CN103992395A - VLP vaccine of recombinant HPV-58 L1 and preparation method thereof - Google Patents
VLP vaccine of recombinant HPV-58 L1 and preparation method thereof Download PDFInfo
- Publication number
- CN103992395A CN103992395A CN201410054216.6A CN201410054216A CN103992395A CN 103992395 A CN103992395 A CN 103992395A CN 201410054216 A CN201410054216 A CN 201410054216A CN 103992395 A CN103992395 A CN 103992395A
- Authority
- CN
- China
- Prior art keywords
- hpv58
- albumen
- leu
- gly
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20023—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention provides a novel polynucleotide gene fragment coding recombinant HPV-58 L1 protein, a vector containing the gene fragment, a host cell including the vector, HPV-58 L1 protein pentamer or VLP translated and expressed by the gene fragment and a vaccine against HPV-58 infection composed by the HPV-58 L1 protein pentamer or VLP.
Description
Technical field
The present invention relates to preventing and/or treating of human papilloma virus infection.More specifically, the present invention relates to a kind of human papillomavirus type 58 L1 albumen of restructuring, and consisting of pentamer and VLP, infect containing the vaccine of this albumen and at prevention HPV58 C-type virus C, particularly infect the purposes in the cervical cancer disease causing at prevention HPV58 C-type virus C.
Background technology
Human papilloma virus HPV (Human Papillomavirus is called for short HPV) is the DNA virus of propagating by close contact.In tissue, HPV main infection skin and mucous membrane tissue.HPV DNA is divided three classes by the size of Viral Carcinogenesis ability: (1) low risk HPV, comprise HPV6, 11, 40, 42, 43, 44, 54, 61, 70.72.51, mainly cause optimum exophytic wart, cervical intraepithelial neoplasia becomes (cervical intraepithelial neoplasm, CIN) (2) high-risk HPV, comprise HPV 16, 18, 31, 33, 35, 39, 43, 51, 52, 56, 58, 59, 68, 73, 82, in mainly causing in epithelium of cervix uteri, height knurl becomes (CINII, and uterine neck infiltrative type squama cancer CTNIII). modal is HPV 16, 18.(3) the carcinogenic type of possibility, comprise HPV 26,53,66(Munoz N, Bosch Fx, Sanjose S, et a1.Epidemiologie classification of human papilloma virus types associated with cervical cancer[J] .N Engl J Med, 2003,348:8).Cervical cancer is the second largest malignant tumour of women, and the morbidity in the annual whole world, probably in 540,000 (2013), approximately has 240,000 examples dead, and fortunately, cervical cancer is unique cancer of developing vaccine.On June 8th, 2006, the Gardasil HPV preventative vaccine listing that Merck company of the official approval U.S. of FDA Food and Drug Administration (FDA) (being MSD Corp.) produces; It is to express the also HPV16/18/6/11 L1 VLP tetravalence cervical cancer preventative vaccine of purifying by yeast saccharomyces cerevisiae, be approved for 6 ~ 26 years old girl of prevention and women HPV16,18,6,11 types and infect caused cervical cancer, precancerous lesion and Genital warts, this is (the Villa of first tumor vaccine in the world that FDA passes through, Costa et al. 2005, Villa, Ault et al. 2006, Bryan 2007, Olsson, Villa et al. 2007, Goldstone and Vuocolo 2012).The also successfully listing of the HPV preventative vaccine of the commodity Cervarix by name that Britain's GlaxoSmithKline PLC (GSK) company produces subsequently, it is the HPV16/18 L1 VLP divalence cervical cancer preventative vaccine that origin comes from insect expression system.But these two kinds of preventative vaccines are expensive, greatly limit the use in developing country and backward areas, therefore developed one just seem particularly important (Jansen and Shaw 2004, Buonaguro of high-titer HPV vaccine cheaply, Tornesello et al. 2009, Campo and Roden 2010, Frazer, Leggatt et al. 2011, Hariri, Dunne et al. 2011, Lehtinen and Dillner 2013, Shaw 2013).
HPV belongs to Papovaviridae (Papovaviridae) Papillomavirus, for without coating DNA virus.Viral genome is double-stranded closed-circular DNA, and size is about 7.2～8kb, has 8 open frames.Genome can be divided into three regions by the difference of function: early stage district (E), and approximately 4. 5kb, coding E1, E2, E4～E7 totally 6 and virus replication, transcribe and transform relevant Nonstructural Protein; Late region (L), approximately 2. 5kb, coding Major capsid protein L1 and less important capsid protein L2; Long control region (LCR), between L district end and E district initiating terminal, is about 800～900bp, and any albumen of not encoding, containing DNA replication dna, expression regulation element.
HPV virion diameter is 55～60nm, and nucleocapsid is 20 body symmetries, is made up of pentamer and the less important capsid protein L2 of 72 Major capsid protein L1s.Studies confirm that in a large number, HPV L1 albumen is the main target protein of HPV vaccine.The HPV L1 albumen of expressing in multiple expression system can be formed on viruslike particle (Virus-L1keParticle, VLP) like morphological structure and natural viral Particle Phase without L2 albumen is auxiliary.Successfully listing the disease such as cervical cancer, pointed condyloma for preventing HPV to infect and cause thus of restructuring HPV L1-VLP vaccine, and fully proved that L1-VLP has the antigenicity identical with wild homologous virus and immunogenicity.From the tertiary structure of composition VLP, its antigenic determinant is all distributed in surface (the Xiaojiang S. Chen of the basic structural unit pentamer of composition VLP, Robert L. Garcea, Ilya Goldberg, Gregory Casini and Stephen C. (2000). HarrisonStructure of Small Virus-like Particles Assembled from the L1 Protein of Human Papillomavirus 16.Molecular Cell, Vol. 5, 557 – 567.Brooke Bishop, Jhimli Dasgupta, Michael Klein, Robert L. Garcea, Neil D. Christensen, Rui Zhaoand Xiaojiang S. Chen. (2007). Crystal Structures of Four Types of Human Papillomavirus L1 Capsid Proteins. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 43, pp. 31803 – 31811), illustrate that the antigenicity of HPV L1-VLP and immunogenicity derive from or depend on the pentamer of L1 composition.Therefore, restructuring L1 albumen pentamer is the same with VLP possesses complete epitope, and both all can be used as antigen and are used for preparing vaccine.
The key of HPV vaccine development is efficiently to prepare in a large number HPV L1 albumen.Comparatively conventional expression system can be divided into eukaryotic expression system and prokaryotic expression system at present.Conventional eukaryotic expression system has pox viruses express system, insect baculovirus expression system, yeast expression system.In eukaryotic expression system, expressed HPV L1 albumen native conformation destroys less, formation VLP that can be spontaneous, and often only need carry out simple purifying can obtain VLP.But because the expression amount of eukaryotic expression system is low, cultivate cost high, brought very big difficulty to large-scale industrial production.In prokaryotic expression system, utilizing escherichia expression system to express HPVL1 albumen has been reported.But the HPV L1 albumen expressed due to intestinal bacteria loses its native conformation mostly, can not produce the protection antibody for HPV.Although or above-mentioned albumen is by occlusion body purifying, the steps such as renaturation also can obtain the VLP of HPV, in renaturation process, loss of proteins amount is large, and yield is low, is difficult to apply in scale operation.Although HPV L1 full length sequence albumen also can be in intestinal bacteria with correct conformation solubility express, be dissolved in the cracking supernatant of thalline, but expression amount is lower, and in supernatant, foreign protein kind is many and amount is large, to therefrom be purified into target protein difficulty quite large, still cannot be applied to scale operation.
Therefore, this area still needs the novel method of cost is low, purity is high, output is high, effective HPV L1 protein production technology and large-scale industrial production prevention vaccine for cervical cancer.
Summary of the invention
The object of this invention is to provide a kind of new HPV58 L1 albumen, and consisting of pentamer protein grain and containing the vaccine of this pentamer protein grain.
The present invention relates to provide a kind of HPV58 L1 albumen of new coding restructuring polynucleotide gene fragment, the carrier that comprises this gene fragment, comprise the host cell of carrier, and the vaccine being infected by the HPV58 L1 albumen pentamer of this gene fragment accurate translation and the anti-HPV58 type that formed by this pentamer.
The invention discloses a kind of aminoacid sequence of HPV58 L1 albumen of restructuring, at 8-15 amino acid of N end, whole or arbitrary portion is replaced by 2-10 aminoacid sequence the aminoacid sequence of described albumen, and its aminoacid sequence is by arbitrary array mode of G, S, A three; H4 structural domain is replaced by 2-10 aminoacid sequence, and its aminoacid sequence is by arbitrary array mode of G, S, A three.
