CN104962567A - Recombinant virus-like particle of human papilloma virus type 6 and preparation method thereof - Google Patents
Recombinant virus-like particle of human papilloma virus type 6 and preparation method thereof Download PDFInfo
- Publication number
- CN104962567A CN104962567A CN201410685769.1A CN201410685769A CN104962567A CN 104962567 A CN104962567 A CN 104962567A CN 201410685769 A CN201410685769 A CN 201410685769A CN 104962567 A CN104962567 A CN 104962567A
- Authority
- CN
- China
- Prior art keywords
- hpv6
- protein
- leu
- gly
- pentamer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a recombinant virus-like particle of human papilloma virus type 6 and a preparation method thereof. Specifically, the invention discloses a novel polynucleotide gene segment coding recombinant HPV6 L1 protein, a vector containing the gene segment, a host cell containing the vector, HPV6 L1 fusion protein translated and expressed by the gene segment, pentamer and VLP composed of the pentamer; the invention also discloses application of the pentamer, VLP protein and a vaccine composition composed of the pentamer and the VLP protein in preparation of drugs used for preventing HPV6 infection.
Description
Technical field
The present invention relates to human papillomavirus
virus-like particleand preparation method thereof.More specifically, the present invention relates to a kind of pentamer and virus-like particle (Virus-like Particle, VLP) and preparation method thereof of human mammilla tumor virus L 1 albumen of restructuring, and containing being somebody's turn to do
virus-like particlethe application of vaccine composition in prevention of human papillomavirus infection.
Background technology
Human papillomavirus (Human Papillomavirus is called for short HPV), mainly through human body close contact, as the virus spread through sex intercourse, can cause the multiple proliferative epithelial lesion of the mankind, comprise papilloma (wart) and tumor-like lesion.Specifically, the disease that HPV brings out mainly comprises 3 large classes, the 1st class: the malignant changes such as the cancer of uterine neck, vagina, female vulva, penis and anus and the tumor of head and neck of some type.The cervical cancer patient of 100% is all that HPV infects and causes, the anus cancer of 90%, and the vulva of 40%, vagina and penis, the oropharynx of 12% and the mouth cancers of 3% infect owing to HPV.2nd class: benign lesion, as the Genital warts such as verruca plana, pointed condyloma, is a kind of sexually transmitted disease (STD), very common in the crowd that sexual behaviour is active.Although Genital warts can not cause serious consequence as cancer; but the clinical symptom that pathology can cause patient comparatively painful is usually as cusalgia, hemorrhage and pain; produce embarrassment, anxiety simultaneously and to feel oneself inferior etc. negative and psychoreaction, and the process of repeatedly treating wastes a large amount of medical resources.Worldwide estimate that the Genital warts caused by non-carcinogenic HPV (mainly 6 and 11 types) has 3,000 ten thousand, wherein 20 ~ 50% pathology in also include the polyinfection of high-risk HPV.3rd class: HPV infects can also cause recurrent respiratory papilloma (RRP), this be a kind of rare, there is potential fatefulue disease, mainly occur in adolescence, sometimes, a large amount of papillomas can cause has difficulty in breathing and causes less age death of child.So prevention or treatment HPV infect very great to human health meaning.
HPV is the double-stranded DNA virus without cyst membrane, primarily of virus coat and genomic dna composition (Bernard, Burk et al. 2011).HPV virus coat is by 360 L1 protein (forming 72 pentamers) and the icosahedral structure of virus that forms of 72 L2 protein at the most, diameter 55 ~ 60 nm (Howley and Lowy 2007).Virus capsid protein matter has self-assembly characteristic, L1 protein separately or form viral all particles (Virus-like Particle with L2 protein co-assemble in vitro, VLP) (Chen, Garcea et al. 2000, Finnen, Erickson et al. 2003, Buck, Cheng et al. 2008, Wang and Roden 2013).
Because HPV can not cell cultures in vitro, the specific antigens of this virus be obtained, recombinant vaccine can only be prepared by the method for recombinant DNA technology.The virus-like particle VLPs that restructuring Ll or L1/L2 assembling is formed, virus-free DNA, security is good, have with natural viral Particle Phase like epitope, neutralizing antibody IgG and IgA can be produced after stimulating body, therefore HPV VLPs can be used as preventative vaccine, thus greatly reduces the possibility (Howley and Lowy 2007) causing producing related neoplasms because infecting HPV.
The key of HPV vaccine development to prepare high purity, stable HPV antigen in a large number.In HPV vaccine antigen technology of preparing, the expression system of production HPV antigen comparatively conventional at present can be divided into eukaryotic expression system and prokaryotic expression system.Conventional eukaryotic expression system has pox viruses express system, insect baculovirus expression system, yeast expression system.The formation VLP that HPV L1 energy expressed in eukaryotic expression system is spontaneous, often only need carry out simple purifying can obtain VLP.But because the expression amount of eukaryotic expression system is low, toxigenic capacity is high, brings extreme difficulties to large-scale industrial production.Utilize escherichia expression system to express HPV L1 protein in prokaryotic expression system to have been reported.But the HPV L1 protein solubility expressed by intestinal bacteria is low, purification process known at present obtains HPV VLP by the steps such as salt-free precipitation or sex change renaturation final purifying from the numerous and diverse enchylema of kinds of protein mostly.Such as: open by procaryotic cell expression and the polymeric method of preparation HPV L1 in patent CN02129070.9, wherein purifying process comprises by 3.3M Urea treatment and dialysis renaturation process; Also be by urea-denatured process to the purification process of L1-GST fused protein in WO-0204007 patent and carry out dialysis renaturation; Also there is open L1 protein purification method to be comprise phosphoric acid buffer ultrafiltration dialysis and centrifugal in the prior art, make target protein precipitate the step of redissolving again.But in these purge processes, protein losses amount is large, and yield is low, is difficult to apply in scale operation.
In the homogeneity of HPV vaccine antigen protein matter VLP, the grain size dispersity of the HPV L1 VLP assembled in prior art has use polyd value to represent, polyd value <15% illustrates that particle has good homogeneity, illustrate between 15% to 30% that particle has larger unhomogeneity, be greater than 30% explanation particle homogeneous completely not.The HPV L1 VLP prepared in prior art is much in 15%.Another illustrates that the index of uniform particle diameter is PdI value, and PdI value is size distribution coefficient, is less than 0.05 for highly homogeneous sample; 0.05 ~ 0.1 is as the criterion homogeneous sample, and 0.1 ~ 0.3 is the poor sample of homogeneity, is greater than 0.3 for inhomogenous sample.The PdI disclosing the mixed protein liquid of two type HPV L1 VLP in US7205125B2 patent is 0.07.
Therefore, this area still need that cost is low, purity is high, output is high, the novel method of stay-in-grade HPV L1 protein production technology and large-scale industrial production restructuring HPV L1 VLP.
Summary of the invention
The object of the invention is the nucleotide sequence of the coding HPV6 L1 protein of openly a kind of optimization, comprise the carrier of this nucleotide sequence, comprise the host cell of carrier, and by the HPV L1 protein of this polynucleotide sequence accurate translation, Tag-HPV-L1 recombinant protein, the pentamer formed by this L1 protein and VLP, and the vaccine infected as the prevention HPV that antigen forms by this pentamer and VLP.
first aspect present invention provides a kind of gene through codon optimized HPV6 L1, its nucleotides sequence is classified as SEQ NO:2.
second aspect present invention provides a kind of expression vector of structure,it comprises the gene through codon optimized HPV6 L1 of first aspect present invention.Described carrier is applicable to driving allogeneic dna sequence DNA accurate translation HPV L1 protein in bacterium.In one embodiment, described expression vector preferred pGEX-6p-1, pGEX-4T-2, pMAL or pET28a.
a third aspect of the present invention provides a kind of engineering bacteria cell of structure,this cell comprises the gene of first aspect present invention, or the expression vector of second aspect.Described engineering bacteria host cell is intestinal bacteria, in one embodiment, and the preferred BL21 cell strain of described host cell.
fourth aspect present invention provides a kind of Tag-HPV6 L1 fusion rotein,wherein label Tag is 6*His.Tag, GST.Tag, SUMO.Tag, MBP.Tag, 6*His-SUMO.Tag or GST-SUMO.Tag; L1 is that HPV6 L1 full length protein and/or C hold brachymemma 5,10,15 or no more than 30 amino acid and/or N to hold brachymemma 2,4,6 or no more than 10 amino acid whose L1 protein.
The nucleotides sequence of coding Tag-HPVL1 fusion rotein GST-HPV6 L1 is classified as SEQ NO:3, SEQ NO:11, the nucleotides sequence of GST-SUMO-HPV6 L1 is classified as SEQ NO:4, SEQ NO:12, the nucleotide sequence SEQ NO:5 of MBP, SEQ NO:13, the nucleotides sequence of 6*His-HPV6 L1 is classified as SEQ NO:6, and the nucleotides sequence of 6*His-SUMO-HPV6 L1 is classified as SEQ NO:7.
The aminoacid sequence SEQ NO:10 of the aminoacid sequence of coding Tag-HPVL1 fusion rotein GST-HPV6 L1 to be the aminoacid sequence of SEQ NO:8, GST-SUMO-HPV6 L1 be SEQ NO:9, MBP.
the pentamer of the HPV L1 that fifth aspect present invention provides Tag-HPVL1 fused protein to obtain after purifying, and the VLP assembled by pentamer.hPV6 L1 pentamer albumen median size 10 ~ 15nm PdI<0.1 in a preferred embodiment.Median size 45 ~ 65nm PdI<0.1 of HPV6 L1VLP in a preferred embodiment.
sixth aspect present invention provides a kind of vaccine composition,it comprises the pentamer of HPV L1 of the present invention or the VLP of HPV L1, comprises pharmaceutically useful vehicle and medicinal adjuvant further in described composition.
Absorption preparation will be carried out with aluminum hydroxide adjuvant normal saline solution according to albumen and aluminium content 1:10 ratio respectively containing HPV6 L1 pentamer or VLP albumen stoste (preparing gained according to aforesaid method) in one embodiment and can obtain recombinate HPV L1 protein pentamer or VLP vaccine, stand-by 4 DEG C of preservations.
on the other hand, the present invention also provides a kind of method obtaining Tag-HPVL1 fusion rotein, comprises the steps:
A. by replacing the codon of the translation same protein of HPV6 L1 gene order with the codon of intestinal bacteria preference, the gene of the codon optimized HPV6 L1 of escherichia expression system preference is obtained;
B. the coli expression carrier of HPV6 L1 gene is built;
C. the escherichia coli expression engineering strain of Tag-HPV6 L1 is built;
D. abduction delivering purifying obtains fusion rotein Tag-HPV6 L1.
Above-mentionedly prepare prokaryotic host cell in fusion rotein Tag-HPV6 L1 method and be selected from but be not limited to GI698, ER2566, BL21 (DE3), XA90, B834 (DE3), BLR (DE3).
Above-mentionedly prepare expression condition in fusion rotein Tag-HPV6 L1 method and be: under 20 ~ 37 DEG C of temperature condition, abduction delivering 3 ~ 20 hours.Preferred under 28 DEG C of temperature condition in a specific embodiment, abduction delivering 16 hours.
the present invention also provides a kind of method obtaining HPV6 L1 pentamer, comprises the steps:
A) with affinity chromatography method absorption fusion rotein Tag-HPV6 L1;
B) add proteolytic enzyme excision Tag label, obtain HPV6 L1 pentamer protein;
C) purifying HPVL1 pentamer protein, obtain purity >98%, the L1 pentamer protein of median size 10 ~ 15nm PdI<0.1.
Be the site-specific proteolytic enzyme of excision Tag label for proteolytic enzyme described in above-mentioned preparation HPV6 L1 pentamer method: restructuring HRV 3CP, zymoplasm, SUMO proteolytic enzyme, SENP1 or TEV protease.
In above-mentioned preparation HPV6 L1 pentamer method, purification process is selected from but is not limited to ion exchange chromatography, hydrophobic chromatography method, molecular sieve (or claiming gel-filtration or size-exclusion) chromatography; Preferably purifying comprises ion exchange chromatography and molecular sieve chromatography.
In above-mentioned preparation HPV6 L1 pentamer method, purification process also comprises use reductive agent, such as, add DTT.
HPV6 L1 pentamer albumen median size 10 ~ 15nm PdI<0.1 is obtained after final purifying in above-mentioned preparation HPV6 L1 pentamer method.
present invention also offers a kind of method that HPV6 L1 pentamer is assembled into VLP, comprise the steps:
The L1 pentamer protein liquid of median size 10 ~ 15nm PdI<0.1 is mixed with assembling damping fluid, final acquisition pH value is 5.0 ~ 5.9, salt concn is 500 ~ 2000 mM, the HPV6 L1 VLP protein liquid of median size 45 ~ 65nm PdI<0.1, preferred acquisition pH value is 5.7, and salt concn is the HPV6 L1 VLP protein liquid of 1300 mM.
Assembling damping fluid includes but not limited to Tris damping fluid, phosphate buffered saline buffer, acetate buffer solution, HEPES damping fluid, MOPS damping fluid, citrate buffer, histidine buffering liquid, borate buffer etc.
Above-mentioned HPV6 L1 pentamer is assembled in the method for VLP can also add protective material in HPV6 L1-VLP protein liquid, such as: 0.01 ~ 0.1 Polysorbate 80.
present invention also offers the method-cryogenic freezing process construction from part of another kind of assembling VLP, comprise the steps:
HPV L1 pentamer protein liquid is placed in pH value is 5.5 ~ 8.0 salt concn is damping fluid under 150 ~ 1000 mM conditions, completely freezing under-20 ~-80 DEG C of conditions, preferably after freezing 24 hours, place room temperature again to melt to protein stoste, obtain the HPV6 L1VLP protein liquid of median size 45 ~ 65nm PdI<0.1.
on the other hand, present invention also offers the pentamer of HPV L1, VLP and comprise the vaccine of pentamer or VLPthe application of composition in the medicine of preparation prevention HPV infection.
According to the present invention, vaccine of the present invention can adopt the acceptable form of patient, includes but not limited to that injection or nasal cavity or oral cavity suck or vagina administration, optimizing injection and intramuscularly.
the explanation of relational language and explanation in the present invention
According to the present invention, term " escherichia expression system " refers to and is made up of intestinal bacteria (bacterial strain) and carrier, wherein intestinal bacteria (bacterial strain) derive from available on the market, illustrate at this but be not limited to: GI698, ER2566, BL21 (DE3), XA90, DH (5a), B834 (DE3), BLR (DE3).
According to the present invention, term " carrier " word refers to and the polynucleotide of certain coded protein can be inserted wherein and make protein obtain a kind of nucleic acid launch vehicle of expressing.Carrier can by transforming, and transduction or transfection host cell, the genetic material element making it carry obtains expression in host cell.For example, carrier comprises: plasmid; Phage; Coemid etc.
According to the present invention, " vaccine vehicle or carrier " refer to and are selected from one or more, include but not limited to: pH adjusting agent, tensio-active agent, adjuvant, ionic strength toughener term.Such as, pH adjusting agent is illustrated but is not limited to phosphate buffered saline buffer, and tensio-active agent comprises positively charged ion, negatively charged ion or nonionic surface active agent.Illustrate but be not limited to: Polysorbate 80.Adjuvant is illustrated but is not limited to aluminium hydroxide, aluminum phosphate, Fu Shi Freund's complete adjuvant, Fu Shi Freund's incomplete adjuvant etc.Ionic strength toughener is illustrated but is not limited to sodium-chlor.
According to the present invention, term " chromatogram " includes but not limited to: ion-exchange chromatography (such as cation-exchange chromatography, anion-exchange chromatography), hydrophobic interaction chromatograph, adsorption chromatography chromatography (such as hydroxylapatite chromatography), molecular sieve chromatography chromatography (gel-filtration or molecular exclusion chromatography), affinity chromatography method.
According to the present invention, in the restructuring HPV L1 method of protein that the present invention obtains, damping fluid refers to a kind of solution that greatly can reduce pH amplitude of fluctuation when adding a small amount of acid or alkali and water, include but not limited to Tris damping fluid, phosphate buffered saline buffer, acetate buffer solution, HEPES damping fluid, MOPS damping fluid, citrate buffer, histidine buffering liquid, borate buffer etc.
According to the present invention, described cytoclasis include but not limited to broken by homogenizer, clarifixator is broken, ultrasonication, grinding, high-pressure extrusion, in N,O-Diacetylmuramidase process one or multinomial method realize;
According to the present invention, in the restructuring HPV L1 method of protein that the present invention obtains, salt used includes but not limited to it is neutral salt, particularly an alkali metal salt, ammonium salt, hydrochloride, vitriol, supercarbonate, one or more in phosphoric acid salt or hydrophosphate, particularly NaCI, KCl, CaCl2, NH4Cl, KCI, NH4CI, MgSO4, (NH4) 2SO4.Preferred NaCI.Reductive agent used includes but not limited to DTT, 2 mercapto ethanol.Amount used includes but not limited to 2mM ~ lO0mM, preferably 10 ~ 15mM.
Beneficial effect
The invention provides a kind of synthetic gene, this gene order carried out codon optimized nucleotide sequence according to colibacillary codon preference, this sequence encoding HPV L1 protein amino acid sequence.Research finds that the nucleotide sequence of codon optimization is significantly increased relative to the expression amount of the L1 albumen without codon optimized nucleotide sequence.
Escherichia expression system disclosed by the invention have expression amount high, be easy to cultivate and operation and the advantage such as production cost is low.But only use this expression system to be still difficult to directly obtain the HPV L1 albumen of great amount of soluble, its reason is the as easy as rolling off a log formation inclusion body of L1 albumen, i.e. the insoluble polymer of abiology activity.In addition, even if obtain a large amount of inclusion bodys, in order to obtain the albumen of biologic activity, also sex change, renaturation process must be carried out to inclusion body, the albumen of this process often large losses.In order to solve this difficult problem, the present invention adopts integration technology, by L1 gene with have assist protein correctly to fold albumen as glutathione S-transferase (GST), SUMO, MBP, 6*His-SUMO or GST-SUMO etc. carry out amalgamation and expression, not only the solubility of albumen and yield increase, and GST-SUMO-HPVL1, 6*His-SUMO-HPVL1 makes do not have the residual of exogenous amino acid at HPV L1 protein N terminal, find the fusion tag that GST-SUMO wherein expresses as recombinant protein HPV L1 and molecular chaperones simultaneously, there is protease inhibitor hydrolysis, remarkable increase expression of recombinant proteins amount and promotion target protein correctly fold, improve the functions such as solubility.Therefore the technological line that the present invention adopts have employed label protein integration technology when building HPV L1 protein expression vector, the fusion rotein formed by label protein and L1 albumen on the one hand improves the solubility of target protein, improve output, affinity chromatography and proteolytic ferment excision can be utilized to merge the purifying feature that matter stamp methods carries out target protein by GST fusion tag on the other hand, thus achieve single step purification from the cell pyrolysis liquid of broad categories and can obtain the HPV L1 albumen that purity reaches more than 70%, substantially increase purification efficiency, thus improve the output of end product HPV L1 albumen.
Provided by the inventionly first to express, separation and purification to obtain after highly purified HPV L1 pentamer albumen Artificial Control assembling again and form the technological line of VLP, can solve current known technology exist from foreign protein miscellaneous cytoclasis liquid, direct purification VLP purity is low, degraded ratio is high, the problem that yield is low, obtains high purity pentamer assembled in vitro VLP and VLP preservation condition.
In addition, the present inventor have been surprisingly found that a kind of new assembling condition and method: i.e. cryogenic freezing process construction from part.The VLP obtained by the method inhomogenous for the particle diameter assembled before freeze thawing protein (PdI is greater than 0.1) can be become size coincidence theory expection and also homogeneous, the VLP that PdI is less than 0.1, the VLP that contrast prior art obtains is more stable, and different salt concn, pH value range can be stored in widely in damping fluid, the dilution of final vaccine preparation of being more convenient for and preparation.
The present invention, through the HPV L1 VLP protein of gained of recombinating, has good immunogenicity, can the neutralizing antibody for homotype HPV of induced high titers, and HPV is to the infection of human body in prevention, is a kind of good vaccine form.
With reference to as detailed below and
accompanying drawingafter, these and other aspect of the present invention will be obvious.All reference disclosed herein all completely to be quoted as a reference at this.
Accompanying drawing explanation
Fig. 1: GST-HPV6 L1 protein is affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is protein mass marker Lane: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kdat, and left swimming lane is the resin of affine absorption GST-L1, and right swimming lane is the resin of GST and L1 after enzymolysis.
Fig. 2: GST-SUMO-HPV6 L1 protein through affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is for being protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and left swimming lane is the resin of affine absorption GST-SUMO-L1, and right swimming lane is the resin of GST-SUMO and L1 after enzymolysis.
Fig. 3: MBP-HPV6 L1 protein through affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is for being protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and left swimming lane is the resin of affine absorption MBP-L1, and right swimming lane is the resin of MBP and L1 after enzymolysis.
Fig. 4: 6*HIS-SUMO-HPV6 L1 protein through affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is for being protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and left swimming lane is the resin of affine absorption 6*HIS-SUMO-L1, and right swimming lane is the resin of 6*HIS-SUMO and L1 after enzymolysis.The fused albumen with 6*HIS-SUMO label is not cut by gel electrophoresis figure display proteolytic enzyme.
Fig. 5: the restructuring HPV6 L1 pentamer protein s DS-PAGE gel electrophoresis figure of the present invention after molecular sieve chromatography purifying.M swimming lane is protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and another swimming lane is HPV L1 albumen.
The dynamic light scattering observed result of Fig. 6: HPV6 L1 pentamer.The particle size diameter of result display pentamer is 12.89nM, size-grade distribution PdI is 0.058.
The dynamic light scattering observed result of Fig. 7: HPV6 L1 VLP.The particle size diameter of result display VLP is 50.29 nM, size-grade distribution PdI is 0.040.
The transmission electron microscope photo of Fig. 8: HPV6 L1 pentamer albumen.
The transmission electron microscope photo of Fig. 9: HPV6 L1 VLP albumen.
The high-pressure liquid phase molecular sieve chromatography figure of Figure 10: HPV6 L1 pentamer protein, shows in figure and is greater than 98% through highly purified L1 pentamer lipidated protein.
The high-pressure liquid phase molecular sieve chromatography figure of Figure 11: HPV6 L1 VLP protein, shows in figure and is greater than 98% through highly purified VLP lipidated protein.
After each experimental group vaccinated mice of Figure 12: HPV6 L1 pentamer, at second time booster immunization after 4 weeks, detect the average titer level of neutralizing antibody.
After each experimental group vaccinated mice of Figure 13: HPV6 L1 VLP, at second time booster immunization after 4 weeks, detect the average titer level of neutralizing antibody.
Below in conjunction with embodiment, the present invention is illustrated description further.These embodiments are nonrestrictive.
EXAMPLE l: the Design and synthesis of codon optimized HPV L1 gene
Gene order derives from published various HPV sequence on PUBMED.With reference to intestinal bacteria, to selected various HPV DNA sequence dna, all HPV DNA sequence dnas of codon optimized rear synthesis are carried out to the preference of genetic transcription codon.According to synthetic DNA primers, synthetic gene is utilized to carry out pcr amplification for template.The codon optimised sequence of gained is verified by determined dna sequence.
The various DNA sequence dna of HPV before optimizing and after optimizing:
SEQ NO.1: the DNA sequence dna of the HPV6 type L1 before optimization
SEQ NO.2: the DNA sequence dna of the HPV6 type L1 after optimization
Embodiment 2: the structure of recombinant vectors pGEX-6P-1-GST-HPV6 L1 and qualification:
The DNA fragmentation primer of amplification HPV6 L1: (restriction enzyme site is BamHI and XhoI respectively)
Forward-HPV6 L1-ApaI:5’ACTTCA
GGATCC ATGTGGCGTCCGTCTGACTCTA
Reverse-HPV6 L1-XhoI:5’ATCTCA
CTCGAGCTA ACGTTTGGTT TTAGCACGTTT
pcr amplification reaction system:10 x Pfu buffer 20 μ L, Pfu enzyme 4 μ L, 10 mM dNTP 2.5 μ L, 5 ' Primer (5 μMs) 10 μ L, 3 ' Primer (5 μMs) 10 μ L, template DNA 50 ng, adds d2H2O to 200 μ L.
gene PCR amplification condition:95 DEG C of 3 min; 95 DEG C of 30 sec, 58 DEG C of 30 sec, 72 DEG C of 4 min; Circulate 32 times; 72 DEG C of 10 min.
L1 gene fragment containing BamH I and XhoI restriction enzyme site and vector pGEX-6P-1 are carried out the process of BamH I/XhoI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pGEX-6P-1 containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
The screening connecting and carry out recon in product to Host Strains DH5 α is transformed after ligation.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order afterwards by Shanghai Sheng Gong biotech firm, the nucleotides sequence obtaining merging restructuring GST-HPV6-L1 protein is classified as SEQ NO.3, and aminoacid sequence is SEQ NO.8.
With reference to the fusion recombinant vectors GST-HPV-L1 of this embodiment method preparation with GST label, its gene order SEQ NO.11.
Embodiment 3: recombinant vectors pGEX-6P-1m-GST-SUMO-HPV6 L1 vector construction
PGEX-6p-1m vector construction: the unique ApaI restriction enzyme site being carrier for the ApaI restriction enzyme site (GGGCCC) making multienzyme cut location proximate, under the prerequisite not changing lacI gene protein expressed sequence, by the synonym GGT that the Gly codon GGC in another ApaI recognition sequence GGGCCC of commercially available pGEX-6p-1 carrier is changed into it by point mutation technology, ApaI(3890 can be eliminated).ApaI is become can be used to the site of inserting expressing gene by such transformation.
The DNA fragmentation primer of amplification SUMO: (restriction enzyme site is ApaI and BamHI respectively)
Forward -SUMO-ApaI: ACTTCA
GGGCCCTCTGACCAGGAAGCTAAACCGTC
Reverse-SUMO-BamHI: CGC
GGATCCACCGGTCTGTTCCTGGTAAAC
The DNA fragmentation primer of amplification HPV6 L1: (restriction enzyme site is BamHI and XhoI respectively)
Forward-HPV6 L1-ApaI:5’ACTTCA
GGATCC ATGTGGCGTCCGTCTGACTCTA
Reverse-HPV6 L1-XhoI:5’ATCTCA
CTCGAGCTA ACGTTTGGTT TTAGCACGTTT
pcr amplification reaction system:10 x Pfu buffer 20 μ L, Pfu enzyme 4 μ L, 10 mM dNTP 2.5 μ L, 5 ' Primer (5 μMs) 10 μ L, 3 ' Primer (5 μMs) 10 μ L, template DNA 50 ng, adds d2H2O to 200 μ L.
gene PCR amplification condition:95 DEG C of 1.5 min; 95 DEG C of 30 sec, 58 DEG C of 30 sec, 72 DEG C of 1 min; Circulate 32 times; 72 DEG C of 10 min.
the same above-described embodiment of gene PCR amplification condition.
Enzyme cuts connection: the SUMO gene fragment containing ApaI and BamHI restriction enzyme site and vector pGEX-6P-1m are carried out the process of Apa I/ BamHI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pGEX-6P-1m containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15h.
Transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Jin Weizhi bio tech ltd, Suzhou afterwards, obtaining merging recombinant vectors pGSTSUMO-6p-1m.
Enzyme cuts connection again: the L1 gene fragment containing BamHI and Xho1 restriction enzyme site and recombinant vectors pGSTSUMO-6p-1m are carried out the process of BamHI/Xho1 double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pGSTSUMO-6p1m containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
Again transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening is carried out enlarged culturing and carries out the extraction of plasmid, checked order by Jin Weizhi bio tech ltd, Suzhou afterwards, obtain the fusion recombinant vectors GST-SUMO-L1 with GST-SUMO label, its gene order SEQ NO.4, aminoacid sequence is SEQ NO.9.
With reference to the fusion recombinant vectors GST-SUMO-L1 of this embodiment method preparation with GST-SUMO label, its gene order SEQ NO.12.
Embodiment 4: the structure of recombinant vectors pMAL-MBP-HPV6 L1
The DNA fragmentation primer of amplification HPV6 L1: (restriction enzyme site is EcoRI and HindIII respectively)
Forward-HPV6 L1-EcoRI:5’ ACTTCA
GAATTC ATGTGGCGTCCGTCTGACTCTA
Reverse-HPV6 L1-HindIII:5’ ATCTCA
AAGCTTCTA ACGTTTGGTT TTAGCACGTTT
L1 gene fragment containing EcoRI and HindIII restriction enzyme site and carrier pMAL are carried out the process of EcoRI/HindIII double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pMAL containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
The screening connecting and carry out recon in product to Host Strains DH5 α is transformed after ligation.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order afterwards by Shanghai Sheng Gong biotech firm, obtain the gene order SEQ NO.5 merging restructuring MBP-HPV6-L1 protein, aminoacid sequence is SEQ NO.10.
With reference to the fusion recombinant vectors MBP-HPV-L1 of this embodiment method preparation with MBP label, its gene order SEQ NO.13.
Embodiment 5: the structure of recombinant vectors pET28a-6*His-HPV6 L1
The DNA fragmentation primer of amplification HPV6 L1: (restriction enzyme site is NdeI and XhoI, pET28a respectively)
Forward-HPV6 L1-NdeI:5’ GACTTCA
CATATGATGTGGCGTCCGTCTGACTCTA
Reverse-HPV6 L1-XhoI:5’ CATCTCA
CTCGAGCTA ACGTTTGGTT TTAGCACGTTT
L1 gene fragment containing NdeI and XhoI restriction enzyme site and carrier pMAL are carried out the process of NdeI/XhoI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pET28a containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
The screening connecting and carry out recon in product to Host Strains DH5 α is transformed after ligation.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Shanghai Sheng Gong biotech firm afterwards, obtaining the gene order SEQ NO.6 merging restructuring MBP-HPV6-L1 protein.
Embodiment 6: recombinant vectors 6*His-SUMO-HPV6 L1 vector construction
The DNA fragmentation primer of amplification SUMO: (restriction enzyme site is NdeI and BamHI respectively)
Forward -SUMO-NdeI: GGAATTC
CATATGTCTGACCAGGAAGCTAAACCGTC
Reverse-SUMO-BamHI: CGC
GGATCCACCGGTCTGTTCCTGGTAAAC
The DNA fragmentation primer of amplification HPV6 L1: (restriction enzyme site is BamHI and XhoI respectively)
Forward-HPV6 L1-ApaI:5’ACTTCA
GGATCC ATGTGGCGTCCGTCTGACTCTA
Reverse-HPV6 L1-XhoI:5’ATCTCA
CTCGAGCTA ACGTTTGGTT TTAGCACGTTT
SUMO gene, L1
gene PCR amplification condition, reaction system are with described in above-described embodiment.
Enzyme cuts connection: the SUMO gene fragment containing NdeI and BamHI restriction enzyme site and carrier pET-28a are carried out the process of NdeI/ BamHI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pET28a containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
Transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Jin Weizhi bio tech ltd, Suzhou afterwards, obtaining merging recombinant vectors pETSUMO-28a.
Enzyme cuts connection again: the L1 gene fragment containing BamHI and Xho1 restriction enzyme site and recombinant vectors pETSUMO-28a are carried out the process of BamHI/Xho1 double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pETSUMO-28a containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
Again transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Shanghai Sheng Gong biotech firm afterwards, obtaining the gene order SEQ NO.7 merging restructuring MBP-HPV6-L1 protein.
Embodiment 7: restructuring HPV L1 pentamer protein expression
By the recombinant vectors transformation of E. coli BL21 host cell of correct for sequencing result embodiment 2,3,4,5 and 6, and carry out the expression of HPV L1 albumen as the engineering bacteria of expressing recombinant protein.Recombinant base is 2YT substratum (10 g/L tryptones; 5 g/L yeast powders; 10 g/L NaCl).Picking contains the thalline list spot of recombinant plasmid in 10ml 2YT substratum (containing 100 μ g/ml penbritins), and 230 revs/min (rpm), 37 DEG C of shaking culture are spent the night.5 ml that transfer spend the night bacterium in 500 ml(containing 100 μ g/ml penbritins) in 2YT liquid nutrient medium, 37 DEG C of concussions are cultured to recombinant bacterial strain when growing to OD600nm ≈ 0.4 ~ 1, add the IPTG induction of final concentration 0.2mM, under the condition of 28 DEG C, carry out the abduction delivering of more than 6h recombinant protein.
Cell harvesting and fragmentation
:carry out centrifugal to fermenting culture, abandon supernatant, results bacterial sediment, weighs; Use buffer L(pH 8.0,50 mM Tris, 200 mM NaCl, 5mM DTT) washing precipitation, be then resuspended in buffer L and carried out ultrasonic disruption, by supercentrifuge, centrifugal (16000 rpm are carried out to broken bacterium liquid subsequently, 30 min, 4 DEG C), collect supernatant liquor.
Embodiment 8: restructuring HPV L1 pentamer albumen is in the detection of expression in escherichia coli amount
Before adopting ELISA sandwich assay to detect affinity chromatography loading, Tag-HPV L1 pentamer albumen is in expression in escherichia coli amount, sample and trial-product:
coated antibody:make anti-HPV6 L1 mouse monoclonal by oneself.
reference substance:make highly purified HPV6 L1 albumen by oneself.
trial-product:with sample diluting liquid by trial-product
tag-HPV6 L1be diluted to concentration in reference substance gradient dilution concentration range.
enzyme labelled antibody:the rabbit anti-HPV6 L1 albumen of homemade horseradish peroxidase-labeled resists more.
result calculates:calculate the mean value of parallel hole, with reference substance series concentration OD
450absorption value makes straight-line equation to its corresponding L1 proteantigen, and between Duplicate Samples sample wells, the variation coefficient must not be greater than 10%, linear regression equation R
2must not 0.980 be less than, by the OD of trial-product
450absorption value substitutes into Equation for Calculating and goes out trial-product L1 proteantigen content after dilution, then is multiplied by corresponding extension rate and is L1 proteantigen content in trial-product, in table 1.
Tag-HPV L1 proteantigen content after table 1 detects and expresses
Embodiment 9: restructuring HPV L1 pentamer protein affinity chromatography
affinity chromatography with GST label recombinant protein:gST agarose affinity chromatography medium 5ml is loaded in affinity column, with buffer L(pH 8.0,50 mM Tris, 200 mM NaCl, 5mM DTT) balance chromatography column, then in loading embodiment 8 with the protein liquid of GST or GST-SUMO label, after with Buffer L be washed till without protein flow out, affine complete.With 5mL Buffer L suspension affinity media, sampling detects and in conjunction with the total amount of L1 protein in calculation medium.
affinity chromatography with MBP label recombinant protein:amylose-Resin affinity chromatography medium 5ml is loaded in affinity column, with buffer L(pH 8.0,50 mM Tris, 200 mM NaCl, 5mM DTT) balance chromatography column, then in loading embodiment 8 with the protein liquid of GST or GST-SUMO label, after with Buffer L be washed till without protein flow out, affine complete.With 5mL Buffer L suspension affinity media, sampling detects and in conjunction with the total amount of L1 protein in calculation medium.
affinity chromatography with 6*HIS label recombinant protein:get 5ml Ni-NTA gel dress post, post slowly adds balance liquid (50mmol/L NaH2PO4, the 300mmol/L Nacl of 10 times of column volumes, 20mmol/L imidazole, pH value to 8 is adjusted with NaOH), fully to balance Ni-NTA gel, flow velocity is 1ml/min.The supernatant liquor with 6*His label after filtering in Example 8, after entering gel completely, continue detergent gel with the balance liquid of 10 times of column volumes, preservation flow velocity is 1ml/min.Be eluted to balance liquid and flow out without protein, affine complete.Sampling detects and in conjunction with the total amount of L1 protein in calculation medium.
Embodiment 10: the enzyme of restructuring Tag-HPV L1 protein cuts purifying
Enzyme amount is added according to target protein matter and proteolytic enzyme mass ratio 100:1, protein HRV 3CP wherein with GST-HPV-L1 is cut, protein with GST-SUMO-HPV-L1 and 6*His-SUMO-HPV-L1 SENP1 proteolytic cleavage, with the protein Factor Xa proteolytic cleavage of Mbp-HPV-L1, protein with 6*His-HPV-L1 Thrombin proteolytic cleavage, respectively after Double digestion 2h, wash-out collects the HPV6 L1 pentamer protein soln of gained after each proteolytic cleavage respectively.
3C enzyme enzyme is cut the L1 protein soln SDS-PAGE detected through gel electrophoresis after GST label, the results are shown in Figure 1 affinity chromatography electrophoresis result, experiment shows, the target protein of 90% can be cut.Fig. 2 is the protein of SENP1 proteolytic cleavage with GST-SUMO-HPV-L1, by SDS-PAGE detected through gel electrophoresis.Fig. 3 is the protein of Factor Xa proteolytic cleavage with Mbp-HPV-L1, by SDS-PAGE detected through gel electrophoresis.Fig. 1-Fig. 3 obtains the HPV6 L1 albumen of 55kDa.
Thrombin proteolytic enzyme does not cut the protein of 6*His-HPV-L1; Cut the protein soln SDS-PAGE detected through gel electrophoresis of 6*His-SUMO-L1 with SENP1 enzyme, the results are shown in Figure 4, display SENP1 proteolytic enzyme fails to cut the fused albumen with 6*His-SUMO label.
Embodiment 11: restructuring HPV L1 pentamer protein purification
Molecular sieve chromatography purifying: the enzyme that a upper embodiment is collected is cut the HPV6 L1 pentamer protein after purifying and carries out purifying respectively, can first through the HPV6 L1 pentamer protein of ion-exchange chromatography collection, or directly use the gel filter medium of Superdex200 (production of GE company) to carry out further sieve chromatography without ion-exchange step, molecular sieve moving phase is pH8.0,10 mM Tris, 100 mM NaCl, collect the cut of HPV6 L1 pentamer protein ultraviolet absorption peak.
Working sample purity after purifying: by the protein soln sampling SDS-PAGE detected through gel electrophoresis of collecting, target protein matter HPV6 L1 pentamer final purity after sieve chromatography purifying is all greater than 98%, refer to Fig. 5, the restructuring HPV6 L1 pentamer protein s DS-PAGE gel electrophoresis figure after molecular sieve chromatography purifying.
Working sample protein concentration: carry out protein concentration detection by Bradford method, standard specimen 2mg/ml BAS preparation is used to be diluted to 500ug/ul from 100ug/ul, example reaction system gets the BSA+200ulBradford working fluid of 10ul dilution: typical curve is y=0.0013 x-0.0294, R2=0.9986, the OD of working sample
595, substitute into typical curve, the protein concentration of calculation sample, the results are shown in Table 2.
Table 2 Bradford method detects restructuring HPV6 L1 pentamer protein concentration
Note: sample sets 1 is that GST-HPV L1 obtains HPV L1 pentamer protein solution after molecular sieve purification; Sample sets 2 is that GST-SUMO-HPV L1 obtains HPV L1 pentamer protein solution after molecular sieve purification; Sample sets 3 is that Mbp-HPV L1 obtains HPV L1 pentamer protein solution after molecular sieve purification.
Embodiment 12: restructuring HPV6 L1 pentamer protein group dresses up VLP
Be placed under following salt concn (NaCl) and pH value condition, HPV L1 pentamer solution example group 1,2 and 3, place after stablizing, use the dynamic light scattering particle instrument of Malvern Zetasizer NanoZS, (size distribution FACTOR P dI value is grain size dispersity index, is less than 0.05 for highly homogeneous sample to carry out particle diameter and particle size distribution measuring; 0.05 ~ 0.1 is as the criterion homogeneous sample, and 0.1 ~ 0.3 is the poor sample of homogeneity, is greater than 0.3 for inhomogenous sample), the assembling of HPV6 L1 pentamer albumen obtains the VLP(of uniform particle diameter
pdI < 0.05).
The droplet measurement of HPV6 L1 VLP is assembled under the different pH of table 3 and salt concentration conditions
Note: sample sets 1 is that GST-HPV L1 obtains HPV L1 VLP protein solution after molecular sieve purification; Sample sets 2 is that GST-SUMO-HPV L1 obtains HPV L1VLP protein solution after molecular sieve purification; Sample sets 3 is that Mbp-HPV L1 obtains HPV L1VLP protein solution after molecular sieve purification.
Embodiment 13: dynamic light scattering (DLS) is to L1 pentamer and VLP protein particle size determination
Instrument is the dynamic light scattering particle instrument of Malvern Zetasizer NanoZS, get HPV6 L1 pentamer that each sample group finally obtains and HPV6 L1 VLP protein detects, survey the homogeneity that median size and monodispersity index PdI(show protein), illustrate the L1 pentamer that each group of sample is finally prepared and VLP albumen homogeneous.The pentamer protein that wherein sample sets 2 is finally obtained and the HPV6 L1 VLP protein size distribution that its assembling obtains refer to
accompanying drawing 6 He7.
The preparation of embodiment 14:HPV6 L1 pentamer and VLP
According to the technology that the above embodiment of the present invention 1-13 adopts, preparation has sequence 11,12, the HPV6 L1 albumen of 13, above albumen all can obtain the albumen that purity reaches more than 98% by purifying, obtains the HPV6 L1 pentamer albumen of median size 10 ~ 15nm PdI<0.1.Further assembling obtains the HPV6 L1VLP albumen of median size 45 ~ 65nm PdI<0.1.
The morphologic detection of embodiment 15:HPV6 L1 pentamer and VLP
transmission electron microscope observing:the HPV6 L1-VLP protein that the HPV6 L1 pentamer protein obtained by each purifying in embodiment, assembling obtain, utilizes transmission electron microscope platform to observe by Instite of Biophysics, Chinese Academy of Sciences.Freezing sample preparation and flow process of taking pictures:
1) by liquid nitrogen box filled with liquid nitrogen, when liquid level does not seethe with excitement, ethane is slowly injected the copper bowl of cooling, make it to be cooled to liquid state.
2) copper mesh is done wetting ability process at PDC-32 type plasma cleaning device.
3) in the freezing sample preparation device of Vitrobot TM Mark IV, by the pentamer of 3.5 μ L and VLP sample adsorption in 300 object QUANTIFOIL copper mesh, after water suction 4s, by the freezing sample of liquid ethane.
4) rapid being transferred in liquid nitrogen by sample is preserved.
5), when collecting freezing photo, electron dose is 20 e-/2.Data are by the Gatan UltraScan 4000 CCD record of the 300 kV Titan Krios transmission electron microscopes of 300 KV.Acceleration voltage is 300 kV.
Result shows, in HPV6 L1 pentamer protein example group, and the pentamer albumen of about the 10nm that visible a large amount of diameter conforms to theoretical size in the visual field; In HPV6 L1-VLP protein example group, a large amount of diameters that visible particle size conforms to theory are the virus-like particle (VLP) of about 50nm, uniformity.After wherein GST-SUMO set of tags (sample sets 2) enzyme cuts purifying, the transmission electron microscope photo of HPV6 L1 pentamer gained sample is shown in
accompanying drawingthe transmission electron microscope photo of the VLP albumen that 8, Mbp set of tags (sample sets 3) enzyme is assembled after cutting purifying is again shown in
accompanying drawing9.
Embodiment 16:HPV6 L1 protein stoste purity detecting
Size Exclusion High Performance liquid chromatogram measuring: chromatographic column Agilent Bio SEC-5um, 2000,7.8 × 300mm, column volume about 15 m1, molecular weight ranges >=lO, OOOkDa; With the 0.1mol/L phosphate buffered saline buffer of pH6.8 (take Sodium phosphate dibasic 25.8g, SODIUM PHOSPHATE, MONOBASIC 4.37g, add ultrapure water and make dissolving, with phosphoric acid adjust pH to 6.8, ultrapure water constant volume becomes 1000ml) be moving phase; Flow velocity is 1ml/min; Determined wavelength 280nm; Column temperature 25 DEG C, applied sample amount must not be less than 20ug, and sample main peak theoretical plate number is not less than 1000, and tailing factor is less than 2.0, continuous sample introduction 5 pin, and the relative standard deviation of peak area must not be greater than 3%.
Get the HPV6 L1 that 2 groups, the sample after purifying finally obtains
pentamerwith assembling after
vLPprotein stoste, weaker concn is 1mg/ml respectively, and applied sample amount 20ul injects high pressure liquid chromatograph, detects according to the method described above, and by area normalization method calculated purity, all process lipidated proteins are all greater than 98%, the results are shown in
accompanying drawing10 and table 4,
accompanying drawing11 and table 5.
The HPLC lipidated protein of table 4 HPV6 L1 pentamer detects
After table 5 HPV6 L1 assembles
vLPhPLC lipidated protein detect
Peak | Retention time | Area | Area % |
1 | 13.995 | 2615610 | 100.00 |
Amount to | 2615610 | 100.00 |
Embodiment 17:HPV VLP stability experiment
The HPV6 VLP protein each sample sets finally obtained, under the buffer conditions of following table, is placed 14 days to 28 days at 25 DEG C, is carried out droplet measurement, the results are shown in following table, prove that HPV6 VLP is at pH 5.0 to 5.9, deposits stable under salt concn 500 ~ 2000mM.Sample sets 3 gained HPV6 VLP is at pH 5.0 to 5.9, and after placing 14-28 days under salt concn 500 ~ 2000mM, detected result refers to as following table.
Table 6 HPV6 L1 VLP places 14-28 days droplet measurement results at 25 DEG C
embodiment 18: preparation contains the univalent vaccine of HPV L1 pentamer or VLP
HPV6 L1 pentamer containing each sample sets or VLP albumen stoste are carried out absorption preparation with aluminum hydroxide adjuvant normal saline solution according to albumen and aluminium content 1:10 ratio respectively and can obtain recombinate HPV L1 protein pentamer or VLP vaccine, stand-by 4 DEG C of preservations.
The immunogenicity determining of embodiment 19:HPV L1 pentamer and VLP
Get above-mentioned L1 pentamer or VLP vaccine respectively, the physiological saline adding sterilizing is diluted to pentamer or the VLP protein vaccine of 20 μ g/ml concentration respectively, with every 0.1ml intramuscular injection BALB/c mouse, often organizes 10.Mouse every 4 weeks booster immunizations once, are total to immunity 2 times.Booster immunization is after 4 weeks, and for the NAT of homotype HPV in the mice serum after adopting pseudovirus cell Neutralizing test method to measure each immunity respectively, result is as attached
figure12, shown in 13.
Result shows, HPV L1 pentamer and VLP protein vaccination mouse, after second immunisation, 4 weeks neutralizing antibodies can reach very high level.The results show, the VLP vaccine of HPV L1 pentamer and assembling all can produce neutralizing antibody in animal body, illustrate that HPV L1 pentamer and VLP protein vaccine all have immunogenicity in human clinical trial, the disease that HPV homologous virus causes can be prevented.
SEQUENCE LISTING
<110> Beijing Health Guard Biotechnology Co., Ltd.
<120> 6 type recombinant human papilloma virus virus-like particle and preparation method thereof
<130> 2014
<160> 13
<170> PatentIn version 3.3
<210> 1
<211> 1503
<212> DNA
<213> artificial sequence
<400> 1
atgtggcggc ctagcgacag cacagtatat gtgcctcctc ctaaccctgt atccaaagtt 60
gttgccacgg atgcttatgt tactcgcacc aacatatttt atcatgccag cagttctaga 120
cttcttgcag tgggacatcc ttatttttcc ataaaacggg ctaacaaaac tgttgtgcca 180
aaggtgtcag gatatcaata cagggtattt aaggtggtgt taccagatcc taacaaattt 240
gcattgcctg actcgtctct tttcgatccc acaacacaac gtttagtatg ggcatgcaca 300
ggcctagagg tgggcagggg acagccatta ggtgtgggtg taagtggaca tcctttccta 360
aataaatatg atgatgttga aaattcaggg agtggtggta accctggaca ggataacagg 420
gttaatgtag gtatggatta taaacaaaca caattatgca tggttggatg tgccccccct 480
ttgggcgagc attggggtaa aggtaaacag tgtactaata cacctgtaca ggctggtgac 540
tgcccgccct tagaacttat taccagtgtt atacaggatg gcgatatggt tgacacaggc 600
tttggtgcta tgaattttgc tgatttgcag accaataaat cagatgttcc tattgacata 660
tgtggcacta catgtaaata tccagattat ttacaaatgg ctgcagaccc atatggtgat 720
agattatttt tttttctacg gaaggaacaa atgtttgcca gacatttttt taacagggct 780
ggcgaggtgg gggaacctgt gcctgataca cttataatta agggtagtgg aaatcgcacg 840
tctgtaggga gtagtatata tgttaacacc ccgagcggct ctttggtgtc ctctgaggca 900
caattgttta ataagccata ttggctacaa aaagcccagg gacataacaa tggtatttgt 960
tggggtaatc aactgtttgt tactgtggta gataccacac gcagtaccaa catgacatta 1020
tgtgcatccg taactacatc ttccacatac accaattctg attataaaga gtacatgcgt 1080
catgtggaag agtatgattt acaatttatt tttcaattat gtagcattac attgtctgct 1140
gaagtaatgg cctatattca cacaatgaat ccctctgttt tggaagactg gaactttggg 1200
ttatcgcctc ccccaaatgg tacattagaa gatacctata ggtatgtgca gtcacaggcc 1260
attacctgtc aaaagcccac tcctgaaaag gaaaagccag atccctataa gaaccttagt 1320
ttttgggagg ttaatttaaa agaaaagttt tctagtgaat tggatcagta tcctttggga 1380
cgcaagtttt tgttacaaag tggatatagg ggacggtcct ctattcgtac aggtgttaag 1440
cgccctgctg tttccaaagc ctctgctgcc cctaaacgta agcgcgccaa aactaaaagg 1500
taa 1503
<210> 2
<211> 1500
<212> DNA
<213> artificial sequence
<400> 2
atgtggcgtc cgtctgactc taccgtttac gttccgccgc cgaacccggt ttctaaagtt 60
gttgctaccg acgcttacgt tacccgtacc aacatcttct accacgcttc ttcttctcgt 120
ctgctggctg ttggtcaccc gtacttctct atcaaacgtg ctaacaaaac cgttgttccg 180
aaagtttctg gttaccagta ccgtgttttc aaagttgttc tgccggaccc gaacaaattc 240
gctctgccgg actcttctct gttcgacccg accacccagc gtctggtttg ggcttgcacc 300
ggtctggaag ttggtcgtgg tcagccgctg ggtgttggtg tttctggtca cccgttcctg 360
aacaaatacg acgacgttga aaactctggt tctggtggta acccgggtca ggacaaccgt 420
gttaacgttg gtatggacta caaacagacc cagctgtgca tggttggttg cgctccgccg 480
ctgggtgaac actggggtaa aggtaaacag tgcaccaaca ccccggttca ggctggtgac 540
tgcccgccgc tggaactgat cacctctgtt atccaggacg gtgacatggt tgacaccggt 600
ttcggtgcta tgaacttcgc tgacctgcag accaacaaat ctgacgttcc gatcgacatc 660
tgcggtacca cctgcaaata cccggactac ctgcagatgg ctgctgaccc gtacggtgac 720
cgtctgttct tcttcctgcg taaagaacag atgttcgctc gtcacttctt caaccgtgct 780
ggtgaagttg gtgaaccggt tccggacacc ctgatcatca aaggttctgg taaccgtacc 840
tctgttggtt cttctatcta cgttaacacc ccgtctggtt ctctggtttc ttctgaagct 900
cagctgttca acaaaccgta ctggctgcag aaagctcagg gtcacaacaa cggtatctgc 960
tggggtaacc agctgttcgt taccgttgtt gacaccaccc gttctaccaa catgaccctg 1020
tgcgcttctg ttaccacctc ttctacctac accaactctg actacaaaga atacatgcgt 1080
cacgttgaag aatacgacct gcagttcatc ttccagctgt gctctatcac cctgtctgct 1140
gaagttatgg cttacatcca caccatgaac ccgtctgttc tggaagactg gaacttcggt 1200
ctgtctccgc cgccgaacgg taccctggaa gacacctacc gttacgttca gtctcaggct 1260
atcacctgcc agaaaccgac cccggaaaaa gaaaaaccgg acccgtacaa aaacctgtct 1320
ttctgggaag ttaacctgaa agaaaaattc tcttctgaac tggaccagta cccgctgggt 1380
cgtaaattcc tgctgcagtc tggttaccgt ggtcgttctt ctatccgtac cggtgttaaa 1440
cgtccggctg tttctaaagc ttctgctgct ccgaaacgta aacgtgctaa aaccaaacgt 1500
<210> 3
<211> 2193
<212> DNA
<213> artificial sequence
<400> 3
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
ctggaagttc tgttccaggg gcccctggga tccatgtggc gtccgtctga ctctaccgtt 720
tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttacccgt 780
accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtacttc 840
tctatcaaac gtgctaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 900
ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 960
ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1020
ctgggtgttg gtgtttctgg tcacccgttc ctgaacaaat acgacgacgt tgaaaactct 1080
ggttctggtg gtaacccggg tcaggacaac cgtgttaacg ttggtatgga ctacaaacag 1140
acccagctgt gcatggttgg ttgcgctccg ccgctgggtg aacactgggg taaaggtaaa 1200
cagtgcacca acaccccggt tcaggctggt gactgcccgc cgctggaact gatcacctct 1260
gttatccagg acggtgacat ggttgacacc ggtttcggtg ctatgaactt cgctgacctg 1320
cagaccaaca aatctgacgt tccgatcgac atctgcggta ccacctgcaa atacccggac 1380
tacctgcaga tggctgctga cccgtacggt gaccgtctgt tcttcttcct gcgtaaagaa 1440
cagatgttcg ctcgtcactt cttcaaccgt gctggtgaag ttggtgaacc ggttccggac 1500
accctgatca tcaaaggttc tggtaaccgt acctctgttg gttcttctat ctacgttaac 1560
accccgtctg gttctctggt ttcttctgaa gctcagctgt tcaacaaacc gtactggctg 1620
cagaaagctc agggtcacaa caacggtatc tgctggggta accagctgtt cgttaccgtt 1680
gttgacacca cccgttctac caacatgacc ctgtgcgctt ctgttaccac ctcttctacc 1740
tacaccaact ctgactacaa agaatacatg cgtcacgttg aagaatacga cctgcagttc 1800
atcttccagc tgtgctctat caccctgtct gctgaagtta tggcttacat ccacaccatg 1860
aacccgtctg ttctggaaga ctggaacttc ggtctgtctc cgccgccgaa cggtaccctg 1920
gaagacacct accgttacgt tcagtctcag gctatcacct gccagaaacc gaccccggaa 1980
aaagaaaaac cggacccgta caaaaacctg tctttctggg aagttaacct gaaagaaaaa 2040
ttctcttctg aactggacca gtacccgctg ggtcgtaaat tcctgctgca gtctggttac 2100
cgtggtcgtt cttctatccg taccggtgtt aaacgtccgg ctgtttctaa agcttctgct 2160
gctccgaaac gtaaacgtgc taaaaccaaa cgt 2193
<210> 4
<211> 2475
<212> DNA
<213> artificial sequence
<400> 4
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720
ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780
atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840
cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900
aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960
cagaccggtg gatccatgtg gcgtccgtct gactctaccg tttacgttcc gccgccgaac 1020
ccggtttcta aagttgttgc taccgacgct tacgttaccc gtaccaacat cttctaccac 1080
gcttcttctt ctcgtctgct ggctgttggt cacccgtact tctctatcaa acgtgctaac 1140
aaaaccgttg ttccgaaagt ttctggttac cagtaccgtg ttttcaaagt tgttctgccg 1200
gacccgaaca aattcgctct gccggactct tctctgttcg acccgaccac ccagcgtctg 1260
gtttgggctt gcaccggtct ggaagttggt cgtggtcagc cgctgggtgt tggtgtttct 1320
ggtcacccgt tcctgaacaa atacgacgac gttgaaaact ctggttctgg tggtaacccg 1380
ggtcaggaca accgtgttaa cgttggtatg gactacaaac agacccagct gtgcatggtt 1440
ggttgcgctc cgccgctggg tgaacactgg ggtaaaggta aacagtgcac caacaccccg 1500
gttcaggctg gtgactgccc gccgctggaa ctgatcacct ctgttatcca ggacggtgac 1560
atggttgaca ccggtttcgg tgctatgaac ttcgctgacc tgcagaccaa caaatctgac 1620
gttccgatcg acatctgcgg taccacctgc aaatacccgg actacctgca gatggctgct 1680
gacccgtacg gtgaccgtct gttcttcttc ctgcgtaaag aacagatgtt cgctcgtcac 1740
ttcttcaacc gtgctggtga agttggtgaa ccggttccgg acaccctgat catcaaaggt 1800
tctggtaacc gtacctctgt tggttcttct atctacgtta acaccccgtc tggttctctg 1860
gtttcttctg aagctcagct gttcaacaaa ccgtactggc tgcagaaagc tcagggtcac 1920
aacaacggta tctgctgggg taaccagctg ttcgttaccg ttgttgacac cacccgttct 1980
accaacatga ccctgtgcgc ttctgttacc acctcttcta cctacaccaa ctctgactac 2040
aaagaataca tgcgtcacgt tgaagaatac gacctgcagt tcatcttcca gctgtgctct 2100
atcaccctgt ctgctgaagt tatggcttac atccacacca tgaacccgtc tgttctggaa 2160
gactggaact tcggtctgtc tccgccgccg aacggtaccc tggaagacac ctaccgttac 2220
gttcagtctc aggctatcac ctgccagaaa ccgaccccgg aaaaagaaaa accggacccg 2280
tacaaaaacc tgtctttctg ggaagttaac ctgaaagaaa aattctcttc tgaactggac 2340
cagtacccgc tgggtcgtaa attcctgctg cagtctggtt accgtggtcg ttcttctatc 2400
cgtaccggtg ttaaacgtcc ggctgtttct aaagcttctg ctgctccgaa acgtaaacgt 2460
gctaaaacca aacgt 2475
<210> 5
<211> 2673
<212> DNA
<213> artificial sequence
<400> 5
atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60
ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120
ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180
atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240
accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300
aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360
gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420
aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480
ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540
gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600
aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660
ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720
gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780
ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840
ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900
ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960
actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020
tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080
gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140
aacctcggga tcgagggaag gatttcagaa ttcatgtggc gtccgtctga ctctaccgtt 1200
tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttacccgt 1260
accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtacttc 1320
tctatcaaac gtgctaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 1380
ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 1440
ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1500
ctgggtgttg gtgtttctgg tcacccgttc ctgaacaaat acgacgacgt tgaaaactct 1560
ggttctggtg gtaacccggg tcaggacaac cgtgttaacg ttggtatgga ctacaaacag 1620
acccagctgt gcatggttgg ttgcgctccg ccgctgggtg aacactgggg taaaggtaaa 1680
cagtgcacca acaccccggt tcaggctggt gactgcccgc cgctggaact gatcacctct 1740
gttatccagg acggtgacat ggttgacacc ggtttcggtg ctatgaactt cgctgacctg 1800
cagaccaaca aatctgacgt tccgatcgac atctgcggta ccacctgcaa atacccggac 1860
tacctgcaga tggctgctga cccgtacggt gaccgtctgt tcttcttcct gcgtaaagaa 1920
cagatgttcg ctcgtcactt cttcaaccgt gctggtgaag ttggtgaacc ggttccggac 1980
accctgatca tcaaaggttc tggtaaccgt acctctgttg gttcttctat ctacgttaac 2040
accccgtctg gttctctggt ttcttctgaa gctcagctgt tcaacaaacc gtactggctg 2100
cagaaagctc agggtcacaa caacggtatc tgctggggta accagctgtt cgttaccgtt 2160
gttgacacca cccgttctac caacatgacc ctgtgcgctt ctgttaccac ctcttctacc 2220
tacaccaact ctgactacaa agaatacatg cgtcacgttg aagaatacga cctgcagttc 2280
atcttccagc tgtgctctat caccctgtct gctgaagtta tggcttacat ccacaccatg 2340
aacccgtctg ttctggaaga ctggaacttc ggtctgtctc cgccgccgaa cggtaccctg 2400
gaagacacct accgttacgt tcagtctcag gctatcacct gccagaaacc gaccccggaa 2460
aaagaaaaac cggacccgta caaaaacctg tctttctggg aagttaacct gaaagaaaaa 2520
ttctcttctg aactggacca gtacccgctg ggtcgtaaat tcctgctgca gtctggttac 2580
cgtggtcgtt cttctatccg taccggtgtt aaacgtccgg ctgtttctaa agcttctgct 2640
gctccgaaac gtaaacgtgc taaaaccaaa cgt 2673
<210> 6
<211> 1563
<212> DNA
<213> artificial sequence
<400> 6
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
atgatgtggc gtccgtctga ctctaccgtt tacgttccgc cgccgaaccc ggtttctaaa 120
gttgttgcta ccgacgctta cgttacccgt accaacatct tctaccacgc ttcttcttct 180
cgtctgctgg ctgttggtca cccgtacttc tctatcaaac gtgctaacaa aaccgttgtt 240
ccgaaagttt ctggttacca gtaccgtgtt ttcaaagttg ttctgccgga cccgaacaaa 300
ttcgctctgc cggactcttc tctgttcgac ccgaccaccc agcgtctggt ttgggcttgc 360
accggtctgg aagttggtcg tggtcagccg ctgggtgttg gtgtttctgg tcacccgttc 420
ctgaacaaat acgacgacgt tgaaaactct ggttctggtg gtaacccggg tcaggacaac 480
cgtgttaacg ttggtatgga ctacaaacag acccagctgt gcatggttgg ttgcgctccg 540
ccgctgggtg aacactgggg taaaggtaaa cagtgcacca acaccccggt tcaggctggt 600
gactgcccgc cgctggaact gatcacctct gttatccagg acggtgacat ggttgacacc 660
ggtttcggtg ctatgaactt cgctgacctg cagaccaaca aatctgacgt tccgatcgac 720
atctgcggta ccacctgcaa atacccggac tacctgcaga tggctgctga cccgtacggt 780
gaccgtctgt tcttcttcct gcgtaaagaa cagatgttcg ctcgtcactt cttcaaccgt 840
gctggtgaag ttggtgaacc ggttccggac accctgatca tcaaaggttc tggtaaccgt 900
acctctgttg gttcttctat ctacgttaac accccgtctg gttctctggt ttcttctgaa 960
gctcagctgt tcaacaaacc gtactggctg cagaaagctc agggtcacaa caacggtatc 1020
tgctggggta accagctgtt cgttaccgtt gttgacacca cccgttctac caacatgacc 1080
ctgtgcgctt ctgttaccac ctcttctacc tacaccaact ctgactacaa agaatacatg 1140
cgtcacgttg aagaatacga cctgcagttc atcttccagc tgtgctctat caccctgtct 1200
gctgaagtta tggcttacat ccacaccatg aacccgtctg ttctggaaga ctggaacttc 1260
ggtctgtctc cgccgccgaa cggtaccctg gaagacacct accgttacgt tcagtctcag 1320
gctatcacct gccagaaacc gaccccggaa aaagaaaaac cggacccgta caaaaacctg 1380
tctttctggg aagttaacct gaaagaaaaa ttctcttctg aactggacca gtacccgctg 1440
ggtcgtaaat tcctgctgca gtctggttac cgtggtcgtt cttctatccg taccggtgtt 1500
aaacgtccgg ctgtttctaa agcttctgct gctccgaaac gtaaacgtgc taaaaccaaa 1560
cgt 1563
<210> 7
<211> 1854
<212> DNA
<213> artificial sequence
<400> 7
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
atgtctgacc aggaagctaa accgtctacc gaagacctgg gtgacaaaaa agaaggtgaa 120
tacatcaaac tgaaagttat cggtcaggac tcttctgaaa tccacttcaa agttaaaatg 180
accacccacc tgaaaaaact gaaagaatct tactgccagc gtcagggtgt tccgatgaac 240
tctctgcgtt tcctgttcga aggtcagcgt atcgctgaca accacacccc gaaagaactg 300
ggtatggaag aagaagacgt tatcgaagtt taccaggaac agaccggtgg atccatgtgg 360
cgtccgtctg actctaccgt ttacgttccg ccgccgaacc cggtttctaa agttgttgct 420
accgacgctt acgttacccg taccaacatc ttctaccacg cttcttcttc tcgtctgctg 480
gctgttggtc acccgtactt ctctatcaaa cgtgctaaca aaaccgttgt tccgaaagtt 540
tctggttacc agtaccgtgt tttcaaagtt gttctgccgg acccgaacaa attcgctctg 600
ccggactctt ctctgttcga cccgaccacc cagcgtctgg tttgggcttg caccggtctg 660
gaagttggtc gtggtcagcc gctgggtgtt ggtgtttctg gtcacccgtt cctgaacaaa 720
tacgacgacg ttgaaaactc tggttctggt ggtaacccgg gtcaggacaa ccgtgttaac 780
gttggtatgg actacaaaca gacccagctg tgcatggttg gttgcgctcc gccgctgggt 840
gaacactggg gtaaaggtaa acagtgcacc aacaccccgg ttcaggctgg tgactgcccg 900
ccgctggaac tgatcacctc tgttatccag gacggtgaca tggttgacac cggtttcggt 960
gctatgaact tcgctgacct gcagaccaac aaatctgacg ttccgatcga catctgcggt 1020
accacctgca aatacccgga ctacctgcag atggctgctg acccgtacgg tgaccgtctg 1080
ttcttcttcc tgcgtaaaga acagatgttc gctcgtcact tcttcaaccg tgctggtgaa 1140
gttggtgaac cggttccgga caccctgatc atcaaaggtt ctggtaaccg tacctctgtt 1200
ggttcttcta tctacgttaa caccccgtct ggttctctgg tttcttctga agctcagctg 1260
ttcaacaaac cgtactggct gcagaaagct cagggtcaca acaacggtat ctgctggggt 1320
aaccagctgt tcgttaccgt tgttgacacc acccgttcta ccaacatgac cctgtgcgct 1380
tctgttacca cctcttctac ctacaccaac tctgactaca aagaatacat gcgtcacgtt 1440
gaagaatacg acctgcagtt catcttccag ctgtgctcta tcaccctgtc tgctgaagtt 1500
atggcttaca tccacaccat gaacccgtct gttctggaag actggaactt cggtctgtct 1560
ccgccgccga acggtaccct ggaagacacc taccgttacg ttcagtctca ggctatcacc 1620
tgccagaaac cgaccccgga aaaagaaaaa ccggacccgt acaaaaacct gtctttctgg 1680
gaagttaacc tgaaagaaaa attctcttct gaactggacc agtacccgct gggtcgtaaa 1740
ttcctgctgc agtctggtta ccgtggtcgt tcttctatcc gtaccggtgt taaacgtccg 1800
gctgtttcta aagcttctgc tgctccgaaa cgtaaacgtg ctaaaaccaa acgt 1854
<210> 8
<211> 731
<212> PRT
<213> artificial sequence
<400> 8
Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro
1 5 10 15
Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu
20 25 30
Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu
35 40 45
Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys
50 55 60
Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn
65 70 75 80
Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu
85 90 95
Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser
100 105 110
Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu
115 120 125
Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn
130 135 140
Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp
145 150 155 160
Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu
165 170 175
Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr
180 185 190
Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala
195 200 205
Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu
210 215 220
Phe Gln Gly Pro Leu Gly Ser Met Trp Arg Pro Ser Asp Ser Thr Val
225 230 235 240
Tyr Val Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala
245 250 255
Tyr Val Thr Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu
260 265 270
Leu Ala Val Gly His Pro Tyr Phe Ser Ile Lys Arg Ala Asn Lys Thr
275 280 285
Val Val Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val
290 295 300
Leu Pro Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp
305 310 315 320
Pro Thr Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly
325 330 335
Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Phe Leu Asn
340 345 350
Lys Tyr Asp Asp Val Glu Asn Ser Gly Ser Gly Gly Asn Pro Gly Gln
355 360 365
Asp Asn Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys
370 375 380
Met Val Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly Lys
385 390 395 400
Gln Cys Thr Asn Thr Pro Val Gln Ala Gly Asp Cys Pro Pro Leu Glu
405 410 415
Leu Ile Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe
420 425 430
Gly Ala Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val Pro
435 440 445
Ile Asp Ile Cys Gly Thr Thr Cys Lys Tyr Pro Asp Tyr Leu Gln Met
450 455 460
Ala Ala Asp Pro Tyr Gly Asp Arg Leu Phe Phe Phe Leu Arg Lys Glu
465 470 475 480
Gln Met Phe Ala Arg His Phe Phe Asn Arg Ala Gly Glu Val Gly Glu
485 490 495
Pro Val Pro Asp Thr Leu Ile Ile Lys Gly Ser Gly Asn Arg Thr Ser
500 505 510
Val Gly Ser Ser Ile Tyr Val Asn Thr Pro Ser Gly Ser Leu Val Ser
515 520 525
Ser Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln
530 535 540
Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val
545 550 555 560
Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val Thr
565 570 575
Thr Ser Ser Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg His
580 585 590
Val Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr
595 600 605
Leu Ser Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser Val
610 615 620
Leu Glu Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu
625 630 635 640
Glu Asp Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln Lys
645 650 655
Pro Thr Pro Glu Lys Glu Lys Pro Asp Pro Tyr Lys Asn Leu Ser Phe
660 665 670
Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln Tyr
675 680 685
Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg Ser
690 695 700
Ser Ile Arg Thr Gly Val Lys Arg Pro Ala Val Ser Lys Ala Ser Ala
705 710 715 720
Ala Pro Lys Arg Lys Arg Ala Lys Thr Lys Arg
725 730
<210> 9
<211> 825
<212> PRT
<213> artificial sequence
<400> 9
Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro
1 5 10 15
Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu
20 25 30
Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu
35 40 45
Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys
50 55 60
Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn
65 70 75 80
Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu
85 90 95
Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser
100 105 110
Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu
115 120 125
Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn
130 135 140
Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp
145 150 155 160
Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu
165 170 175
Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr
180 185 190
Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala
195 200 205
Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu
210 215 220
Phe Gln Gly Pro Ser Asp Gln Glu Ala Lys Pro Ser Thr Glu Asp Leu
225 230 235 240
Gly Asp Lys Lys Glu Gly Glu Tyr Ile Lys Leu Lys Val Ile Gly Gln
245 250 255
Asp Ser Ser Glu Ile His Phe Lys Val Lys Met Thr Thr His Leu Lys
260 265 270
Lys Leu Lys Glu Ser Tyr Cys Gln Arg Gln Gly Val Pro Met Asn Ser
275 280 285
Leu Arg Phe Leu Phe Glu Gly Gln Arg Ile Ala Asp Asn His Thr Pro
290 295 300
Lys Glu Leu Gly Met Glu Glu Glu Asp Val Ile Glu Val Tyr Gln Glu
305 310 315 320
Gln Thr Gly Gly Ser Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Val
325 330 335
Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala Tyr Val
340 345 350
Thr Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Ala
355 360 365
Val Gly His Pro Tyr Phe Ser Ile Lys Arg Ala Asn Lys Thr Val Val
370 375 380
Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val Leu Pro
385 390 395 400
Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Thr
405 410 415
Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gly
420 425 430
Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Phe Leu Asn Lys Tyr
435 440 445
Asp Asp Val Glu Asn Ser Gly Ser Gly Gly Asn Pro Gly Gln Asp Asn
450 455 460
Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys Met Val
465 470 475 480
Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly Lys Gln Cys
485 490 495
Thr Asn Thr Pro Val Gln Ala Gly Asp Cys Pro Pro Leu Glu Leu Ile
500 505 510
Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala
515 520 525
Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val Pro Ile Asp
530 535 540
Ile Cys Gly Thr Thr Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ala Ala
545 550 555 560
Asp Pro Tyr Gly Asp Arg Leu Phe Phe Phe Leu Arg Lys Glu Gln Met
565 570 575
Phe Ala Arg His Phe Phe Asn Arg Ala Gly Glu Val Gly Glu Pro Val
580 585 590
Pro Asp Thr Leu Ile Ile Lys Gly Ser Gly Asn Arg Thr Ser Val Gly
595 600 605
Ser Ser Ile Tyr Val Asn Thr Pro Ser Gly Ser Leu Val Ser Ser Glu
610 615 620
Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln Gly His
625 630 635 640
Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp
645 650 655
Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val Thr Thr Ser
660 665 670
Ser Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg His Val Glu
675 680 685
Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr Leu Ser
690 695 700
Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser Val Leu Glu
705 710 715 720
Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu Asp
725 730 735
Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln Lys Pro Thr
740 745 750
Pro Glu Lys Glu Lys Pro Asp Pro Tyr Lys Asn Leu Ser Phe Trp Glu
755 760 765
Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln Tyr Pro Leu
770 775 780
Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg Ser Ser Ile
785 790 795 800
Arg Thr Gly Val Lys Arg Pro Ala Val Ser Lys Ala Ser Ala Ala Pro
805 810 815
Lys Arg Lys Arg Ala Lys Thr Lys Arg
820 825
<210> 10
<211> 891
<212> PRT
<213> artificial sequence
<400> 10
Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys
1 5 10 15
Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr
20 25 30
Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe
35 40 45
Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala
50 55 60
His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile
65 70 75 80
Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp
85 90 95
Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu
100 105 110
Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys
115 120 125
Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly
130 135 140
Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro
145 150 155 160
Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys
165 170 175
Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly
180 185 190
Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp
195 200 205
Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala
210 215 220
Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys
225 230 235 240
Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser
245 250 255
Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro
260 265 270
Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp
275 280 285
Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala
290 295 300
Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala
305 310 315 320
Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln
325 330 335
Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala
340 345 350
Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn
355 360 365
Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile
370 375 380
Glu Gly Arg Ile Ser Glu Phe Met Trp Arg Pro Ser Asp Ser Thr Val
385 390 395 400
Tyr Val Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala
405 410 415
Tyr Val Thr Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu
420 425 430
Leu Ala Val Gly His Pro Tyr Phe Ser Ile Lys Arg Ala Asn Lys Thr
435 440 445
Val Val Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val
450 455 460
Leu Pro Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp
465 470 475 480
Pro Thr Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly
485 490 495
Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Phe Leu Asn
500 505 510
Lys Tyr Asp Asp Val Glu Asn Ser Gly Ser Gly Gly Asn Pro Gly Gln
515 520 525
Asp Asn Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys
530 535 540
Met Val Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly Lys
545 550 555 560
Gln Cys Thr Asn Thr Pro Val Gln Ala Gly Asp Cys Pro Pro Leu Glu
565 570 575
Leu Ile Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe
580 585 590
Gly Ala Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val Pro
595 600 605
Ile Asp Ile Cys Gly Thr Thr Cys Lys Tyr Pro Asp Tyr Leu Gln Met
610 615 620
Ala Ala Asp Pro Tyr Gly Asp Arg Leu Phe Phe Phe Leu Arg Lys Glu
625 630 635 640
Gln Met Phe Ala Arg His Phe Phe Asn Arg Ala Gly Glu Val Gly Glu
645 650 655
Pro Val Pro Asp Thr Leu Ile Ile Lys Gly Ser Gly Asn Arg Thr Ser
660 665 670
Val Gly Ser Ser Ile Tyr Val Asn Thr Pro Ser Gly Ser Leu Val Ser
675 680 685
Ser Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln
690 695 700
Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val
705 710 715 720
Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val Thr
725 730 735
Thr Ser Ser Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg His
740 745 750
Val Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr
755 760 765
Leu Ser Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser Val
770 775 780
Leu Glu Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu
785 790 795 800
Glu Asp Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln Lys
805 810 815
Pro Thr Pro Glu Lys Glu Lys Pro Asp Pro Tyr Lys Asn Leu Ser Phe
820 825 830
Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln Tyr
835 840 845
Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg Ser
850 855 860
Ser Ile Arg Thr Gly Val Lys Arg Pro Ala Val Ser Lys Ala Ser Ala
865 870 875 880
Ala Pro Lys Arg Lys Arg Ala Lys Thr Lys Arg
885 890
<210> 11
<211> 2088
<212> DNA
<213> artificial sequence
<400> 11
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
ctggaagttc tgttccaggg gccctctgac tctaccgttt acgttccgcc gccgaacccg 720
gtttctaaag ttgttgctac cgacgcttac gttacccgta ccaacatctt ctaccacgct 780
tcttcttctc gtctgctggc tgttggtcac ccgtacttct ctatcaaacg tgctaacaaa 840
accgttgttc cgaaagtttc tggttaccag taccgtgttt tcaaagttgt tctgccggac 900
ccgaacaaat tcgctctgcc ggactcttct ctgttcgacc cgaccaccca gcgtctggtt 960
tgggcttgca ccggtctgga agttggtcgt ggtcagccgc tgggtgttgg tgtttctggt 1020
cacccgttcc tgaacaaata cgacgacgtt gaaaactctg gttctggtgg taacccgggt 1080
caggacaacc gtgttaacgt tggtatggac tacaaacaga cccagctgtg catggttggt 1140
tgcgctccgc cgctgggtga acactggggt aaaggtaaac agtgcaccaa caccccggtt 1200
caggctggtg actgcccgcc gctggaactg atcacctctg ttatccagga cggtgacatg 1260
gttgacaccg gtttcggtgc tatgaacttc gctgacctgc agaccaacaa atctgacgtt 1320
ccgatcgaca tctgcggtac cacctgcaaa tacccggact acctgcagat ggctgctgac 1380
ccgtacggtg accgtctgtt cttcttcctg cgtaaagaac agatgttcgc tcgtcacttc 1440
ttcaaccgtg ctggtgaagt tggtgaaccg gttccggaca ccctgatcat caaaggttct 1500
ggtaaccgta cctctgttgg ttcttctatc tacgttaaca ccccgtctgg ttctctggtt 1560
tcttctgaag ctcagctgtt caacaaaccg tactggctgc agaaagctca gggtcacaac 1620
aacggtatct gctggggtaa ccagctgttc gttaccgttg ttgacaccac ccgttctacc 1680
aacatgaccc tgtgcgcttc tgttaccacc tcttctacct acaccaactc tgactacaaa 1740
gaatacatgc gtcacgttga agaatacgac ctgcagttca tcttccagct gtgctctatc 1800
accctgtctg ctgaagttat ggcttacatc cacaccatga acccgtctgt tctggaagac 1860
tggaacttcg gtctgtctcc gccgccgaac ggtaccctgg aagacaccta ccgttacgtt 1920
cagtctcagg ctatcacctg ccagaaaccg accccggaaa aagaaaaacc ggacccgtac 1980
aaaaacctgt ctttctggga agttaacctg aaagaaaaat tctcttctga actggaccag 2040
tacccgctgg gtcgtaaatt cctgctgcag tctggttacc gtggttag 2088
<210> 12
<211> 2457
<212> DNA
<213> artificial sequence
<400> 12
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720
ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780
atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840
cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900
aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960
cagaccggtg gatcctctac cgtttacgtt ccgccgccga acccggtttc taaagttgtt 1020
gctaccgacg cttacgttac ccgtaccaac atcttctacc acgcttcttc ttctcgtctg 1080
ctggctgttg gtcacccgta cttctctatc aaacgtgcta acaaaaccgt tgttccgaaa 1140
gtttctggtt accagtaccg tgttttcaaa gttgttctgc cggacccgaa caaattcgct 1200
ctgccggact cttctctgtt cgacccgacc acccagcgtc tggtttgggc ttgcaccggt 1260
ctggaagttg gtcgtggtca gccgctgggt gttggtgttt ctggtcaccc gttcctgaac 1320
aaatacgacg acgttgaaaa ctctggttct ggtggtaacc cgggtcagga caaccgtgtt 1380
aacgttggta tggactacaa acagacccag ctgtgcatgg ttggttgcgc tccgccgctg 1440
ggtgaacact ggggtaaagg taaacagtgc accaacaccc cggttcaggc tggtgactgc 1500
ccgccgctgg aactgatcac ctctgttatc caggacggtg acatggttga caccggtttc 1560
ggtgctatga acttcgctga cctgcagacc aacaaatctg acgttccgat cgacatctgc 1620
ggtaccacct gcaaataccc ggactacctg cagatggctg ctgacccgta cggtgaccgt 1680
ctgttcttct tcctgcgtaa agaacagatg ttcgctcgtc acttcttcaa ccgtgctggt 1740
gaagttggtg aaccggttcc ggacaccctg atcatcaaag gttctggtaa ccgtacctct 1800
gttggttctt ctatctacgt taacaccccg tctggttctc tggtttcttc tgaagctcag 1860
ctgttcaaca aaccgtactg gctgcagaaa gctcagggtc acaacaacgg tatctgctgg 1920
ggtaaccagc tgttcgttac cgttgttgac accacccgtt ctaccaacat gaccctgtgc 1980
gcttctgtta ccacctcttc tacctacacc aactctgact acaaagaata catgcgtcac 2040
gttgaagaat acgacctgca gttcatcttc cagctgtgct ctatcaccct gtctgctgaa 2100
gttatggctt acatccacac catgaacccg tctgttctgg aagactggaa cttcggtctg 2160
tctccgccgc cgaacggtac cctggaagac acctaccgtt acgttcagtc tcaggctatc 2220
acctgccaga aaccgacccc ggaaaaagaa aaaccggacc cgtacaaaaa cctgtctttc 2280
tgggaagtta acctgaaaga aaaattctct tctgaactgg accagtaccc gctgggtcgt 2340
aaattcctgc tgcagtctgg ttaccgtggt cgttcttcta tccgtaccgg tgttaaacgt 2400
ccggctgttt ctaaagcttc tgctgctccg aaacgtaaac gtgctaaaac caaacgt 2457
<210> 13
<211> 2628
<212> DNA
<213> artificial sequence
<400> 13
atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60
ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120
ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180
atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240
accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300
aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360
gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420
aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480
ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540
gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600
aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660
ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720
gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780
ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840
ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900
ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960
actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020
tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080
gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140
aacctcggga tcgagggaag gatttcagaa ttcatgtggc gtccgtctga ctctaccgtt 1200
tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttacccgt 1260
accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtacttc 1320
tctatcaaac gtgctaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 1380
ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 1440
ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1500
ctgggtgttg gtgtttctgg tcacccgttc ctgaacaaat acgacgacgt tgaaaactct 1560
ggttctggtg gtaacccggg tcaggacaac cgtgttaacg ttggtatgga ctacaaacag 1620
acccagctgt gcatggttgg ttgcgctccg ccgctgggtg aacactgggg taaaggtaaa 1680
cagtgcacca acaccccggt tcaggctggt gactgcccgc cgctggaact gatcacctct 1740
gttatccagg acggtgacat ggttgacacc ggtttcggtg ctatgaactt cgctgacctg 1800
cagaccaaca aatctgacgt tccgatcgac atctgcggta ccacctgcaa atacccggac 1860
tacctgcaga tggctgctga cccgtacggt gaccgtctgt tcttcttcct gcgtaaagaa 1920
cagatgttcg ctcgtcactt cttcaaccgt gctggtgaag ttggtgaacc ggttccggac 1980
accctgatca tcaaaggttc tggtaaccgt acctctgttg gttcttctat ctacgttaac 2040
accccgtctg gttctctggt ttcttctgaa gctcagctgt tcaacaaacc gtactggctg 2100
cagaaagctc agggtcacaa caacggtatc tgctggggta accagctgtt cgttaccgtt 2160
gttgacacca cccgttctac caacatgacc ctgtgcgctt ctgttaccac ctcttctacc 2220
tacaccaact ctgactacaa agaatacatg cgtcacgttg aagaatacga cctgcagttc 2280
atcttccagc tgtgctctat caccctgtct gctgaagtta tggcttacat ccacaccatg 2340
aacccgtctg ttctggaaga ctggaacttc ggtctgtctc cgccgccgaa cggtaccctg 2400
gaagacacct accgttacgt tcagtctcag gctatcacct gccagaaacc gaccccggaa 2460
aaagaaaaac cggacccgta caaaaacctg tctttctggg aagttaacct gaaagaaaaa 2520
ttctcttctg aactggacca gtacccgctg ggtcgtaaat tcctgctgca gtctggttac 2580
cgtggtcgtt cttctatccg taccggtgtt aaacgtccgg ctgtttct 2628
Claims (21)
1., through a gene of the encoding human papilloma virus HPV6 L1 of intestinal bacteria preferred codons optimization, this gene is the nucleotide sequence shown in SEQ NO.2.
2. a coli expression carrier, is characterized in that this carrier comprises the sequence with gene described in claim 1.
3. coli expression carrier as claimed in claim 2, is characterized in that this carrier is pGEX-6p-1, pGEX-4T-2, pMAL or pET28a.
4. an engineering bacteria cell, this cell comprises gene according to claim 1, or the expression vector described in claim 2,3.
5. the fusion rotein of a Tag-HPV6 L1, it is characterized in that this albumen comprises the gene of encoding human papilloma virus HPV6 L1, preferably through the gene of the encoding human papilloma virus HPV6 L1 of intestinal bacteria preferred codons optimization, more preferably genes encoding as claimed in claim 1; Label Tag is GST.Tag, MBP.Tag or GST-SUMO.Tag.
6. fusion rotein as claimed in claim 5, is characterized in that L1 protein is that full length protein or C hold no more than 30 amino acid of brachymemma and/or N to hold no more than 10 the amino acid whose L1 protein of brachymemma.
7. fusion rotein as claimed in claim 5, is characterized in that its nucleotides sequence is classified as SEQ NO.3, SEQ NO.4, SEQ NO.5, SEQ NO.11, SEQ NO.12 or SEQ NO.13.
8. fusion rotein as claimed in claim 5, is characterized in that its aminoacid sequence is SEQ NO.8, SEQ NO.9 or SEQ NO.10.
9. a HPV6 L1 pentamer protein, is characterized in that this pentamer protein is obtained after purifying by the fused protein as described in claim 5,6,7 or 8, pentamer albumen median size 10 ~ 15nm PdI<0.1.
10. a VLP of HPV6 L1, is characterized in that this VLP is formed by pentamer protein assembly according to claim 9, median size 45 ~ 65nm PdI<0.1.
11. 1 kinds of HPV L1 protein vaccine compositions, is characterized in that this vaccine composition comprises HPV L1 pentamer protein according to claim 9 and medicinal adjuvant.
12. 1 kinds of HPV L1 protein vaccine compositions, is characterized in that this vaccine composition comprises HPV L1 VLP according to claim 10 and medicinal adjuvant.
The preparation method of 13. fusion roteins as described in claim 5,6,7 or 8, is characterized in that the method comprises the steps:
By replacing the codon of HPV6 L1 gene order with the codon of intestinal bacteria preference, obtain the gene of codon optimized HPV6 L1;
Build the coli expression carrier of HPV6 L1 gene;
Build the escherichia coli expression engineering strain of Tag-HPV6 L1;
Abduction delivering purifying obtains fusion rotein Tag-HPV6 L1.
14. methods as claimed in claim 13, wherein said prokaryotic host cell is GI698, ER2566, BL21 (DE3), XA90, B834 (DE3) or BLR (DE3), preferred BL21 (DE3).
The preparation method of 15. HPV6 L1 pentamer protein as claimed in claim 9, is characterized in that the method comprises the steps:
With affinity chromatography method absorption fusion rotein Tag-HPV6 L1;
Add proteolytic enzyme excision Tag label, obtain HPV6 L1 pentamer protein;
Purifying HPVL1 pentamer protein, the L1 pentamer protein of purity >98%, median size 10 ~ 15nm PdI<0.1.
The preparation method of 16. HPV6 L1 pentamer protein as claimed in claim 15, is characterized in that described proteolytic enzyme is the site-specific proteolytic enzyme of excision Tag label: restructuring HRV 3CP, zymoplasm, SUMO proteolytic enzyme, SENP1 or TEV protease.
The preparation method of 17. HPV6 L1 VLP as claimed in claim 10, is characterized in that the method comprises the steps:
The L1 pentamer protein liquid of median size 10 ~ 15nm PdI<0.1 is mixed with assembling damping fluid, final acquisition pH value is 5.0 ~ 5.9, salt concn is 500 ~ 2000 mM, the HPV6 L1 VLP protein liquid of median size 45 ~ 65nm PdI<0.1.
18. a preparation method of HPV6 L1-VLP as claimed in claim 10 is assembled in cryogenic freezing process, it is characterized in that the method comprises the steps:
The L1 pentamer protein liquid of median size 10 ~ 15nm PdI<0.1 is placed in pH value is 5.5 ~ 8.0 salt concn is damping fluid under 150 ~ 1000 mM conditions, completely freezing under-20 ~-80 DEG C of conditions, place room temperature again to melt to protein stoste, obtain the HPV6 L1VLP protein liquid of median size 45 ~ 65nm PdI<0.1.
19. the application of HPV6 L1 pentamer protein as claimed in claim 9 in the medicine of preparation prevention HPV6 infection.
20. the application of HPV6 L1VLP protein as claimed in claim 10 in the medicine of preparation prevention HPV6 infection.
Application in the medicine that 21. vaccine compositions as described in claim 11 or 12 infect at preparation prevention HPV6.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410685769.1A CN104962567B (en) | 2013-12-03 | 2014-11-25 | 6 type recombinant human papilloma virus-like particle and preparation method thereof |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310635249 | 2013-12-03 | ||
CN2013106352495 | 2013-12-03 | ||
CN201410685769.1A CN104962567B (en) | 2013-12-03 | 2014-11-25 | 6 type recombinant human papilloma virus-like particle and preparation method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104962567A true CN104962567A (en) | 2015-10-07 |
CN104962567B CN104962567B (en) | 2022-11-08 |
Family
ID=54216657
Family Applications (5)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410672159.8A Active CN105002190B (en) | 2013-12-03 | 2014-11-22 | 11 type recombinant human papilloma virus-like particle and preparation method thereof |
CN201410672158.3A Active CN105177025B (en) | 2013-12-03 | 2014-11-22 | 18 type recombinant human papilloma virus-like particle and preparation method thereof |
CN201410672161.5A Active CN105039358B (en) | 2013-12-03 | 2014-11-22 | 58 type recombinant human papilloma virus-like particle and preparation method thereof |
CN201410685769.1A Active CN104962567B (en) | 2013-12-03 | 2014-11-25 | 6 type recombinant human papilloma virus-like particle and preparation method thereof |
CN201410683185.0A Active CN105039359B (en) | 2013-12-03 | 2014-11-25 | 16 type recombinant human papilloma virus-like particle and preparation method thereof |
Family Applications Before (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410672159.8A Active CN105002190B (en) | 2013-12-03 | 2014-11-22 | 11 type recombinant human papilloma virus-like particle and preparation method thereof |
CN201410672158.3A Active CN105177025B (en) | 2013-12-03 | 2014-11-22 | 18 type recombinant human papilloma virus-like particle and preparation method thereof |
CN201410672161.5A Active CN105039358B (en) | 2013-12-03 | 2014-11-22 | 58 type recombinant human papilloma virus-like particle and preparation method thereof |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410683185.0A Active CN105039359B (en) | 2013-12-03 | 2014-11-25 | 16 type recombinant human papilloma virus-like particle and preparation method thereof |
Country Status (1)
Country | Link |
---|---|
CN (5) | CN105002190B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2024088087A1 (en) * | 2022-10-28 | 2024-05-02 | 北京康乐卫士生物技术股份有限公司 | Expression of human papillomavirus (hpv) 68 l1 protein, and virus-like particles and preparation method therefor |
Families Citing this family (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105296521B (en) * | 2015-12-07 | 2020-08-28 | 郑州大学 | Recombinant plasmid for expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof |
CN105548420B (en) * | 2015-12-30 | 2019-08-02 | 上海泽润生物科技有限公司 | The detection method of MOPS residual quantity |
CN107188931B (en) * | 2016-03-15 | 2020-02-11 | 中国医学科学院基础医学研究所 | Truncated human papilloma virus 58 type L1 protein and application thereof |
CN107184973A (en) * | 2016-03-15 | 2017-09-22 | 中国医学科学院基础医学研究所 | A kind of compound vaccine adjuvant and its application |
JP7051132B2 (en) * | 2016-09-16 | 2022-04-11 | ロイコケア・アクチェンゲゼルシャフト | A novel method for obtaining efficient viral vector-based compositions for vaccination or gene therapy |
CN108239652B (en) * | 2016-12-27 | 2020-03-17 | 天津大学 | Zika virus capsid protein rigid fusion expression vector and construction and application thereof |
CN107488747A (en) * | 2017-09-14 | 2017-12-19 | 温州美众医学检验所 | Quantitative fluorescent PCR primer and probe combinations and its reaction system |
WO2021013063A1 (en) * | 2019-07-19 | 2021-01-28 | 神州细胞工程有限公司 | Chimeric human papillomavirus type 16 l1 protein |
CN114539363B (en) * | 2020-11-26 | 2023-12-01 | 中国医学科学院基础医学研究所 | C-terminal modified human papilloma virus 11 type L1 protein and application thereof |
CN114681602B (en) * | 2020-12-25 | 2023-12-01 | 中国食品药品检定研究院 | Bivalent human papillomavirus vaccine |
CN113549634B (en) * | 2021-06-07 | 2023-03-31 | 郑州大学 | Gene for coding soluble HPV58L1 protein and construction and application of recombinant plasmid thereof |
CN116200416B (en) * | 2023-02-15 | 2024-03-12 | 北京康乐卫士生物技术股份有限公司 | Construction and application of plasmid expression vector based on Tac promoter |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1259051A (en) * | 1997-04-08 | 2000-07-05 | 麦克公司 | Stabilized human papillomavirus formulations |
CN101016542A (en) * | 2007-02-14 | 2007-08-15 | 马润林 | Method of increasing yield of human papilloma virus L1 albumen pronucleus expression |
CN101343315A (en) * | 2007-05-29 | 2009-01-14 | 厦门大学 | Shorten human papilloma virus 6 type L1 protein |
Family Cites Families (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1386611A4 (en) * | 2001-04-19 | 2009-05-13 | Teika Pharmaceutical Co Ltd | Medicines and medicinal kits |
CN101153280B (en) * | 2006-09-29 | 2015-08-19 | 厦门大学 | The method of purifying human papilloma virus advanced protein L1 from prokaryotic organism |
CN101245099A (en) * | 2007-02-14 | 2008-08-20 | 马润林 | Amino acid sequence of recombined human papilloma virus L1 capsid protein and uses thereof |
BRPI0811016B1 (en) * | 2007-04-29 | 2021-09-21 | Xiamen Innovax Biotech Co., Ltd. | LI TRUNCATE PROTEIN FROM HUMAN PAPILOMA VIRUS TYPE 16 |
WO2008134935A1 (en) * | 2007-04-29 | 2008-11-13 | Beijing Wantai Biological Pharmacy Enterprise Co., Ltd. | Truncated human papillomavirus type 18 l1 proteins |
DK2154148T3 (en) * | 2007-05-29 | 2016-09-19 | Univ Xiamen | Truncated L1 protein of human papillomavirus 11 |
CN101481407A (en) * | 2008-01-07 | 2009-07-15 | 马润林 | Modification sequence of recombinant human mammilla tumor virus L1 capsid protein |
CN101735310B (en) * | 2008-11-20 | 2012-07-18 | 中国疾病预防控制中心病毒病预防控制所 | Human papilloma virus (HPV) fusion protein, gene, carrier, strain, preparation method and application |
WO2011138234A2 (en) * | 2010-05-05 | 2011-11-10 | Deutsches Krebsforschungszentrum | Diagnostic transcript and splice patterns of hr-hpv in different cervical lesions |
CN101857870B (en) * | 2010-06-12 | 2012-09-05 | 上海泽润生物科技有限公司 | HPV58 L1 gene, vector, strain and expression method |
EP2594579B1 (en) * | 2010-07-16 | 2015-04-15 | Xiamen University | Truncated human papillomavirus type 58 l1 protein |
WO2012158639A2 (en) * | 2011-05-14 | 2012-11-22 | Sanofi Pasteur Biologics, Llc | Recombinant fusion proteins and methods for use thereof for treatment or prevention of papillomavirus infection |
CN103864936B (en) * | 2012-12-11 | 2018-01-23 | 中国疾病预防控制中心病毒病预防控制所 | HPV18 type L2NE7E6 antigen-4 fusion protein genes, expression vector, method, bacterial strain and purposes |
CN104045696B (en) * | 2012-12-18 | 2018-10-19 | 北京康乐卫士生物技术股份有限公司 | L 1 Protein of Human Papillomavirus Type 16 of recombination and application thereof |
CN104045695B (en) * | 2012-12-19 | 2019-01-25 | 北京康乐卫士生物技术股份有限公司 | HPV 18 L1 albumen of recombination and application thereof |
-
2014
- 2014-11-22 CN CN201410672159.8A patent/CN105002190B/en active Active
- 2014-11-22 CN CN201410672158.3A patent/CN105177025B/en active Active
- 2014-11-22 CN CN201410672161.5A patent/CN105039358B/en active Active
- 2014-11-25 CN CN201410685769.1A patent/CN104962567B/en active Active
- 2014-11-25 CN CN201410683185.0A patent/CN105039359B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1259051A (en) * | 1997-04-08 | 2000-07-05 | 麦克公司 | Stabilized human papillomavirus formulations |
CN101016542A (en) * | 2007-02-14 | 2007-08-15 | 马润林 | Method of increasing yield of human papilloma virus L1 albumen pronucleus expression |
CN101343315A (en) * | 2007-05-29 | 2009-01-14 | 厦门大学 | Shorten human papilloma virus 6 type L1 protein |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2024088087A1 (en) * | 2022-10-28 | 2024-05-02 | 北京康乐卫士生物技术股份有限公司 | Expression of human papillomavirus (hpv) 68 l1 protein, and virus-like particles and preparation method therefor |
Also Published As
Publication number | Publication date |
---|---|
CN105177025A (en) | 2015-12-23 |
CN105039359A (en) | 2015-11-11 |
CN104962567B (en) | 2022-11-08 |
CN105039358A (en) | 2015-11-11 |
CN105039359B (en) | 2020-02-28 |
CN105002190B (en) | 2022-11-08 |
CN105002190A (en) | 2015-10-28 |
CN105039358B (en) | 2020-02-28 |
CN105177025B (en) | 2022-11-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104962567A (en) | Recombinant virus-like particle of human papilloma virus type 6 and preparation method thereof | |
CN101293918B (en) | Shorten human papilloma virus 16 type L1 protein | |
US10537629B2 (en) | Truncated L1 protein of human papillomavirus type 11 | |
EP1305039B1 (en) | Stable (fixed) forms of viral l1 capsid proteins, fusion proteins and uses thereof | |
CN106831961A (en) | A kind of mutant of human papillomavirus type 58 L1 albumen | |
CN101343315B (en) | Shorten human papilloma virus 6 type L1 protein | |
CN106831959A (en) | A kind of mutant of human papillomavirus 33 type L 1 protein | |
CN106399329B (en) | 33 type recombinant human papilloma virus-like particle and preparation method thereof | |
CN106831958A (en) | A kind of mutant of Human Papillomavirus Type 11 L1 albumen | |
CN104212818A (en) | Optimized gene sequence of human papillomavirus 31 type L1 protein | |
CN106701797B (en) | 31 type recombinant human papilloma virus-like particle and preparation method thereof | |
CN103936840A (en) | Recombinant human papilloma virus type 33 L1 protein and its purpose | |
CN106701796B (en) | 52 type recombinant human papilloma virus-like particle and preparation method thereof | |
CN104211782B (en) | The type L1 albumen of HPV 45 of truncation | |
US20110033893A1 (en) | Improved methods for protein production | |
CN103992395A (en) | VLP vaccine of recombinant HPV-58 L1 and preparation method thereof | |
CN103819543A (en) | Recombinant protein HPV6L1 (Human Papilloma Virus 6 L1) and application thereof | |
CN106701798B (en) | 45 type recombinant human papilloma virus-like particle and preparation method thereof | |
CN104045695A (en) | Recombinant human papilloma virus 18L1 protein and its use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |