 24h on the shaking table of 200r/min.
2. next day, take 3ml bacterium solution, be inoculated in the 50mlYEP fluid medium containing 100mg/L kanamycin and 100mg/L rifampicin, when bacterium solution is in vigorous period (OD600=0.4-0.6) time, bacterium solution is poured into 50ml centrifuge tube, at 5000r/min, at 4 DEG C, centrifugal 10min, abandons supernatant, collects thalline.Resuspended with the MS fluid medium of equivalent, make OD600=0.9～1, add the AS (acetosyringone) of final concentration of 100 μm ol/L.
Outer implant is contaminated
1. tobacco leaf is removed master pulse and limb edge, then blade is cut into 0.5cm × 0.5cm size, immerse the Agrobacterium bacterium solution prepared, soaking 15-20min, shake 2-3 time, makes blade be fully contacted bacterium solution therebetween, take out blade, by the sterile water wash containing kanamycin and with the aseptic filter paper unnecessary liquid of exhaustion, blade face down, blade back be inoculated in upward in common training culture medium, about 25 DEG C light culture 2-3 days.
2. being transferred in screening culture medium by blade, within about 20 days, change a subculture, induction of resistance bud produces, and when resistant buds grows to about 1cm from callus, cuts resistant buds from wound healing, is inoculated in resistance seedling rooting culture medium.
Transgenic seedling is transplanted
Root growth is good, vitality is vigorous Nicotiana tabacum L. tissue cultured seedling takes out from tissue culture bottle, culture medium (as far as possible reducing root system damage) is rinsed with tap water, it is planted in perlite, in the compost of Vermiculitum and fertile soil (1:2:2), cover film moisturizing, ventilative, at 25 DEG C, cultivate 7-10 days, then open thin film, periodically water, apply fertilizer, and be transferred in greenhouse.
Embodiment 7
Transgene tobacco Molecular Detection and salt-resistance detection
The PCR detection of transgene tobacco genomic DNA: 1.CTAB method extracts T1 for Nicotiana tabacum L. STb gene；2. detecting with genomic DNA for template performing PCR, primer is P1, P2.
Take above-mentioned PCR primer 5 μ l and carry out electrophoresis detection, Fig. 8, illustrate that Lc PCS gene the most successfully proceeds to Nicotiana tabacum L..
At greenhouse normal growth, 5-7cm transgene tobacco Seedling and wild type control Seedling, water the water of NaCl containing 200mmol/L and 400mmol/L concentration respectively, greenhouse keeps the humidity of 85%.Detection finds, under the growth conditions of 200mmol/LNaCl, WT lines growth phase is to slowly, Biomass is relatively fewer, and blade is the most yellow, and transgene tobacco can normal growth, Biomass is big, and blade is greener, it is possible to blossom and bear fruit, under conditions of the NaCl of 400mmol/L concentration, after growing one week, wild-type tobacco yellow leaf, wilt, tissue necrosis, it is impossible to normal growth.Although the growth of transgene tobacco is also by a certain degree of suppression, but obvious unlike wild-type tobacco, substantially can normal growth.
At greenhouse normal growth, choose 4 weeks big, grow consistent transgene tobacco Seedling and wild type control Seedling, cultivate respectively containing 300 μm ol/L and the CdCl of 500 μm ol/L concentration21/10hoagland nutritional solution in, in greenhouse keep 85% humidity.After 4 weeks, detection finds: 300 μm ol/L process group transgene tobacco cross phase true leaves turn yellow, but top is bud green, and root system compared with normal plant is short and thick, but can grow, but non-transgenic tobacco blade and stem all turn yellow, and root system is the shortest, and plant is downgraded serious, withered；500 μm ol/L process groups, transgenic group tobacco growing is suppressed, yellow leaf, and root system is short and thick, and color browning is yellow.
Embodiment 8
By seed embryo growing point Wicresoft brush infestation method (Rong Fei, Wang Gang, Ji Jing, Deng. utilize " Wicresoft's brush " method to obtain resistance glyphosate genetically engineered soybean [J]. Soybean Science, 2015, 34 (2) .) to Semen Maydis, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, Rhizoma Solani tuber osi, Fructus Hordei Vulgaris, Semen Tritici aestivi, the crop maturity embryo transgenic (Lc PCS) such as Cotton Gossypii, it is successfully obtained transgenic corns, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, Rhizoma Solani tuber osi, Cotton Gossypii, Fructus Hordei Vulgaris, wheat plant, Genomic PCR electrophoretogram such as Fig. 9, it is followed successively by Semen Maydis from left to right, Semen sojae atricolor, Oryza sativa L., Semen arachidis hypogaeae, Helianthi, Rhizoma Solani tuber osi, Cotton Gossypii, Fructus Hordei Vulgaris, Wheat volatiles and the PCR primer of plasmid pCAMBIA2300-LcPCS.
At greenhouse normal growth, 5-7 true leaf transgenic seedlings and wild type control Seedling, water the water of NaCl containing 200mmol/L and 400mmol/L concentration respectively, greenhouse keeps the humidity of 85%.Detection finds, under the growth conditions of 200mmol/LNaCl, WT lines growth phase is to slowly, Biomass is relatively fewer, and blade is the most yellow, and transgenic seedlings can normal growth, Biomass is big, and blade is greener, it is possible to blossom and bear fruit, under conditions of the NaCl of 400mmol/L concentration, after growing one week, wild type seedlings yellow leaf, wilt, tissue necrosis, it is impossible to normal growth.Although the growth of transgenic seedlings is also by a certain degree of suppression, but obvious unlike wild type seedlings, substantially can normal growth.
At greenhouse normal growth, choose 4 weeks big, grow consistent transgenic plant and wild type control Seedling, cultivate respectively containing 300 μm ol/L and the CdCl of 500 μm ol/L concentration21/10hoagland nutritional solution in, in greenhouse keep 85% humidity.After 4 weeks, detection finds: 300 μm ol/L process group transgenic plant cross phase true leaves turn yellow, but top is bud green, and root system compared with normal plant is short and thick, but can grow, but non-transgenic plant blade and stem all turn yellow, and root system is the shortest, and plant is downgraded serious, withered；500 μm ol/L process groups, growth of transgenic plants is suppressed, yellow leaf, and root system is short and thick, and color browning is yellow.
Embodiment 9
Utilize Agrobacterium infestation method that the flowers such as Chinese rose, Lisianthus, Bulbus Lilii, iris are carried out axillalry bud or stem scale Wicresoft's method transgenic (Lc PCS), obtain transgenic Chinese rose, Lisianthus, An Zuhua, Phalaenopsis plants, Genomic PCR electrophoretogram such as Figure 10, is followed successively by Chinese rose, Lisianthus, Bulbus Lilii, iris genome and the PCR primer of plasmid pCAMBIA2300-LcPCS from left to right.
At greenhouse normal growth, 5-7cm transgenic seedlings and wild type control Seedling, water the water of NaCl containing 200mmol/L and 400mmol/L concentration respectively, greenhouse keeps the humidity of 85%.Detection finds, under the growth conditions of 200mmol/LNaCl, WT lines growth phase is to slowly, blade is the most yellow, it is impossible to normally bloom, and transgenic seedlings can normal growth, blade is greener, can bloom, under conditions of the NaCl of 400mmol/L concentration, after growing one week, wild type seedlings yellow leaf, wilt, tissue necrosis, it is impossible to normal growth.Although the growth of transgenic seedlings is also by a certain degree of suppression, but obvious unlike wild type seedlings, substantially can bloom by normal growth.
At greenhouse normal growth, choose 4 weeks big, grow consistent transgene tobacco Seedling and wild type control Seedling, cultivate respectively containing 300 μm ol/L and the CdCl of 500 μm ol/L concentration21/10hoagland nutritional solution in, in greenhouse keep 85% humidity.After 4 weeks, detection finds: 300 μm ol/L process group transgenic plant cross phase true leaves turn yellow, but top is bud green, and root system compared with normal plant is short and thick, but can grow, but non-transgenic plant blade and stem all turn yellow, and root system is the shortest, and plant is downgraded serious, withered；500 μm ol/L process groups, transgenic group plant growing is suppressed, yellow leaf, and root system is short and thick, and color browning is yellow.
Embodiment 10
Utilize Agrobacterium infestation method that the arbor trees such as Euonymus japonicus, Populus euphratica, fragrant flower Chinese scholar tree are carried out transgenic (Lc PCS), obtain transgenic Euonymus japonicus, Populus euphratica, fragrant flower Chinese scholar tree plant, Genomic PCR electrophoretogram such as Figure 11, is followed successively by Euonymus japonicus, Populus euphratica, the genome of fragrant flower Chinese scholar tree and the PCR primer of pCAMBIA2300-LcPCS plasmid from left to right.
At transgenic seedling and the wild type control Seedling of greenhouse normal growth, water the water of NaCl containing 200mmol/L and 400mmol/L concentration respectively, greenhouse keeps the humidity of 85%.Detection finds, under the growth conditions of 200mmol/LNaCl, WT lines growth phase is to slowly, and blade is the most yellow.And transgenic seedling can normal growth, blade is greener.Under conditions of the NaCl of 400mmol/L concentration, after growing one week, wild type seedling leaf turns to be yellow, and wilts, tissue necrosis, it is impossible to normal growth.Although turning the growth of base seedling also by a certain degree of suppression, but obvious unlike wild type seedlings, substantially can normal growth.
At greenhouse normal growth, choose 4 weeks big, grow consistent transgenic seedling and wild type control seedling, cultivate respectively containing 300 μm ol/L and the CdCl of 500 μm ol/L concentration21/10hoagland nutritional solution in, in greenhouse keep 85% humidity.After 4 weeks, detection finds: 300 μm ol/L process group transgenic seedling cross phase true leaves turn yellow, but top is bud green, and root system compared with normal plant is short and thick, but can grow, but non-transgenic seedling blade and stem all turn yellow, and root system is the shortest, and plant is downgraded serious, withered；500 μm ol/L process groups, the growth of transgenic group seedling is suppressed, yellow leaf, and root system is short and thick, and color browning is yellow.
Claims (5)
1. a lycium plant complexation element synzyme, is characterized in that the aminoacid sequence shown in SEQ ID NO.1.
2. lycium plant complexation element synthetase-coding gene, is characterized in that the deoxynucleotide sequence shown in SEQ ID NO.2.
3. contain the recombinant vector of gene described in claim 2, expression vector and recombinant bacterium.
4. lycium plant complexation element synthetase-coding gene is preparing the application of transgenic plant, it is characterized in that claim 2
In described channel genes purpose plant, transgenic plant that is that obtain resistance to high NaCl environment stress and that tolerate cadmium ion.
Application the most according to claim 4, it is characterised in that described purpose plant be corn and soybean, Oryza sativa L., Semen arachidis hypogaeae,
Helianthi, Rhizoma Solani tuber osi, Fructus Hordei Vulgaris, Semen Tritici aestivi, Cotton Gossypii, Chinese rose, Lisianthus, Bulbus Lilii, An Zuhua, iris, Euonymus japonicus,
Populus euphratica or fragrant flower Chinese scholar tree.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610223742.XA CN105754965A (en) | 2016-04-08 | 2016-04-08 | Wlofberry phytochelatin synthetase as well as coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610223742.XA CN105754965A (en) | 2016-04-08 | 2016-04-08 | Wlofberry phytochelatin synthetase as well as coding gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105754965A true CN105754965A (en) | 2016-07-13 |
Family
ID=56334694
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610223742.XA Pending CN105754965A (en) | 2016-04-08 | 2016-04-08 | Wlofberry phytochelatin synthetase as well as coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105754965A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371060A (en) * | 2018-11-27 | 2019-02-22 | 金陵科技学院 | A kind of quick transgene method of spindle tree |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110126312A1 (en) * | 2007-10-24 | 2011-05-26 | Juan Pedro Navarro Avino | Method for improving salinity tolerance |
-
2016
- 2016-04-08 CN CN201610223742.XA patent/CN105754965A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110126312A1 (en) * | 2007-10-24 | 2011-05-26 | Juan Pedro Navarro Avino | Method for improving salinity tolerance |
Non-Patent Citations (2)
| Title |
|---|
| 贾翠翠等: "过表达谷胱甘肽合成酶基因增强烟草对镉的耐受性", 《中国生物工程杂志》 * |
| 赵翠珠: "芦苇抗重金属基因的克隆和功能鉴定", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371060A (en) * | 2018-11-27 | 2019-02-22 | 金陵科技学院 | A kind of quick transgene method of spindle tree |
| CN109371060B (en) * | 2018-11-27 | 2021-09-14 | 金陵科技学院 | Method for rapid transgenosis of euonymus persicifera |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20060225154A1 (en) | Method for increasing expression of stress defense genes | |
| CN101743314A (en) | Transgenic plants with increased stress tolerance and yield | |
| CN106636025B (en) | A kind of rice EPSP S mutant and its encoding gene and application | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN113604480B (en) | Corn transcription factor ZmHsf28 and application thereof | |
| CN109608530B (en) | Soybean low-phosphorus response gene for promoting lateral root formation, protein and application thereof | |
| CN113388017B (en) | Drought-resistant protein and application of coding gene thereof in cultivating drought-resistant plants | |
| CN101809155A (en) | Transgenic plants with increased stress tolerance and yield | |
| CN106591324B (en) | Millet SiASR4 gene and application | |
| CN116426496B (en) | Application of alfalfa IPT gene in regulation and control of plant drought tolerance | |
| CN115807006B (en) | Application of gene segment B in cultivation of new plant material | |
| CN105734024A (en) | Wolfberry glutamyl cysteine synthetase and encoding gene and application | |
| CN105754965A (en) | Wlofberry phytochelatin synthetase as well as coding gene and application thereof | |
| CN113583100B (en) | Apple ion transporter MdCCX2, and transgenic plant and application thereof | |
| CN115058433B (en) | Tobacco leaf yellowing regulatory gene NtMYB2, protein and application thereof | |
| CN112063597B (en) | Maize multi-copper oxidase coding gene ZmDEK559-2 and application thereof | |
| CN103320450A (en) | Blade ageing and stress resistance related gene and application thereof | |
| CN110184253B (en) | Application of CiCPK32 gene of caragana intermedia in regulation and control of plant stress resistance | |
| CN105255914A (en) | Lycium barbarum mitogen activated protein kinase kinase and application in improving saline-alkaline tolerance of plant | |
| CN102559699A (en) | CsCoL1 gene relative to cymbidium sinense photoperiod and application of CsCoL1 gene | |
| CN116640799B (en) | Application of medicago sativa MtMET1 gene in regulation and control of plant stress tolerance | |
| CN116003551B (en) | Application of gene segment A in cultivation of new plant material | |
| CN109810984A (en) | A kind of relevant Sesame SiGolS6 of drought resisting and its application | |
| CN105734026A (en) | Wolfberry glutathione reductase and encoding gene and application | |
| CN113913441B (en) | Application of rice nascent polypeptide binding complex alpha subunit NACA gene in osmotic stress resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160713 |