The HPV58 L1 albumen the present invention relates to is further 0,1,2 to 21 amino acid of its aminoacid sequence C end brachymemma.
HPV58 L1 albumen of the present invention, is preferably replaced by GSGGG, ASASG or GSGAG by 8-15 amino acid before its aminoacid sequence N end, and H4 structural domain is preferably replaced by GGGSG or GAGAS.
HPV58 L1 albumen as described embodiments, preferably its aminoacid sequence is preferably replaced by GSGGG or ASASG aminoacid sequence at front 8,10,12 or 15 amino acid of N end.C holds a preferred brachymemma 10-21 amino acid, more preferably 10,21 amino acid of brachymemma.
HPV58 L1 albumen as described embodiments, its sequence comprises sequence SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10.
The present invention discloses a kind of polynucleotide sequence of proteins encoded.The present invention discloses a kind of expression vector of the gene that comprises polynucleotide sequence.The present invention discloses a kind of cell that comprises expression vector.
The present invention discloses a kind of HPV58 L1 albumen pentamer, and this albumen pentamer is formed by five HPV58 L1 protein monomers.
The present invention discloses a kind of HPV58 L1 prion sample particle (VLP), and this virus-like particle is the three-dimensional symmetrical structure of icosahedron, is made up of the pentamer of 72 L1 albumen.
The present invention discloses a kind of HPV vaccine, and this vaccine comprises HPV58 L1 albumen pentamer or VLP and medicinal adjuvant.
The present invention discloses a kind of preparation method of HPV vaccine, and the method is:
A. the gene fragment of clone or synthetic restructuring HPV58 L1 albumen;
B. in intestinal bacteria or yeast expression system, express the HPV58 L1 albumen of restructuring;
C. the pentamer that purifying is made up of HPV58 L1 albumen or be further assembled into VLP;
D. add medicinal adjuvant to make vaccine.
In aforesaid method, the purifying of step C preferably utilizes affinity chromatography chromatogram purification HPV58 L1 fusion tag albumen.
The open HPV vaccine of the present invention prevents and/or treats the application in the medicine that comprises HPV58 infection and cause disease in preparation.
First aspect present invention provides a kind of polynucleotide gene fragment of the restructuring HPV58 L1 albumen of encoding.
Second aspect present invention provides a kind of expression vector of structure, the polynucleotide gene fragment of the coding restructuring HPV58 L1 albumen that it comprises first aspect present invention.Described carrier is applicable to driving allogeneic dna sequence DNA accurate translation HPV58 L1 albumen in bacterium, insect or mammalian cell.In one embodiment, the preferred pGEX-6p-1 of described expression vector or pGEX-4T-2.
A third aspect of the present invention provides a kind of engineering bacteria cell of structure, the polynucleotide gene fragment that this cell comprises first aspect present invention, or the expression vector of second aspect.Described engineering bacteria host cell can be bacterial cell, and for example intestinal bacteria can be eukaryotic cells, for example yeast cell, or insect cell.
Fourth aspect present invention provides a kind of medicinal compositions, and it comprises the expression product HPV58 L1 albumen, vehicle or the carrier that adopt the technology of the present invention to produce.
The present invention provides the method for polynucleotide sequence, expression vector establishment, engineering bacteria cell transformation and the medicinal compositions of preparing above-mentioned coding restructuring HPV58 L1 albumen simultaneously.
The present invention obtains the method for HPV58 L1 albumen, and it is included in HPV58 L1 albumen and the pentamer thereof of in expression system, expressing restructuring, then the cracking supernatant that contains this recombinant protein is carried out to purification process.The concrete method that obtains HPV58 L1 albumen pentamer comprises:
1. the fragment of clone or synthetic coding HPV58 L1 full-length proteins gene or truncated protein gene from clinical sample.
2. in intestinal bacteria or yeast expression system, express the L1 albumen of restructuring.
3. purifying HPV58 L1 recombinant protein.
In one embodiment, the preferred method of acquisition restructuring HPV58 L1 albumen comprises:
1. the HPV58 L1 recombinant protein that 1-15 amino acid of N end is whole or arbitrary portion is replaced by GGGSG sequence by GSGGG replacement, H4 structural domain.
2. in intestinal bacteria or yeast expression system, express the L1 albumen of restructuring.
3. purifying HPV58 L1 recombinant protein.
In preferred embodiment 1 scheme, 8 amino acid of N end brachymemma are replaced by GSGGG, and H4 structural domain is replaced by GGGSG sequence, 21 amino acid of C end brachymemma simultaneously, SEQ ID NO:2.
In preferred embodiment 2 schemes, 8 amino acid of N end brachymemma are replaced by GSGGG, and H4 structural domain is replaced by GGGSG sequence, 10 amino acid of C end brachymemma simultaneously, SEQ ID NO:4.
In preferred embodiment 3 schemes, 15 amino acid of N end brachymemma are replaced by GSGAG, and H4 structural domain is replaced by GAGSG sequence, 10 amino acid of C end brachymemma simultaneously, SEQ ID NO:6.
In preferred embodiment 4 schemes, 15 amino acid of N end brachymemma are replaced by ASASG, and H4 structural domain is replaced by GGGSG sequence, 21 amino acid of C end brachymemma simultaneously, SEQ ID NO:8.
In preferred embodiment 5 schemes, 8 amino acid of N end brachymemma are replaced by GSGGG, and H4 structural domain is replaced by GGGSG sequence, and C end retains not brachymemma, SEQ ID NO:10 simultaneously.
In embodiment 6 schemes of contrast, N holds front 8 amino acid to be replaced by GSGGG, and H4 structural domain does not replace, and C end retains not brachymemma.
The present invention separately provides medicinal compositions of the present invention in preparation prevention or treatment HPV58 type infection and has caused the application in disease medicament.
The invention still further relates to a kind of vaccine that prevents cervical cancer or HPV to infect, the HPV58 L1 pentamer that it comprises the present invention's restructuring, or the VLP being made up of pentamer or polymer, comprise 1,2,3,4,5 ... 200 pentamers.Preferred this vaccine also comprises at least one and is selected from HPV6 L1 pentamer, HPV11 L1 pentamer, HPV16 L1 pentamer, HPV18L1 pentamer, HPV31 L1 pentamer, HPV35 L1 pentamer, HPV45 L1 pentamer, HPV52 L1 pentamer, HPV58 L1 pentamer, and the divalence being formed by above-mentioned pentamer, trivalent, tetravalence, pentavalent, sexavalence, septivalency, octavalence, nine valencys or ten valency vaccines.This vaccine also comprises vaccine vehicle or carrier conventionally.
Preferably, the amount of every dose of HPV58 L1 albumen that contains the present invention's restructuring of described vaccine is 1 μ g-200 μ g, preferably 5 μ g-50 μ g.The HPV58 L1 that described vaccine contains the present invention's restructuring and HPV6 L1 are according to the vaccine of 0.5-2:1 ratio composition, the HPV58 L1 of restructuring and HPV11 L1 are according to the vaccine of 0.5-2:1 ratio composition, the HPV58 L1 of restructuring and HPV16 L1 are according to the vaccine of 0.5-2:1 ratio composition, the HPV58 L1 of restructuring and HPV18 L1 are according to the vaccine of 0.5-2:1 ratio composition, the HPV58 L1 of restructuring and HPV31 L1 are according to the vaccine of 0.5-2:1 ratio composition, the HPV58 L1 of restructuring and HPV33 L1 are according to the vaccine of 0.5-2:1 ratio composition, the HPV58 L1 of restructuring and HPV45 L1 are according to the vaccine of 0.5-2:1 ratio composition, the HPV58 L1 of restructuring and HPV52 L1 are according to the vaccine of 0.5-2:1 ratio composition, and the divalence being formed by the HPV58 L1 pentamer of recombinating and above-mentioned various HPV L1 pentamer, trivalent, tetravalence, pentavalent, sexavalence, septivalency vaccine or nine valencys that are further combined to form on this basis or ten valency vaccines.
The invention still further relates to a kind of method for the preparation of prevention cervical cancer or HPV infection vaccine, the HPV58 L1 pentamer that it comprises the present invention's restructuring, or the polymer being made up of pentamer and optional one or more are selected from HPV58,6,11,16,18, the pentamer of 31,33,45 and 52 HPV type and carrier or mixed with excipients for vaccine.
The invention further relates to the HPV58 L1 pentamer that comprises the present invention restructuring, VLP or the polymer that is made up of pentamer are infecting the purposes in vaccine for the preparation of prevention cervical cancer or HPV58.
the explanation of relational language and explanation in the present invention
According to the present invention, term " escherichia expression system " refers to by intestinal bacteria (bacterial strain) and expression vector and forms, wherein intestinal bacteria (bacterial strain) derive from available on the market, give an example but be not limited at this: GI698, ER2566, BL21 (DE3), B834 (DE3), BLR (DE3) etc.
According to the present invention, term " carrier " word refers to, and the polynucleotide of certain proteins encoded can be inserted wherein and make albumen obtain a kind of nucleic acid launch vehicle of expressing.Carrier can be by transforming, and transduction or transfection host cell, make its genetic material element carrying in host cell, obtain expression.For instance, carrier comprises: plasmid, phage, coemid etc.
According to the present invention, term " vehicle or carrier for vaccine " refers to and is selected from one or more, includes but not limited to: pH adjusting agent, tensio-active agent, adjuvant, ionic strength toughener.For example, pH adjusting agent is given an example but is not limited to phosphate buffered saline buffer, and tensio-active agent comprises positively charged ion, negatively charged ion or nonionic surface active agent.Give an example but be not limited to: Tween-80.Adjuvant is given an example but is not limited to aluminium hydroxide, aluminum phosphate, unformed hydroxyl phosphoric acid Tai-Ace S 150, Fu Shi Freund's complete adjuvant.Ionic strength toughener is given an example but is not limited to sodium-chlor.
According to the present invention, term " chromatography " includes but not limited to: ion-exchange chromatography, hydrophobic interaction chromatograph, adsorption chromatography (for example hydroxylapatite chromatography), gel-filtration (gel exclusion) chromatography, affinity chromatography.
According to the present invention, term " HPV58 L1 H4 structural domain " refers to " FG LTPPPSASLQ DTYRFVTSQA ITCQKTAPPK E " in HPV58 L1 DNA sequence dna, the 429th amino acids to 461 amino acids in the L1 protein sequence that is AEI61781 in Genebank accession number, or corresponding amino acid position with it in other HPV58 L1 sequence.
According to the present invention, in the method for the restructuring HPV58 L1 albumen obtaining in the present invention, damping fluid refers to the solution that can maintain within the specific limits pH value stabilization, includes but not limited to Tris damping fluid, phosphate buffered saline buffer, HEPES damping fluid, MOPS damping fluid etc.
According to the present invention, during described prokaryotic host cell fragmentation includes but not limited to process by homogenizer fragmentation, clarifixator fragmentation, ultrasonication, grinding, high-pressure extrusion, N,O-Diacetylmuramidase one or multinomial method realize;
According to the present invention, in the method for the restructuring HPV58 L1 albumen obtaining in the present invention, salt used includes but not limited to it is neutral salt, particularly an alkali metal salt, ammonium salt, hydrochloride, vitriol, vitriol, supercarbonate, one or more in phosphoric acid salt or hydrophosphate, particularly NaCI, KCI, NH4CI, (NH4) 2S04.Preferably NaCI.Reductive agent used includes but not limited to DTT, 2 mercapto ethanol.Institute's consumption includes but not limited to lOmM-lOOmM.
According to the present invention, described vaccine can adopt the acceptable form of patient, includes but not limited to that injection or nasal cavity or oral cavity suck or vagina administration, optimizing injection.
According to the present invention, term " valency " refers to the genotypic quantity that the component of composition vaccine comprises.The vaccine of HPV16 and 18 type antigens composition is called " divalence " vaccine for instance.
The inventor finds after deliberation, through the gene recombination to HPV58 L1 albumen n end, C end and H4 region, recycling escherichia expression system is expressed and can be obtained a large amount of restructuring GST-HPV58 L1 pentamer fusion roteins, this GST-HPV58 L1 pentamer albumen can obtain the HPV58 L1 pentamer albumen of high yield after affinitive layer purification, and purity is more than at least 85%.HPV58 L1 pentamer albumen after being further purified can reach more than 98% purity and can induce the protection antibody for HPV58.The present invention is based on above invention and now complete, for the vaccine of large-scale industrial production prevention cervical cancer provides a kind of novel method.
In the present invention, increase GSGGG or GSGAG at N end, and merge mutually with GST albumen, can greatly improve the solubility of L1 albumen, and improve enzyme and cut efficiency, reduce purifying cost, utilize protease hydrolyzed method excision GST albumen, the introducing of having removed external source impurity simultaneously; Replace H4 structural domain with GSGGG or GAGAS, can stop the polymerization of L1 albumen, thereby obtain homogeneous, stable pentamer or VLP albumen, for example, by the experiment of embodiment 12, find the protein product stability difference of different aminoacids sequence composition.More stable compared with the protein product that wherein sequence H4 structural domain is unsubstituted with H4 structural domain through the protein product replacing; C end brachymemma amino acid can effectively avoid the degraded of C end, minimizing because the product that proteolytic degradation causes is impure, thereby affects the stability of protein vaccine.
The HPV58 L1 albumen that sequence of the present invention obtains H4 structural domain house of correction forms pentamer, VLP or the polymer being formed by pentamer, there is good immunogenicity, can induce the neutralizing antibody for HPV58 of high titre, the infection of prevention HPV58 to human body is a kind of good vaccine form.In addition, the restructuring HPV58 L1 albumen adopting in the present invention is in retaining the antigenicity and pentamer particle assembling ability of total length HPV58 L1 albumen, be easy to express in eukaryotic expression system and prokaryotic expression system, increase albumen solvability, improve output, reduce production costs, can be applicable to large-scale industrial production.
After with reference to as detailed below and accompanying drawing, the beneficial effect of these and other aspect of the present invention will be obvious.All reference disclosed herein are this equal complete quoting as a reference.
Brief description of the drawings
HPV58 L1 pentamer transmission electron microscope observing (100,000 times) result prepared by figure l embodiment; Result shows, the pentamer that in the visual field, visible diameter is 13nm left and right, and granular size conforms to theoretical size, uniformity.
The dynamic light scattering observed result of the pentamer that Fig. 2-A is prepared according to embodiment 1, result shows particle diameter and the particle size distribution figure of pentamer.
The dynamic light scattering observed result of the HPV58 L1 pentamer that Fig. 2-B is prepared according to embodiment 6, result shows particle diameter and the particle size distribution figure of pentamer.
The high-pressure liquid phase molecular sieve chromatography figure of Fig. 3 embodiment 1 HPV58 L1 pentamer albumen, shows through highly purified pentamer purity of protein in figure.
After HPV58 L1 pentamer vaccine inoculation mouse prepared by Fig. 4 embodiment, after 3 weeks, detect the average titer level of neutralizing antibody at booster immunization for the second time.
Below in conjunction with embodiment, the present invention is further described for example.These embodiment are nonrestrictive.
[0062] EXAMPLE l: the structure with the engineering bacteria of HPV58 L1 sequence 2
1,hPV58 L1 full length gene is synthetic by Jin Wei intelligence bio tech ltd (GENEWIZ), its
nucleotide sequencesEQ ID NO:1, it is derived from GeneBank, and sequence number is GenBank:M14119.1.
2, contain SEQ ID NO:1 gene fragment and do the template that PCR reacts.With forward primer sequence: 5 '-CGCGGA TCCGGA AAGGAAGATC CATTAAATAA A-3 '; 5 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA.Downstream comprises XhoI restriction enzyme site, reverse primer sequence: 5 '-GCTCTCCTCGAG TTA GGGCTTTGCT TTAAGGCCTG A-3 ', and its 5 ' end is introduced restriction enzyme XhoI site, and XhoI site sequence is CTCGAG.Obtain HPV58B through PCR reaction amplification.
3, contain SEQ ID NO:1 gene fragment and do the template that PCR reacts.With the restriction enzyme BamH I site of containing introducing, BamH I site sequence is GGATCC, forward primer sequence: 5 '-CGCGGAGGATCC GGA GGA GGA CTAGTTATTTTATTTTGCGTC-3 '; 3 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA, reverse primer sequence: GCTCTCTCCGGA TCC TCC TCC TTGCCAGTCC TCCAAAATAT C; Obtain HPV58A through PCR reaction amplification amplification.
4, HPV58A fragment and HPV58B cut with restriction enzyme A ccIII enzyme jointly, form special sticky end, use T4 DNA ligase to connect HPV58A and HPV58B fragment, make it to form one deleted H4 structural domain, former H4 structural domain is encoded and connects the HPV58C that the nucleoside base sequence of polypeptide GGGSG replaces.
5, expression plasmid pGEX-4T-2 cuts digestion with BamH I and XhoI enzyme, then connects HPV58c and expression plasmid with T4 ligase enzyme.BamH I/XhoI enzyme is cut and is identified the positive expression clone pGEX-4T-2-HPV58C that obtains inserting L1 protein gene fragment.Utilize M13 (+)/(-) primer, record the object nucleotide sequence inserting in plasmid correct, the aminoacid sequence of its coding is SEQ ID NO:2.
6, connect product through electricity transform or CaCl2 method by recombinant plasmid transformed to intestinal bacteria, preferably transform e. coli bl21 host cell.The BL21 cell of conversion is applied on the LB plate culture medium that contains penbritin, through 37 DEG C of cultivations, picking mono-clonal colony inoculation in LB liquid nutrient medium 37 DEG C cultivate 12 hours, therefrom get 1ml bacterium solution preparation glycerine pipe bacterial classification in-70 DEG C of preservations.
The Taq archaeal dna polymerase that in above steps, PCR reaction system comprises 20 μ g DNA profilings, lx PCR damping fluid, forward and reverse special primer (concentration is 0.2 μ Μ), 1.5mM magnesium ion, 1.0 units; Reaction conditions is: 95 DEG C of sex change Celsius 5 minutes, through 36 PCR circulation amplifies, each circulation be 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 2 minutes, reaction product incubation 10 minutes at 72 DEG C, then stopped reaction.
Embodiment 2: the structure with the engineering bacteria of HPV58 L1 sequence 4
1, the clinical cell sample waste that the target gene segment of HPV58 L1 full length gene contains wild-type HPV58 virus purchased from Beijing An Zhen hospital-based outpatient obstetrical clinic, its
nucleotidesequence is SEQ ID NO:3(GenBank:FN870689.1).
2, contain SEQ ID NO:3 gene fragment and do the template that PCR reacts.With forward primer sequence: 5 '-CGCGGATCCGGA AAGGAAGATC CATTAAATAA A-3 '; 5 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA.Downstream comprises XhoI restriction enzyme site, reverse primer sequence: 5 '-GCTCTCCTCGAG TTA TGCACGGGTA GTAGGGGCTG A-3 ', and its 5 ' end is introduced restriction enzyme XhoI site, and XhoI site sequence is CTCGAG.Through PCR reaction, amplification obtains HPV58B.
3, contain SEQ ID NO:3 gene fragment and do the template that PCR reacts.Restriction enzyme BamH I site forward primer sequence to contain introducing: 5 '-CGCGGAGGATCC GGA GGA GGA CTAGTTATTTTATTTTGCGTC-3 '; 3 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA, reverse primer sequence: GCTCTCTCCGGA TCC TCC TCC TTGCCAGTCC TCCAAAATAT C; Through PCR reaction, amplification obtains HPV58A.
4, HPV58A fragment and HPV58B cut with restriction enzyme A ccIII enzyme jointly, form special sticky end, use T4 DNA ligase to connect HPV58A and HPV58B fragment, make it to form one deleted H4 structural domain, former H4 structural domain is encoded and connects the HPV58C that the nucleoside base sequence of polypeptide GGGSG replaces.
5, expression plasmid pGEX-4T-2 cuts digestion with BamH I and XhoI enzyme, then connects HPV58c and expression plasmid with T4 ligase enzyme.BamH I/XhoI enzyme is cut and is identified the positive expression clone pGEX-4T-2-HPV58C that obtains inserting L1 protein gene fragment.Utilize M13 (+)/(-) primer, record the object nucleotide sequence inserting in plasmid correct, the aminoacid sequence of its coding is SEQ ID NO:4.
6, connect product through electricity transform or CaCl2 method by recombinant plasmid transformed to intestinal bacteria, preferably transform e. coli bl21 host cell.The BL21 cell of conversion is applied on the LB plate culture medium that contains penbritin, through 37 DEG C of cultivations, picking mono-clonal colony inoculation in LB liquid nutrient medium 37 DEG C cultivate 12 hours, therefrom get 1ml bacterium solution preparation glycerine pipe bacterial classification in-70 DEG C of preservations.
The Taq archaeal dna polymerase that in above steps, PCR reaction system comprises 20 μ g DNA profilings, lx PCR damping fluid, forward and reverse special primer (concentration is 0.2 μ Μ), 1.5mM magnesium ion, 1.0 units; Reaction conditions is: 95 DEG C of sex change Celsius 5 minutes, through 36 PCR circulation amplifies, each circulation be 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 2 minutes, reaction product incubation 10 minutes at 72 DEG C, then stopped reaction.
Embodiment 3: the structure with the engineering bacteria of HPV58 L1 sequence 6
1,hPV58 L1 full length gene is synthetic by Jin Wei intelligence bio tech ltd (GENEWIZ), its
nucleotide sequencesEQ ID NO:5, it is derived from GeneBank, and sequence number is GenBank:FN870694.1.
2, contain SEQ ID NO:3 gene fragment and do the template that PCR reacts.With forward primer sequence: 5 '-CGCGGATCCGGA AAGGAAGATC CATTAAATAA A-3 '; 5 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA.Downstream comprises XhoI restriction enzyme site, reverse primer sequence: 5 '-GCTCTCCTCGAG TTA TGCACGGGTA GTAGGGGCCG A-3 ', and its 5 ' end is introduced restriction enzyme XhoI site, and XhoI site sequence is CTCGAG.PCR reaction, amplification obtains HPV58B.
3, contain SEQ ID NO:3 gene fragment and do the template that PCR reacts.Restriction enzyme BamH I site forward primer sequence to contain introducing: 5 '-CGCGGAGGATCC GGA GCC GGA GCAGACGTAAACGTTTTCCAT-3 '; 3 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA, reverse primer sequence: 5 '-GCTCTCTCCGGA TCC GGC TCC TTGCCAGTCC TCCAAAATAT C-3 '; Through PCR reaction, amplification obtains HPV58A.
4, HPV58A fragment and HPV58B cut with restriction enzyme A ccIII enzyme jointly, form special sticky end, use T4 DNA ligase to connect HPV58A and HPV58B fragment, make it to form one and deleted H4 structural domain H4 structural domain, original and be encoded and connect the HPV58C that the nucleoside base sequence of polypeptide GGGSG replaces.
5, expression plasmid pGEX-4T-2 cuts digestion with BamH I and XhoI enzyme, then connects HPV58c and expression plasmid with T4 ligase enzyme.BamH I/XhoI enzyme is cut and is identified the positive expression clone pGEX-4T-2-HPV58C that obtains inserting L1 protein gene fragment.Utilize M13 (+)/(-) primer, record the object nucleotide sequence inserting in plasmid correct, the aminoacid sequence of its coding is SEQ ID NO:6.
All the other operation stepss are with reference to the method for embodiment 1.
Embodiment 4: the structure with the engineering bacteria of HPV58 L1 sequence 8
1, HPV58 L1 full length gene is synthetic by Jin Wei intelligence bio tech ltd (GENEWIZ), its
nucleotide sequencesEQ ID NO:7, it is derived from GeneBank, and sequence number is GenBank:HE574702.1.
2, contain SEQ ID NO:7 gene fragment and do the template that PCR reacts.With forward primer sequence: 5 '-CGCGGATCCGGA AAGGAAGATC CATTAAATAA A-3 '; 5 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA.Downstream comprises XhoI restriction enzyme site, reverse primer sequence: 5 '-GCTCTCCTCGAG TTA GGGCTTTGCT TTAAGGCCTG A-3 ', and its 5 ' end is introduced restriction enzyme XhoI site, and XhoI site sequence is CTCGAG.Through PCR reaction, amplification obtains HPV58B.
3, contain SEQ ID NO:7 gene fragment and do the template that PCR reacts.Restriction enzyme Nhe I site forward primer sequence to contain introducing: 5 '-CGCGGA GCTAGCGCC TCC GGA GCAGACGTAAACGTTTTCCAT-3 '; 3 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA, reverse primer sequence: 5 '-GCTCTCTCCGGA TCC TCC TCC TTGCCAGTCC TCCAAAATAT T-3 '; Through PCR reaction, amplification obtains HPV58A.
4, HPV58A fragment and HPV58B cut with restriction enzyme A ccIII enzyme jointly, form special sticky end, use T4 DNA ligase to connect HPV58A and HPV58B fragment, make it to form one and deleted H4 structural domain H4 structural domain, original and be encoded and connect the HPV58C that the nucleoside base sequence of polypeptide GGGSG replaces.
5, expression plasmid pGEX-4T-2 cuts digestion with BamH I and XhoI enzyme, then connects HPV58c and expression plasmid with T4 ligase enzyme.BamH I/XhoI enzyme is cut and is identified the positive expression clone pGEX-4T-2-HPV58C that obtains inserting L1 protein gene fragment.Utilize M13 (+)/(-) primer, record the object nucleotide sequence inserting in plasmid correct, the aminoacid sequence of its coding is SEQ ID NO:8.
All the other operation stepss are with reference to the method for embodiment 1.
Embodiment 5: the structure with the engineering bacteria of HPV58 L1 sequence 10
1, HPV58 L1 full length gene is synthetic by Jin Wei intelligence bio tech ltd (GENEWIZ), its
nucleotidesequence SEQ ID NO:9, it is derived from GeneBank, and sequence number is GenBank:AF335603.1.
2, contain SEQ ID NO:9 gene fragment and do the template that PCR reacts.With forward primer sequence: 5 '-CGCGGATCCGGA AAGGAAGATC CATTAAATAA A-3 '; 5 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA.Downstream comprises XhoI restriction enzyme site, reverse primer sequence: 5 '-GCTCTCCTCGAG TTA TTTTTTAACC TTTTTGCGTT T-3 ', and its 5 ' end is introduced restriction enzyme XhoI site, and XhoI site sequence is CTCGAG.Through PCR reaction, amplification obtains HPV58B.
3, contain SEQ ID NO:9 gene fragment and do the template that PCR reacts.Restriction enzyme BamH I site forward primer sequence to contain introducing: 5 '-CGCGGAGGATCC GGA GGA GGA CTAGCTATTTTATTTTGCGTC
-3 '; 3 ' the end in H4 structure is introduced restriction enzyme A ccIII site, and AccIII site sequence is TCCGGA, reverse primer sequence: 5 '-GCTCTCTCCGGA TCC TCC TCC TTGCCAGTCC TCCAAAATAT T-3 '; Through PCR reaction, amplification obtains HPV58A.
4, HPV58A fragment and HPV58B cut with restriction enzyme A ccIII enzyme jointly, form special sticky end, use T4 DNA ligase to connect HPV58A and HPV58B fragment, make it to form one and deleted H4 structural domain H4 structural domain, original and be encoded and connect the HPV58C that the nucleoside base sequence of polypeptide GGGSG replaces.
5, expression plasmid pGEX-4T-2 cuts digestion with BamH I and XhoI enzyme, then connects HPV58c and expression plasmid with T4 ligase enzyme.BamH I/XhoI enzyme is cut and is identified the positive expression clone pGEX-4T-2-HPV58C that obtains inserting L1 protein gene fragment.Utilize M13 (+)/(-) primer, record the object nucleotide sequence inserting in plasmid correct, the aminoacid sequence of its coding is SEQ ID NO:10.
All the other operation stepss are with reference to the method for embodiment 1.
Embodiment 6: the structure with the engineering bacteria of HPV58 L1 sequence 11
Do with the SEQ ID NO:1 gene fragment that contains of synthesizing the template that PCR reacts, N holds front 8 amino acid to be replaced by GSGGG, and C holds not brachymemma amino acid, and according to the method pcr amplification of above-described embodiment 1, obtaining its object aminoacid sequence is SEQ ID NO:11.
Embodiment 7: great expression and the purifying of restructuring HPV58 L1 albumen
protein expression:in-70 DEG C, take out respectively the frozen bacterial classification of embodiment 1-6, dull and stereotyped activation, cultivates 14-20h for 37 DEG C, chooses lawn in 80mL seed culture medium, cultivates 10-12h for 37 DEG C; Then be inoculated in 50L seeding tank and cultivate 10-12h at 37 DEG C; Be inoculated in afterwards in 500L fermentor tank fermentation culture, abduction delivering; Abduction delivering finishes rear centrifugal collection thalline.With the resuspended thalline of pH7.4 phosphate buffered saline buffer, broken afterwards, breaking method can with but be not limited to: chemistry or the physical means such as high-pressure homogenization, ultrasonic disruption or N,O-Diacetylmuramidase dissolving.Centrifugal, obtain supernatant liquor.Can adopt Lowry method to detect total protein concentration, with Elisa method detection L1 content.
protein purification:supernatant liquor can with but be not limited to saltout, the separation purification method such as isoelectric precipitation, ion exchange chromatography, affinity chromatography, molecular sieve, obtain the pentamer of the HPV58 L1 of purity 98%.Use electron microscopic observation purified product, diameter is the pentamer albumen of 10nm left and right.
Purification process concrete steps be by the L1 albumen in supernatant solution through affinity chromatography purifying: prepackage gsh-agarose resin (Glutathione Sepharose 4 B that GE company produces) chromatographic column.Get concentration and be 50% Glutathione Sepharose 4 B resin homogenate and put into chromatographic column (every 200ml albumen clear liquid needs the homogenate of 5-10ml resin).By the buffer A of 5-10 column volume doubly, (component is: the Tric-HCl of 50mmol/L, the NaCl of 200mmol/, the EDTA of 1mmol/L, pH8.0) washing resin, then albumen clear liquid is added in chromatographic column, evenly and after at room temperature acting on 20 minutes emit filtered solution with mixed with resin, with the buffer A washing resin post of 10 times of column volumes.By buffer A dilution for accurate proteolytic enzyme (Prescission Protease is called for short PP enzyme), loading post cocycle enzyme are cut 120min.Emit enzyme and cut liquid, with appropriate buffer A wash-out and collect target protein.
Ion-exchange chromatogram purification: by Source Q or Mono Q(GE company for the target protein of above-mentioned collection) anion-exchange column carries out ion exchange chromatography, collects target protein.
Molecular sieve chromatography purifying: the target protein that ion-exchange chromatography is collected carries out sieve chromatography with molecular weight at the gel filter medium of 10-600kDa, finally obtains the high purity HPV58 L1 pentamer albumen that purity is greater than 98%.
The morphologic detection of embodiment 8:HPV58 L1 pentamer
The engineering strain that embodiment 1-6 is built is served the order-checking of Hai Shenggong company, record the target DNA sequence of inserting in plasmid, the aminoacid sequence of its coding is shown in SEQID NO:2, SEQID NO:4, SEQID NO:6, SEQID NO:8, SEQID NO:10, SEQID NO:11, wherein embodiment 1-5 result shows that in original full length sequence, H4 structural domain has not existed, and the substitute is " GGA GGA GGA TCC GGA " or " GGA GCC GGA TCC GGA " nucleotide sequence that coding connects polypeptide GGGSG or GAGSG sequence.
The product HPV58 L1 pentamer albumen that the engineering strain that embodiment 1-6 method is obtained adopts the method expression and purification of embodiment 7 to obtain, transmission electron microscope observing (100,000 times), result shows, the pentamer that in the visual field, visible diameter is 13nm left and right, granular size conforms to theoretical size, uniformity.Wherein implement the electromicroscopic photograph of 1 sequence gained sample and see accompanying drawing 1.
Carry out grain diameter mensuration.Instrument is the dynamic light scattering particle instrument of Ma Erwen Zetasizer NanoZS, and use algorithm is Regulation algorithm.Sample is measured after 0.22 u m membrane filtration, the results are shown in Table 1.Result shows, six kinds of basically identical 12.89-14.48nm of pentamer median size, but dispersed indices P dI(shows the homogeneity of albumen) and there is significant difference, wherein the dispersed index of embodiment 1-5 sample is less, and interpret sample is homogeneous very.The dispersed index of embodiment 6 samples is larger, interpret sample heterogeneity.
Table 1 pentamer median size and dispersed index
Wherein the hydrated molecule kinetics median size of the prepared HPV58 L1 pentamer particle of embodiment 1 is 12.53nm, and dispersed indices P dI is that 0.034(is specifically shown in accompanying drawing 2-A); The hydrated molecule kinetics median size of the prepared HPV58 L1 pentamer particle of embodiment 6 is 14.19nm, and dispersed indices P dI is that 0.168(is specifically shown in accompanying drawing 2-B).
Embodiment 9: albumen stoste purity detecting
Chromatographic column is TSK-GEL G3000 SWxl, or identical filler, the chromatographic column of separating ranges 10KDa-500 KDa; 0.1mol/l phosphate buffered saline buffer (take Sodium phosphate dibasic 25.8g, SODIUM PHOSPHATE, MONOBASIC 4.37g, adds ultrapure water and make to dissolve, and adjusts pH to 6.8 with phosphoric acid, and ultrapure water constant volume becomes 1000ml) with pH6.8 is moving phase; Flow velocity is 1ml/min; Detect wavelength 280nm; 25 DEG C of column temperatures, applied sample amount must not be less than 20ug, and sample main peak theoretical plate number is not less than 1000, and tailing factor is less than 2.0, continuous sample introduction 5 pins, the relative standard deviation of peak area must not be greater than 3%.
Get the HPV albumen stoste of embodiment 7 gained, weaker concn is 1mg/ml respectively, applied sample amount 20ul injects high pressure liquid chromatograph, detect according to the method described above, press area percentage calculated purity, the results are shown in the sieve chromatography color atlas that following table 2 and accompanying drawing 3(implement 1 prepared HPV58 L1 pentamer), all processing purity of protein are all greater than 98%.
The purity of albumen stoste after table 2 purifying
Embodiment 10: the preparation that contains HPV58 L1 pentamer protein vaccine
The protein liquid of 100 μ g/ml will be diluted to respectively after embodiment 1-6 preparation with the borate buffer salt of pH7.2 through the HPV58 L1 pentamer albumen stoste of embodiment 7 step purifying, the protein liquid of getting after 1ml dilution adds 50 μ g/ml aluminum hydroxide adjuvants, fully mixing and absorption 2 hours, the HPV58 L1 pentamer protein vaccine that obtains 40 μ g/ml, keeps in Dark Place in 4 DEG C.
The immunogenicity determining of embodiment 11:HPV58 L1 pentamer vaccine
The immunogenicity of mouse: HPV58 L1 pentamer protein vaccine thinner for vaccine prepared by embodiment 10 is diluted to respectively dosage shown in table 1, with every 0.5mL abdominal injection BALB/C mice, 10 of each treatment group.Immunity in every 3 weeks once, is total to immunity 2 times.After each immunity, within three weeks, take respectively every mice serum, adopt in pseudovirus cell and measure respectively the NAT for HPV58 in the mice serum after each immunity with laboratory method.Result is as shown in table 3, after 3 weeks, detects the average titer level of neutralizing antibody as shown in Figure 4 at booster immunization for the second time.
In table 3 pseudovirus cell, detect HPV58 L1 pentamer albumen neutralizing antibody level with laboratory method
Result shows, HPV58 L1 pentamer albumen Mice Inoculated prepared by embodiment, can produce neutralizing antibody after immune 3 weeks for the first time; Neutralizing antibody after second immunisation can reach very high level, and it is as shown in the table respectively.The results show, the HPV L1 pentamer protein vaccine of each embodiment gained sample preparation can produce neutralizing antibody in animal body.Illustrate that HPV L1 pentamer protein vaccine prepared by the present invention has immunogenicity in human clinical trial, can prevent or treat the disease that HPV58 virus causes.
Embodiment 12:HPV58 L1 albumen productivity ratio
To implement the engineering bacteria of 1-6 method structure with reference to the method for embodiment 7, preparation HPV58 L1 albumen, calculation expression amount (with Lowry method detection total protein concentration, with Elisa method detection L1 content), place afterwards the 6-20 hour relatively stability of albumen, result is as shown in table 4.
Table 4 protein content and stability experiment
Result shows, the protein product stability difference of different aminoacids sequence composition.Wherein SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10, the SEQ ID NO:11 not transforming than H4 structural domain prepares HPV58 L1 protein purification product, place the 6-15 hour relatively stability of albumen, there is precipitation at 6 hours in the protein purification product that contains SEQ ID NO:11 sequence, the protein purification product that contains SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 SEQ ID NO:8 and SEQ ID NO:10 sequence was observed and is not occurred precipitation at 15 hours, still kept stable.
SEQUENCE LISTING
<110> Beijing Health Guard Biotechnology Co., Ltd.
VLP vaccine of <120> restructuring HPV-58 type L1 and preparation method thereof
<130> 2014
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 1575
<212> DNA
<213> artificial sequence
<400> 1
atggtgctga ttttatgttg caccctagtt attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtgttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttagtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgttggca taagtggtca tccttattta aataaatttg atgacactga aactggtaac 480
agatataccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcaa 840
atgtttgtta gacacttttt taatagggct ggaacccttg gcgagcctgt cccgaatgac 900
ctttatatta aagggtccgg taatactgca ggtatccaaa gtagtgcatt ttttccaact 960
cctagtggct ccatagttac ctcagaatca caactattta ataagcctta ttggctacag 1020
cgtgcacaag gtcataacaa tgacatttgc tggggcaatc agttatttgt taccgtggtt 1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaaaga agatacatat 1140
aaaaataata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt 1200
tttcagcttt gcaaaattac actaactgca gaggtaatga catatataca tactatgaat 1260
tcagatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag 1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa 1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt 1440
tctgcagatc tggatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa 1500
gcaaagccca gactaaaacg ttcagcccct actacccgtg caccatccac caaacgcaaa 1560
aaggttaaaa aataa 1575
<210> 2
<211> 472
<212> PRT
<213> artificial sequence
<400> 2
Gly Ser Gly Gly Gly Leu Val Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His
130 135 140
Pro Tyr Leu Asn Lys Phe Asp Asp Thr Glu Thr Gly Asn Arg Tyr Thr
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Thr Leu Gly Glu Pro Val Pro Asn Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Gly Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Asp Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Asp Thr Tyr Lys Asn Asn Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Val Met Thr Tyr Ile His Thr Met
405 410 415
Asn Ser Asp Ile Leu Glu Asp Trp Gln Gly Gly Gly Ser Gly Lys Glu
420 425 430
Asp Pro Leu Asn Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys
435 440 445
Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu
450 455 460
Gln Ser Gly Leu Lys Ala Lys Pro
465 470
<210> 3
<211> 1575
<212> DNA
<213> artificial sequence
<400> 3
atggtgctga ttttatgttg caccctagtt attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtgttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttagtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgttggca taagtggtca tccttattta aataaatttg atgacactga aactggtaac 480
agatataccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcaa 840
atgtttgtta gacacttttt taatagggct ggaacccttg gcgagcctgt cccgaatgac 900
ctttatatta aagggtccgg taatactgca ggtatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag 1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt 1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaaaga agatacatat 1140
aaaaataata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt 1200
tttcagcttt gcaaaattac actaactgca gaggtaatga catatataca tactatgaat 1260
tcagatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag 1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa 1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt 1440
tctgcagatc tggatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa 1500
gcaaagccca gactaaaacg ttcagcccct actacccgtg caccatccac caaacgcaaa 1560
aaggttaaaa aataa 1575
<210> 4
<211> 483
<212> PRT
<213> artificial sequence
<400> 4
Gly Ser Gly Gly Gly Leu Val Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His
130 135 140
Pro Tyr Leu Asn Lys Phe Asp Asp Thr Glu Thr Gly Asn Arg Tyr Thr
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Thr Leu Gly Glu Pro Val Pro Asn Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Gly Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Asp Thr Tyr Lys Asn Asn Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Val Met Thr Tyr Ile His Thr Met
405 410 415
Asn Ser Asp Ile Leu Glu Asp Trp Gln Gly Gly Gly Ser Gly Lys Glu
420 425 430
Asp Pro Leu Asn Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys
435 440 445
Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu
450 455 460
Gln Ser Gly Leu Lys Ala Lys Pro Arg Leu Lys Arg Ser Ala Pro Thr
465 470 475 480
Thr Arg Ala
<210> 5
<211> 1575
<212> DNA
<213> artificial sequence
<400> 5
atggtgctga ttttatgttg caccctagtt attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataagaaagt attagttccc aaggtatcag gcttacagta tagggtcttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttggtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgtaggca taagtggtca tccttattta aataaatttg atgacactga aaccagtaac 480
agatatcccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcaa 840
atgtttgtta gacacttttt taatagggct ggaaaacttg gcgaggctgt cccagatgac 900
ctttatatta aagggtccgg taatactgca gttatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag 1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt 1080
gataccactc gtagcactaa tatgacatta tgcactgaag taaataagga aggtacatat 1140
aaaaatgata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt 1200
tttcagcttt gcaaaattac actaactgca gaggtaatga catatataca tactatgaat 1260
tcagatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag 1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa 1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt 1440
tctgcggatc tggatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa 1500
gcaaagccca gactcaaacg ttcggcccct actacccgtg caccatccac caaacgcaaa 1560
aaggttaaaa aataa 1575
<210> 6
<211> 476
<212> PRT
<213> artificial sequence
<400> 6
Gly Ser Gly Ala Gly Ala Asp Val Asn Val Phe His Ile Phe Leu Gln
1 5 10 15
Met Ser Val Trp Arg Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val
20 25 30
Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ser Arg Thr Ser
35 40 45
Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg Leu Leu Ala Val Gly Asn Pro
50 55 60
Tyr Phe Ser Ile Lys Ser Pro Asn Asn Asn Lys Lys Val Leu Val Pro
65 70 75 80
Lys Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Val Arg Leu Pro Asp
85 90 95
Pro Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr
100 105 110
Gln Arg Leu Val Trp Ala Cys Val Gly Leu Glu Ile Gly Arg Gly Gln
115 120 125
Pro Leu Gly Val Gly Ile Ser Gly His Pro Tyr Leu Asn Lys Phe Asp
130 135 140
Asp Thr Glu Thr Ser Asn Arg Tyr Pro Ala Gln Pro Gly Ser Asp Asn
145 150 155 160
Arg Glu Cys Leu Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile
165 170 175
Gly Cys Lys Pro Pro Thr Gly Glu His Trp Gly Lys Gly Val Ala Cys
180 185 190
Asn Asn Asn Ala Ala Ala Thr Asp Cys Pro Pro Leu Glu Leu Phe Asn
195 200 205
Ser Ile Ile Glu Asp Gly Asp Met Val Asp Thr Gly Phe Gly Cys Met
210 215 220
Asp Phe Gly Thr Leu Gln Ala Asn Lys Ser Asp Val Pro Ile Asp Ile
225 230 235 240
Cys Asn Ser Thr Cys Lys Tyr Pro Asp Tyr Leu Lys Met Ala Ser Glu
245 250 255
Pro Tyr Gly Asp Ser Leu Phe Phe Phe Leu Arg Arg Glu Gln Met Phe
260 265 270
Val Arg His Phe Phe Asn Arg Ala Gly Lys Leu Gly Glu Ala Val Pro
275 280 285
Asp Asp Leu Tyr Ile Lys Gly Ser Gly Asn Thr Ala Val Ile Gln Ser
290 295 300
Ser Ala Phe Phe Pro Thr Pro Ser Gly Ser Ile Val Thr Ser Glu Ser
305 310 315 320
Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn
325 330 335
Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr
340 345 350
Thr Arg Ser Thr Asn Met Thr Leu Cys Thr Glu Val Asn Lys Glu Gly
355 360 365
Thr Tyr Lys Asn Asp Asn Phe Lys Glu Tyr Val Arg His Val Glu Glu
370 375 380
Tyr Asp Leu Gln Phe Val Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala
385 390 395 400
Glu Val Met Thr Tyr Ile His Thr Met Asn Ser Asp Ile Leu Glu Asp
405 410 415
Trp Gln Gly Ala Gly Ser Gly Lys Glu Asp Pro Leu Asn Lys Tyr Thr
420 425 430
Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln
435 440 445
Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Leu Lys Ala Lys
450 455 460
Pro Arg Leu Lys Arg Ser Ala Pro Thr Thr Arg Ala
465 470 475
<210> 7
<211> 1575
<212> DNA
<213> artificial sequence
<400> 7
atggtgctga ttttatgttg caccctagct attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtcttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttggtctg ggcatgtgta ggccttaaaa taggtagggg acagccattg 420
ggtgttggcg taagtggtca tccttattta aataaatttg atgacactga aaccagtaac 480
agatatcccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcag 840
atgtttgtta gacacttttt taatagggct ggaaaacttg gcgaggctgt cccggatgac 900
ctttatatta aagggtccgg taatactgca gttatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag 1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt 1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaagga aggtacatat 1140
aaaaatgata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt 1200
tttcagcttt gcaaaattac actaactgca gagataatga catatataca tactatggat 1260
tccaatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag 1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa 1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt 1440
tctgcagatc tagatcagtt tcctttggga ccaaagtttt tattacaatc aggccttaaa 1500
gcaaagccca gactaaaacg ttcggcccct actacccgtg caccatccac caaacgcaaa 1560
aaggttaaaa aataa 1575
<210> 8
<211> 465
<212> PRT
<213> artificial sequence
<400> 8
Ala Ser Ala Ser Gly Ala Asp Val Asn Val Phe His Ile Phe Leu Gln
1 5 10 15
Met Ser Val Trp Arg Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val
20 25 30
Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ser Arg Thr Ser
35 40 45
Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg Leu Leu Ala Val Gly Asn Pro
50 55 60
Tyr Phe Ser Ile Lys Ser Pro Asn Asn Asn Lys Lys Val Leu Val Pro
65 70 75 80
Lys Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Val Arg Leu Pro Asp
85 90 95
Pro Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr
100 105 110
Gln Arg Leu Val Trp Ala Cys Val Gly Leu Lys Ile Gly Arg Gly Gln
115 120 125
Pro Leu Gly Val Gly Val Ser Gly His Pro Tyr Leu Asn Lys Phe Asp
130 135 140
Asp Thr Glu Thr Ser Asn Arg Tyr Pro Ala Gln Pro Gly Ser Asp Asn
145 150 155 160
Arg Glu Cys Leu Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile
165 170 175
Gly Cys Lys Pro Pro Thr Gly Glu His Trp Gly Lys Gly Val Ala Cys
180 185 190
Asn Asn Asn Ala Ala Ala Thr Asp Cys Pro Pro Leu Glu Leu Phe Asn
195 200 205
Ser Ile Ile Glu Asp Gly Asp Met Val Asp Thr Gly Phe Gly Cys Met
210 215 220
Asp Phe Gly Thr Leu Gln Ala Asn Lys Ser Asp Val Pro Ile Asp Ile
225 230 235 240
Cys Asn Ser Thr Cys Lys Tyr Pro Asp Tyr Leu Lys Met Ala Ser Glu
245 250 255
Pro Tyr Gly Asp Ser Leu Phe Phe Phe Leu Arg Arg Glu Gln Met Phe
260 265 270
Val Arg His Phe Phe Asn Arg Ala Gly Lys Leu Gly Glu Ala Val Pro
275 280 285
Asp Asp Leu Tyr Ile Lys Gly Ser Gly Asn Thr Ala Val Ile Gln Ser
290 295 300
Ser Ala Phe Phe Pro Thr Pro Ser Gly Ser Ile Val Thr Ser Glu Ser
305 310 315 320
Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn
325 330 335
Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr
340 345 350
Thr Arg Ser Thr Asn Met Thr Leu Cys Thr Glu Val Thr Lys Glu Gly
355 360 365
Thr Tyr Lys Asn Asp Asn Phe Lys Glu Tyr Val Arg His Val Glu Glu
370 375 380
Tyr Asp Leu Gln Phe Val Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala
385 390 395 400
Glu Ile Met Thr Tyr Ile His Thr Met Asp Ser Asn Ile Leu Glu Asp
405 410 415
Trp Gln Gly Gly Gly Ser Gly Lys Glu Asp Pro Leu Asn Lys Tyr Thr
420 425 430
Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln
435 440 445
Phe Pro Leu Gly Pro Lys Phe Leu Leu Gln Ser Gly Leu Lys Ala Lys
450 455 460
Pro
465
<210> 9
<211> 1575
<212> DNA
<213> artificial sequence
<400> 9
atggtgctga ttttatgttg caccctagct attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtcttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttggtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgttggcg taagtggtca tccttgttta aataaatttg atgacactga aaccagtaac 480
agatatcccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcag 840
atgtttgtta gacacttttt taatagggct ggaaaacttg gcgaggctgt cccggatgac 900
ctttatatta aagggtccgg taatactgca gttatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag 1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt 1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaagga aggtacatat 1140
aaaaatgata attttaagga atatgtacgt catgttgaag agtatgactt acagtttgtt 1200
tttcagcttt gcaaaattac actaactgca gagataatga catatataca tactatggat 1260
tccaatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag 1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa 1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt 1440
tctgcagatc tagatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa 1500
gcaaagccca gactaaaacg ttcggcccct actacccgtg caccatccac caaacgcaaa 1560
aaggttaaaa aataa 1575
<210> 10
<211> 493
<212> PRT
<213> artificial sequence
<400> 10
Gly Ser Gly Gly Gly Leu Ala Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His
130 135 140
Pro Cys Leu Asn Lys Phe Asp Asp Thr Glu Thr Ser Asn Arg Tyr Pro
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Lys Leu Gly Glu Ala Val Pro Asp Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Val Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Gly Thr Tyr Lys Asn Asp Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Ile Met Thr Tyr Ile His Thr Met
405 410 415
Asp Ser Asn Ile Leu Glu Asp Trp Gln Gly Gly Gly Ser Gly Lys Glu
420 425 430
Asp Pro Leu Asn Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys
435 440 445
Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu
450 455 460
Gln Ser Gly Leu Lys Ala Lys Pro Arg Leu Lys Arg Ser Ala Pro Thr
465 470 475 480
Thr Arg Ala Pro Ser Thr Lys Arg Lys Lys Val Lys Lys
485 490
<210> 11
<211> 521
<212> PRT
<213> artificial sequence
<400> 11
Gly Ser Gly Gly Gly Leu Val Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His
130 135 140
Pro Tyr Leu Asn Lys Phe Asp Asp Thr Glu Thr Gly Asn Arg Tyr Thr
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Thr Leu Gly Glu Pro Val Pro Asn Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Gly Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Asp Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Asp Thr Tyr Lys Asn Asn Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Val Met Thr Tyr Ile His Thr Met
405 410 415
Asn Ser Asp Ile Leu Glu Asp Trp Gln Phe Gly Leu Thr Pro Pro Pro
420 425 430
Ser Ala Ser Leu Gln Asp Thr Tyr Arg Phe Val Thr Ser Gln Ala Ile
435 440 445
Thr Cys Gln Lys Thr Ala Pro Pro Lys Glu Lys Glu Asp Pro Leu Asn
450 455 460
Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp
465 470 475 480
Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Leu
485 490 495
Lys Ala Lys Pro Arg Leu Lys Arg Ser Ala Pro Thr Thr Arg Ala Pro
500 505 510
Ser Thr Lys Arg Lys Lys Val Lys Lys
515 520
Claims (15)
1. a HPV58 L1 albumen for restructuring, at 8-15 amino acid of N end, whole or arbitrary portion is replaced by 2-10 aminoacid sequence the aminoacid sequence that it is characterized in that described albumen, and its aminoacid sequence is by arbitrary array mode of G, S, A three; H4 structural domain is replaced by 2-10 aminoacid sequence, and its aminoacid sequence is by arbitrary array mode of G, S, A three.
2. HPV58 L1 albumen as claimed in claim 1, is characterized in that 0-21 amino acid of its aminoacid sequence C end brachymemma, preferably 10 or 21 amino acid of brachymemma.
3. HPV58 L1 albumen as claimed in claim 1 or 2, is characterized in that front 8-15 the amino acid of its aminoacid sequence N end is replaced by GSGGG, ASASG or GSGAG, and H4 structural domain is replaced by GGGSG or GAGAS.
4. HPV58 L1 albumen as claimed in claim 3, is characterized in that its aminoacid sequence is preferably replaced by GSGGG or GAGA aminoacid sequence at front 8,10 or 15 amino acid of N end.
5. HPV58 L1 albumen as claimed in claim 4, is characterized in that its sequence comprises sequence SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or SEQ ID NO:10.
6. the polynucleotide of the albumen of coding claim 1-5 any one.
7. comprise the expression vector of the polynucleotide of claim 5.
8. comprise the cell of the expression vector of claim 7.
9. a HPV58 L1 albumen pentamer, is characterized in that this albumen pentamer is formed by the arbitrary described albumen of claim 1 to 5.
10. a HPV58 L1 albumen VLP, is characterized in that this albumen VLP is formed by the arbitrary described albumen of claim 1 to 5.
11. 1 kinds of HPV vaccines, is characterized in that this vaccine comprises HPV58 L1 albumen pentamer claimed in claim 9 and medicinal adjuvant.
12. 1 kinds of HPV vaccines, is characterized in that this vaccine comprises HPV58 L1 albumen VLP claimed in claim 10 and medicinal adjuvant.
The preparation method of 13. HPV vaccines as claimed in claim 11, is characterized in that the method is:
The gene fragment of clone or synthetic restructuring HPV58 L1 albumen;
In intestinal bacteria or yeast expression system, express the HPV58 L1 albumen of restructuring;
The pentamer that purifying is made up of HPV58 L1 albumen;
HPV58 L1 albumen pentamer adds medicinal adjuvant to make vaccine.
14. HPV58 L1 albumen pentamers as claimed in claim 9 are in the application preventing and/or treating in the medicine that comprises HPV58 infection and cause disease.
15. HPV58 L1 vaccines as described in claim 11 or 12 comprise that HPV58 infects and causes the application in the medicine of disease preventing and/or treating.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410054216.6A CN103992395B (en) | 2013-02-18 | 2014-02-18 | Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310052472 | 2013-02-18 | ||
| CN201310052472.7 | 2013-02-18 | ||
| CN2013100524727 | 2013-02-18 | ||
| CN201410054216.6A CN103992395B (en) | 2013-02-18 | 2014-02-18 | Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103992395A true CN103992395A (en) | 2014-08-20 |
| CN103992395B CN103992395B (en) | 2018-07-27 |
Family
ID=51306758
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410054216.6A Active CN103992395B (en) | 2013-02-18 | 2014-02-18 | Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103992395B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713087A (en) * | 2014-11-12 | 2016-06-29 | 北京康乐卫士生物技术股份有限公司 | Human papillomavirus 58 monoclonal antibody and application thereof |
| EP3385273A4 (en) * | 2015-12-04 | 2019-08-07 | Xiamen University | Mutant of human papillomavirus type 58 l1 protein |
| CN114716562A (en) * | 2021-01-04 | 2022-07-08 | 中国医学科学院基础医学研究所 | Human papilloma virus 58 type chimeric protein and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1942583A (en) * | 2003-11-12 | 2007-04-04 | 默克公司 | Optimized expression of HPV 58 L1 in yeast |
| CN101116745A (en) * | 2006-08-04 | 2008-02-06 | 长春百克生物科技有限公司 | Human papilloma virus sample particle vaccines |
| CN101245099A (en) * | 2007-02-14 | 2008-08-20 | 马润林 | Amino acid sequence of recombined human papilloma virus L1 capsid protein and uses thereof |
| CN101481408A (en) * | 2008-01-07 | 2009-07-15 | 马润林 | Modification sequence of recombinant human mammilla tumor virus L1 capsid protein for preventing high polymerization |
-
2014
- 2014-02-18 CN CN201410054216.6A patent/CN103992395B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1942583A (en) * | 2003-11-12 | 2007-04-04 | 默克公司 | Optimized expression of HPV 58 L1 in yeast |
| CN101116745A (en) * | 2006-08-04 | 2008-02-06 | 长春百克生物科技有限公司 | Human papilloma virus sample particle vaccines |
| CN101245099A (en) * | 2007-02-14 | 2008-08-20 | 马润林 | Amino acid sequence of recombined human papilloma virus L1 capsid protein and uses thereof |
| CN101481408A (en) * | 2008-01-07 | 2009-07-15 | 马润林 | Modification sequence of recombinant human mammilla tumor virus L1 capsid protein for preventing high polymerization |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713087A (en) * | 2014-11-12 | 2016-06-29 | 北京康乐卫士生物技术股份有限公司 | Human papillomavirus 58 monoclonal antibody and application thereof |
| CN105713087B (en) * | 2014-11-12 | 2020-05-08 | 北京康乐卫士生物技术股份有限公司 | Human papilloma virus 58 monoclonal antibody and application thereof |
| EP3385273A4 (en) * | 2015-12-04 | 2019-08-07 | Xiamen University | Mutant of human papillomavirus type 58 l1 protein |
| US10940194B2 (en) | 2015-12-04 | 2021-03-09 | Xiamen University | Mutant of L1 protein of human papillomavirus type 58 |
| CN114716562A (en) * | 2021-01-04 | 2022-07-08 | 中国医学科学院基础医学研究所 | Human papilloma virus 58 type chimeric protein and application thereof |
| CN114716562B (en) * | 2021-01-04 | 2023-11-10 | 中国医学科学院基础医学研究所 | Human papilloma virus 58 chimeric protein and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103992395B (en) | 2018-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101293918B (en) | Shorten human papilloma virus 16 type L1 protein | |
| CN102229660B (en) | Truncated human papillomavirus 33 type L1 protein | |
| CN101343314B (en) | The Human Papillomavirus Type 11 L1 albumen of brachymemma | |
| CN103936840B (en) | Human papillomavirus 33 type L 1 protein of recombination and application thereof | |
| CN101245099A (en) | Amino acid sequence of recombined human papilloma virus L1 capsid protein and uses thereof | |
| CN105039358A (en) | Virus-like particles of 58-type recombinant human papilloma virus and preparation method thereof | |
| EP2589604B1 (en) | Truncated l1 protein of human papillomavirus type 52 | |
| CN101343315B (en) | Shorten human papilloma virus 6 type L1 protein | |
| US9738691B2 (en) | Truncated L1 protein of human papillomavirus type 58 | |
| CN101570571B (en) | Truncated human papilloma virus 18 type L1 protein | |
| KR20210018351A (en) | Mutant of type 39 human papillomavirus L1 protein | |
| CN103992395A (en) | VLP vaccine of recombinant HPV-58 L1 and preparation method thereof | |
| CN104045696A (en) | Recombinant human papilloma virus 16L1 protein and its use | |
| CN103819543A (en) | Recombinant protein HPV6L1 (Human Papilloma Virus 6 L1) and application thereof | |
| CN104211782B (en) | The type L1 albumen of HPV 45 of truncation | |
| CN104045695B (en) | HPV 18 L1 albumen of recombination and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |