CN103992395B - Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 - Google Patents
Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 Download PDFInfo
- Publication number
- CN103992395B CN103992395B CN201410054216.6A CN201410054216A CN103992395B CN 103992395 B CN103992395 B CN 103992395B CN 201410054216 A CN201410054216 A CN 201410054216A CN 103992395 B CN103992395 B CN 103992395B
- Authority
- CN
- China
- Prior art keywords
- leu
- gly
- val
- ser
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20023—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides a kind of polynucleotides genetic fragment of the HPV58 L1 albumen of new coding recombination, the carrier comprising the genetic fragment includes the host cell of carrier, and HPV58 L1 albumen pentamers or VLP by the genetic fragment accurate translation, and be made from it anti-HPV58 types infection vaccine.
Description
Technical field
The present invention relates to the prevention of human papilloma virus infection and/or treatments.More particularly it relates to one
The human papillomavirus type 58 L1 albumen of kind of recombination, and the pentamer and VLP that are made from it, vaccine containing the albumen and its pre-
Purposes in anti-HPV58 types virus infection, especially the cervical carcinoma disease caused by preventing the infection of HPV58 type viruses.
Background technology
Human papilloma virus (Human Papillomavirus, abbreviation HPV) is propagated by close contact
DNA virus.In tissue, HPV main infections skin and mucous membrane tissue.HPV DNA are divided by the size of Viral Carcinogenesis ability
For three classes：(1) low risk HPV, including HPV6,11,40,42,43,44,54,61,70.72.51, mainly cause benign exophytic
Wart, Cervical intraepitheliaI neoplasia (cervical intraepithelial neoplasm, CIN) (2) high-risk HPV, including HPV
16,18,31,33,35,39,43,51,52,56,58,59,68,73,82, mainly cause middle and high degree tumor in epithelium of cervix uteri to become
(CINII, CTNIII) and cervical invasion type squamous carcinoma are most commonly that HPV 16,18.(3) it is potentially carcinogenic type, including HPV 26,
53,66 (Munoz N, Bosch Fx, Sanjose S, et a1.Epidemiologie classification of human
Papilloma virus types associated with cervical cancer [J] .N Engl J Med, 2003,
348：8).Cervical carcinoma is the second largest malignant tumour of women, and the morbidity in the annual whole world is probably in 540,000 (2013), and there are about 240,000
Death, fortunately, cervical carcinoma are uniquely to develop the cancer of vaccine.On June 8th, 2006, U.S. Food and Drug Administration
(FDA) the Gardasil HPV preventative vaccines listing of official approval U.S. Merck companies (i.e. MSD Corp.) production；It is
The HPV16/18/6/11L1VLP tetravalence cancer, prophylaxis vaccines expressed by saccharomyces cerevisiae and purified, are approved for prevention 6
~26 years old girls and the type of women HPV16,18,6,11 infect caused cervical carcinoma, precancerous lesion and genital wart, this is FDA
By first tumor vaccine (Villa, Costa et al.2005, Villa, Ault et al.2006, Bryan in the world
2007,Olsson,Villa et al.2007,Goldstone and Vuocolo 2012).Subsequent Britain GlaxoSmithKline PLC
(GSK) the HPV preventative vaccines of the trade name Cervarix of company's production also successfully list, it is that origin is expressed derived from insect
The HPV16/18L1VLP divalent cancer, prophylaxis vaccines of system.But both preventative vaccines are expensive, strongly limit
In the use of developing country and backward areas, therefore a kind of high-titer HPV vaccines of low cost of exploitation are just particularly important
(Jansen and Shaw 2004,Buonaguro,Tornesello et al.2009,Campo and Roden 2010,
Frazer,Leggatt et al.2011,Hariri,Dunne et al.2011,Lehtinen and Dillner 2013,
Shaw 2013)。
HPV belongs to Papovaviridae (Papovaviridae) Papillomavirus, for no coating DNA virus.Disease
Virus gene group is double-strand closed-circular DNA, and size is about 7.2~8kb, has 8 open frames.Genome can be divided by the difference of function
For three regions：Early stage area (E), about 4.5kb encode E1, E2, E4~E7 totally 6 and virus replication, transcribe and convert and is related
Non-structural protein；Late region (L), about 2.5kb encode Major capsid protein L1 and secondary capsid protein L2；Long control region
(LCR), between the areas L end and the areas E initiating terminal, it is about 800~900bp, does not encode any albumen, containing DNA replication dna, expression
Controlling element.
HPV viruse particle diameter is 55~60nm, and nucleocapsid is symmetrical in 20 face bodies, by the five of 72 Major capsid protein L1s
Aggressiveness and secondary capsid protein L2 compositions.Numerous studies confirm that HPV L1 albumen is the major target proteins of HPV vaccines.A variety of
To may be formed at morphosis similar to natural viral particle without L2 albumen auxiliary for the HPV L1 albumen expressed in expression system
Viruslike particle (Virus-L1keParticle, VLP).Recombination HPV L1-VLP vaccines have been successfully listed and are used to prevent
HPV infection and thus caused by the diseases such as cervical carcinoma, condyloma acuminatum, and fully demonstrate L1-VLP and have and wild homologous virus
Identical antigenicity and immunogenicity.In terms of the tertiary structure of composition VLP, antigenic determinant is distributed in the base of composition VLP
Surface (Xiaojiang S.Chen, Robert L.Garcea, the Ilya Goldberg, Gregory of this structural unit pentamer
Casini and Stephen C.(2000).
HarrisonStructure of Small Virus-like Particles Assembled from the
L1Protein of Human Papillomavirus 16.Molecular Cell,Vol.5,557–567.Brooke
Bishop,Jhimli Dasgupta,Michael Klein,Robert L.Garcea,Neil D.Christensen,Rui
Zhaoand Xiaojiang S.Chen.(2007).Crystal Structures of Four Types of Human
Papillomavirus L1Capsid Proteins.THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL.282,
NO.43, pp.31803-31811), illustrate that the antigenicity of HPV L1-VLP and immunogenicity are derived from or formed depending on L1
Pentamer.Therefore, recombination L1 albumen pentamers have complete epitope as VLP, can both antigen are used as to use
To prepare vaccine.
The key of HPV vaccine developments is largely can efficiently to prepare HPV L1 albumen.Current more common expression system
Eukaryotic expression system and prokaryotic expression system can be divided into.Common eukaryotic expression system has pox viruses express system, insect bar
Shape virus expression systems, yeast expression system.Expressed HPV L1 albumen native conformations destroy few in eukaryotic expression system,
The spontaneous formation VLP of energy often need to only carry out simply purifying and can be obtained VLP.But due to the expression of eukaryotic expression system
Measure low, toxigenic capacity is high, and extreme difficulties are brought to large-scale industrial production.Escherichia coli table is utilized in prokaryotic expression system
It is had been reported up to system expression HPVL1 albumen.But since the HPV L1 albumen expressed by Escherichia coli loses it naturally mostly
Conformation cannot generate the protection antibody for HPV.Although above-mentioned albumen is purified by occlusion body, renaturation and etc. also may be used
The VLP of HPV is obtained, but loss of proteins amount is big in renaturation process, yield is low, it is difficult to be applied in large-scale production.HPV
Although L1 full length sequences albumen can also in Escherichia coli with correct conformation it is soluble express, be dissolved in the cracking of thalline
In clear, but expression quantity is relatively low, and foreign protein type is more in supernatant and amount is big, and it is suitable to be therefrom purified into destination protein difficulty
Greatly, large-scale production can not be still applied to.
Therefore, this field there is still a need at low cost, purity is high, yield is high, effect is good HPV L1 protein productions technologies and
Large-scale industrial production prevents the new method of vaccine for cervical cancer.
Invention content
The object of the present invention is to provide a kind of new humanpapilloma virus 58 L1 proteins, and the pentamer albumen particle that is made from it and contain
The vaccine of the pentamer albumen particle.
The present invention relates to a kind of polynucleotides genetic fragment of the humanpapilloma virus 58 L1 protein of new coding recombination is provided, comprising should
The carrier of genetic fragment including the host cell of carrier, and the humanpapilloma virus 58 L1 protein pentamer by the genetic fragment accurate translation
With the vaccine for the anti-HPV58 types infection being made of the pentamer.
The invention discloses a kind of amino acid sequences of the humanpapilloma virus 58 L1 protein of recombination, and the amino acid sequence of the albumen is in N
The 8-15 amino acid whole in end or arbitrary portion are replaced by 2-10 amino acid sequence, and amino acid sequence is by G, S, A three
Any combination mode；H4 structural domains are replaced by 2-10 amino acid sequence, and amino acid sequence is by any group of G, S, A three
Conjunction mode.
Humanpapilloma virus 58 L1 protein of the present invention is further that its amino acid sequence C-terminal truncates 0,1,2 to 21
Amino acid.
Humanpapilloma virus 58 L1 protein of the present invention, preferably by 8-15 amino acid before its amino acid sequence N-terminal by GSGGG,
ASASG or GSGAG substitutions, H4 structural domains are preferably replaced by GGGSG or GAGAS.
Humanpapilloma virus 58 L1 protein as described embodiments, preferably its amino acid sequence are 8 before N-terminal, 10,12 or 15 amino acid
It is preferred that being replaced by GSGGG or ASASG amino acid sequences.C-terminal preferably truncates 10-21 amino acid, more preferably truncates 10,21
Amino acid.
Humanpapilloma virus 58 L1 protein as described embodiments, sequence include sequence SEQ ID NO：2、SEQ ID NO：4、SEQ
ID NO：6、SEQ ID NO：8 or SEQ ID NO：10.
The present invention discloses a kind of polynucleotide sequence of coding albumen.It includes polynucleotide sequence that the present invention, which discloses a kind of,
The expression vector of gene.The present invention discloses a kind of cell including expression vector.
The present invention discloses a kind of humanpapilloma virus 58 L1 protein pentamer, and the albumen pentamer is by five humanpapilloma virus 58 L1 protein monomer shapes
At.
The present invention discloses a kind of humanpapilloma virus 58 L1 protein virus-like particle (VLP), which is that icosahedron solid is right
Claim structure, is made of the pentamer of 72 L1 albumen.
The present invention discloses a kind of HPV vaccines, which includes humanpapilloma virus 58 L1 protein pentamer or VLP and medicinal adjuvant.
The present invention discloses a kind of preparation method of HPV vaccines, and this method is：
A. clone or synthesize the genetic fragment of recombination humanpapilloma virus 58 L1 protein；
B. the humanpapilloma virus 58 L1 protein of recombination is expressed in Escherichia coli or yeast expression system；
C. it purifies the pentamer being made of humanpapilloma virus 58 L1 protein or is further assembled into VLP；
D. medicinal adjuvant is added, vaccine is made.
The purifying of step C is preferably by affinity chromatography chromatogram purification HPV58L1 fusion tag albumen in the above method.
The present invention discloses HPV vaccines and prevents and/or treatment includes during HPV58 infects and leads to the drug of disease preparing
Using.
First aspect present invention provides a kind of polynucleotides genetic fragment of coding recombination humanpapilloma virus 58 L1 protein.
Second aspect of the present invention provides a kind of expression vector of structure, and it includes the recombinations of the coding of first aspect present invention
The polynucleotides genetic fragment of humanpapilloma virus 58 L1 protein.The carrier is suitble to drive allogeneic dna sequence DNA thin in bacterium, insect or mammal
Accurate translation humanpapilloma virus 58 L1 protein in born of the same parents.In one embodiment, the expression vector preferred pGEX-6p-1 or pGEX-4T-
2。
The third aspect of the present invention provides a kind of engineering bacteria cell of structure, which includes first aspect present invention
The expression vector of polynucleotides genetic fragment or second aspect.The engineering bacteria host cell can be bacterial cell, such as
Escherichia coli can be eukaryocyte, such as yeast cells or insect cell.
Fourth aspect present invention provides a kind of Pharmaceutical composition, and it includes the expression products using the technology of the present invention production
Humanpapilloma virus 58 L1 protein, excipient or carrier.
Invention also provides the polynucleotide sequence, the expression vector structures that prepare above-mentioned coding recombination humanpapilloma virus 58 L1 protein
It builds, the method for engineering bacteria cell transformation and Pharmaceutical composition.
The present invention obtain humanpapilloma virus 58 L1 protein method comprising expressed in expression system recombination humanpapilloma virus 58 L1 protein and
Then cracking supernatant containing the recombinant protein is carried out purification process by its pentamer.It is specific to obtain humanpapilloma virus 58 L1 protein pentamer
Method include：
1. the piece of clone or artificial synthesized coding HPV58L1 full-length proteins gene or truncated protein gene from clinical sample
Section.
2. expressing the L1 albumen of recombination in Escherichia coli or yeast expression system.
3. purifying HPV58L1 recombinant proteins.
In one embodiment, the preferred method of acquisition recombination humanpapilloma virus 58 L1 protein includes：
1-15, the ends 1.N amino acid whole or arbitrary portion are replaced by GSGGG, H4 structural domains are replaced by GGGSG sequences
HPV58L1 recombinant proteins.
2. expressing the L1 albumen of recombination in Escherichia coli or yeast expression system.
3. purifying HPV58L1 recombinant proteins.
N-terminal truncates 8 amino acid and is replaced by GSGGG in 1 scheme of preferred embodiment, and H4 structural domains are by GGGSG sequences
Substitution, while C-terminal truncates 21 amino acid, SEQ ID NO：2.
N-terminal truncates 8 amino acid and is replaced by GSGGG in 2 scheme of preferred embodiment, and H4 structural domains are by GGGSG
Sequence replaces, while C-terminal truncates 10 amino acid, SEQ ID NO：4.
N-terminal truncates 15 amino acid and is replaced by GSGAG in 3 scheme of preferred embodiment, and H4 structural domains are by GAGSG
Sequence replaces, while C-terminal truncates 10 amino acid, SEQ ID NO：6.
N-terminal truncates 15 amino acid and is replaced by ASASG in 4 scheme of preferred embodiment, and H4 structural domains are by GGGSG
Sequence replaces, while C-terminal truncates 21 amino acid, SEQ ID NO：8.
N-terminal truncates 8 amino acid and is replaced by GSGGG in 5 scheme of preferred embodiment, and H4 structural domains are by GGGSG
Sequence replaces, while C-terminal reservation does not truncate, SEQ ID NO：10.
8 amino acid are replaced by GSGGG before N-terminal in 6 scheme of embodiment of comparison, and H4 structural domains do not replace, and C-terminal retains
It does not truncate.
The present invention separately provides Pharmaceutical composition of the present invention and is preparing prevention or the infection for the treatment of HPV58 types and leading to disease medicine
Application in object.
The invention further relates to a kind of prevention cervical carcinoma or the vaccines of HPV infection, and it includes the HPV58L1 five that the present invention recombinates
Aggressiveness, or the VLP or polymer that are made of pentamer, including 1,2,3,4,5 ... 200 pentamer.It is preferred that the vaccine is also
It is selected from HPV6L1 pentamers including at least one, HPV11L1 pentamers, HPV16L1 pentamers, HPV18L1 pentamers,
HPV31L1 pentamers, HPV35L1 pentamers, HPV45L1 pentamers, HPV52L1 pentamers, HPV58L1 pentamers, Yi Jiyou
Divalent, trivalent, tetravalence, pentavalent, sexavalence, septivalency, octavalence, nine valences or the ten valence vaccines of above-mentioned pentamer composition.The vaccine is usual
Also include vaccine excipient or carrier.
Preferably, every dose of amount containing the humanpapilloma virus 58 L1 protein of the invention recombinated of the vaccine is 1 μ g-200 μ g, preferably 5 μ
g-50μg.The vaccine contains the HPV58L1 that the present invention recombinates and HPV6L1 according to 0.5-2：The vaccine of 1 ratio composition, recombination
HPV58L1 and HPV11L1 according to 0.5-2：The vaccine of 1 ratio composition, the HPV58L1 and HPV16L1 of recombination are according to 0.5-2：1
The vaccine of ratio composition, the HPV58L1 and HPV18L1 of recombination are according to 0.5-2：The vaccine of 1 ratio composition, the HPV58L1 of recombination
With HPV31L1 according to 0.5-2：The vaccine of 1 ratio composition, the HPV58L1 and HPV33L1 of recombination are according to 0.5-2：1 ratio forms
Vaccine, the HPV58L1 and HPV45L1 of recombination are according to 0.5-2：The vaccine of 1 ratio composition, the HPV58L1 and HPV52L1 of recombination
According to 0.5-2：The vaccine of 1 ratio composition, and the HPV58L1 pentamers by recombinating are formed with above-mentioned various HPV L1 pentamers
Divalent, trivalent, tetravalence, pentavalent, sexavalence, septivalency vaccine or be further combined nine valences to be formed or ten valence epidemic diseases on this basis
Seedling.
The invention further relates to a kind of methods prepared for preventing cervical carcinoma or HPV infection vaccine, and it includes present invention weights
The HPV58L1 pentamers of group, or the polymer that is made of pentamer with it is optional it is one or more be selected from HPV58,6,11,
The pentamer and vaccine carrier or excipient of 16,18,31,33,45 and 52 HPV types mix.
The invention further relates to comprising the HPV58L1 pentamers that recombinate of the present invention, VLP or it is made of pentamer more
Aggressiveness is being prepared for preventing the purposes in cervical carcinoma or HPV58 infection vaccines.
The explanation of relational language and explanation in the present invention
According to the present invention, term " escherichia expression system " refers to being made of with expression vector Escherichia coli (bacterial strain),
Wherein Escherichia coli (bacterial strain) derive from available on the market, illustrate but are not limited to herein：GI698, ER2566, BL21
(DE3), B834 (DE3), BLR (DE3) etc..
According to the present invention, term " carrier " word, which refers to, to be inserted the polynucleotides of certain coding albumen and make
Albumen obtains a kind of nucleic acid delivery vehicle of expression.Carrier can make its carrying by conversion, transduction or transfection host cell
Inhereditary material element expressed in host cell.For example, carrier includes：Plasmid, bacteriophage, coemid etc..
According to the present invention, term " vaccine excipient or carrier " refers to selected from one or more, including but not limited to：pH
Conditioning agent, surfactant, adjuvant, ionic strength reinforcing agent.For example, pH adjusting agent citing but it is not limited to phosphate buffer,
Surfactant includes cation, anion or nonionic surface active agent.It illustrates but is not limited to：Tween-80.Adjuvant
It illustrates but is not limited to aluminium hydroxide, aluminum phosphate, unformed aluminium hydroxyphosphate sulfate, Fu Shi Freund's complete adjuvants.Ionic strength reinforcing agent
It illustrates but is not limited to sodium chloride.
According to the present invention, term " chromatography " includes but not limited to：Ion-exchange chromatography, hydrophobic interaction chromatograph,
Adsorption chromatography (such as hydroxylapatite chromatography), gel filtration (gel exclusion) chromatography, affinity chromatography.
According to the present invention, term " HPV58L1H4 structural domains " refers to " FG LTPPPSASLQ in HPV58L1 DNA sequence dnas
DTYRFVTSQA ITCQKTAPPK E ", the 429th bit amino in the L1 protein sequences that Genebank accession number is AEI61781
Corresponding amino acid position in acid to 461 amino acids or other HPV58L1 sequences.
According to the present invention, in the method for the recombination humanpapilloma virus 58 L1 protein that the present invention obtains, buffer solution refers to can be in certain model
The interior solution for maintaining pH stable is enclosed, including but not limited to, Tris buffer solutions, phosphate buffer, HEPES buffer solution, MOPS
Buffer solution etc..
According to the present invention, the prokaryotic host cell is broken include but not limited to by homogenizer broken, homogeneous crusher machine,
One or more method in ultrasonication, grinding, high-pressure extrusion, bacteriolyze enzymatic treatment is realized；
According to the present invention, in the method for the recombination humanpapilloma virus 58 L1 protein that the present invention obtains, salt used includes but not limited to
It is neutral salt, especially alkali metal salt, ammonium salt, hydrochloride, sulfate, sulfate, bicarbonate, phosphate or hydrophosphate,
One or more of especially NaCI, KCI, NH4CI, (NH4) 2S04.It is preferred that NaCI.Reducing agent used includes but unlimited
In DTT, 2 mercapto ethanol.Amount used includes but not limited to lOmM-lOOmM.
According to the present invention, the acceptable form of patient can be used in the vaccine, including but not limited to injection or nasal cavity or
Oral cavity sucks or vagina administration, optimizing injection.
According to the present invention, term " valence " refers to the quantity for the genotype that the component of composition vaccine is included.For example
The vaccine of HPV16 and 18 type antigens composition is known as " divalent " vaccine.
The present inventor it has been investigated that, by the genetic recombination to humanpapilloma virus 58 L1 protein N-terminal, C-terminal and the regions H4, recycle
Escherichia expression system carries out expression and can be obtained a large amount of recombination GST-HPV58L1 pentamer fusion proteins, the GST-
The HPV58L1 pentamer albumens of high yield, purity at least 85% can be obtained in HPV58L1 pentamer albumens after affinitive layer purification
More than.HPV58L1 pentamer albumens after being further purified can reach 98% or more purity and can induce and protected for HPV58
Property antibody.The present invention is based on the above inventions to have completed, and the vaccine for preventing cervical carcinoma for large-scale industrial production provides one
Kind new method.
Increase GSGGG or GSGAG in N-terminal in the present invention, and blended with GST albumen, is greatly improved L1 albumen
Solubility, and digesting efficiency is improved, purifying cost is reduced, while GST albumen is cut off using protease hydrolyzed method, eliminated
The introducing of external source impurity；Replace H4 structural domains with GSGGG or GAGAS, L1 albumen can be prevented to polymerize, it is uniform, steady to obtain
Fixed pentamer or VLP albumen, such as by the experiment of embodiment 12, it is found that the protein product of different aminoacids sequence composition is steady
Qualitative difference.Wherein sequence H4 structural domains by substitution protein product compared with the protein product that H4 structural domains are unsubstituted more
Stablize；C-terminal, which truncates amino acid, can effectively avoid C-terminal degradation, reduction product caused by protein degradation impure, to shadow
Ring the stability of protein vaccine.
Humanpapilloma virus 58 L1 protein that sequence pair H4 structural domain house of correction of the present invention obtains forms pentamer, VLP or by pentamer group
At polymer, have good immunogenicity, can with the neutralizing antibody for HPV58 of induced high titers, prevention HPV58 pairs
The infection of human body is a kind of good vaccine form.In addition, the recombination humanpapilloma virus 58 L1 protein used in the present invention is retaining overall length
While antigenicity and pentamer particle the assembling ability of humanpapilloma virus 58 L1 protein, it is easy in eukaryotic expression system and prokaryotic expression system
It is expressed in system, increases the dissolubility of albumen, improve yield, reduce production cost, can be applied to large-scale industrial production.
With reference to as detailed below with after attached drawing, what the advantageous effect of these and other aspects of the invention will be apparent.This
The disclosed all bibliography in place are completely incorporated as referring to herein.
Description of the drawings
HPV58L1 pentamers transmission electron microscope observing (100,000 times) result prepared by Fig. 1 embodiments；The results show that the visual field
In visible a diameter of 13nm or so pentamer, granular size is consistent with theoretical size, uniformity.
The dynamic light scattering observed result for the pentamer that Fig. 2-A are prepared according to embodiment 1, as a result shows the grain size of pentamer
With particle size distribution figure.
As a result the dynamic light scattering observed result for the HPV58L1 pentamers that Fig. 2-B are prepared according to embodiment 6 shows that five is poly-
The grain size and particle size distribution figure of body.
The high pressure Liquid-Phase Molecular Sieve chromatogram of Fig. 3 embodiment 1HPV58L1 pentamer albumens, display is through highly purified in figure
Pentamer albumen purity.
After HPV58L1 pentamer vaccinated mices prepared by Fig. 4 embodiments, after second booster immunization 3 weeks, detection
The average titer of neutralizing antibody is horizontal.
With reference to embodiment to further citing description of the invention.These embodiments are non-limiting.
Embodiment l：The structure of engineering bacteria with HPV58L1 sequences 2
1, HPV58L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence
SEQ ID NO：1, it is originated from GeneBank, Serial No. GenBank:M14119.1.
2, contain SEQ ID NO：1 genetic fragment does the template of PCR reactions.With forward primer sequence：5’-
CGCGGATCCGGAAAGGAAGATC CATTAAATAA A-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures
Point, AccIII site sequences are TCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：
5 '-GCTCTCCTCGAGTTA GGGCTTTGCT TTAAGGCCTG A-3 ', 5 ' ends introduce restriction enzyme
The sites XhoI, XhoI site sequences are CTCGAG.HPV58B is obtained through PCR reaction amplifications.
3, contain SEQ ID NO：1 genetic fragment does the template of PCR reactions.With the restriction enzyme BamH containing introducing
I site, BamH I site sequences are GGATCC, forward primer sequence：5’-CGCGGAGGATCC GGA GGA
GGACTAGTTATTTTATTTTGCGTC-3’；It is held the 3 ' of H4 structures and introduces the sites restriction enzyme A ccIII, AccIII
Point sequence is TCCGGA, reverse primer sequences：GCTCTCTCCGGA TCC TCC TCCTTGCCAGTCC TCCAAAATAT C；
Amplification amplification, which is reacted, through PCR obtains HPV58A.
4, HPV58A segments and HPV58B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make
HPV58A and HPV58B segments are connected with T4DNA ligases, is allowed to be formed one and deletes H4 structural domains, former H4 structural domains quilt
Encode the HPV58C of the nucleoside base sequence substitution of connecting peptides GAGSG.
5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV58c and table with T4 ligases
Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments
HPV58C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured
It is classified as SEQ ID NO：2.
6, connection product preferably converts large intestine bar through electrotransformation or CaCl2 methods by recombinant plasmid transformed to Escherichia coli
Bacterium BL21 host cells.The BL21 cells of conversion are applied on the LB plating mediums containing ampicillin, are cultivated through 37 DEG C,
Picking monoclonal colonies are inoculated in LB liquid medium and cultivate 12 hours for 37 DEG C, and 1ml bacterium solutions is therefrom taken to prepare glycerol tube strain
In -70 DEG C of preservations.
PCR reaction systems are specifically drawn comprising 20 μ g DNA profilings, lx PCR buffer solutions, forward and reverse in above steps
The Taq archaeal dna polymerases of object (concentration is 0.2 μ Μ), 1.5mM magnesium ions, 1.0 units；Reaction condition is：95 DEG C of denaturation Celsius
5 minutes, amplify through 36 PCR cycles, each cycle for 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 2 minutes, reaction product is at 72 DEG C
It is lower to incubate 10 minutes, then stop reaction.
Embodiment 2：The structure of engineering bacteria with HPV58L1 sequences 4
1, the target gene segment of HPV58L1 full length genes contains wild type purchased from Beijing An Zhen hospital-based outpatient obstetrical clinic
The clinical cytology sample waste of HPV58 viruses, nucleotides sequence are classified as SEQ ID NO：3(GenBank:FN870689.1).
2, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With forward primer sequence：5’-
CGCGGATCCGGAAAGGAAGATC CATTAAATAA A-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures
Point, AccIII site sequences are TCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：
5 '-GCTCTCCTCGAGTTATGCACGGGTA GTAGGGGCTG A-3 ', 5 ' ends introduce restriction enzyme
The sites XhoI, XhoI site sequences are CTCGAG.It is reacted through PCR, amplification obtains HPV58B.
3, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With the restriction enzyme BamH containing introducing
I site forward primer sequence：5’-CGCGGAGGATCC GGA GGA GGA CTAGTTATTTTATTTTGCGTC-3’；It is tied in H4
3 ' ends of structure introduce the sites restriction enzyme A ccIII, and AccIII site sequences are TCCGGA, reverse primer sequences：
GCTCTCTCCGGA TCC TCC TCC TTGCCAGTCC TCCAAAATAT C；It is reacted through PCR, amplification obtains
HPV58A。
4, HPV58A segments and HPV58B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make
HPV58A and HPV58B segments are connected with T4DNA ligases, is allowed to be formed one and deletes H4 structural domains, former H4 structural domains quilt
Encode the HPV58C of the nucleoside base sequence substitution of connecting peptides GGGSG.
5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV58c and table with T4 ligases
Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments
HPV58C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured
It is classified as SEQ ID NO：4.
6, connection product preferably converts large intestine bar through electrotransformation or CaCl2 methods by recombinant plasmid transformed to Escherichia coli
Bacterium BL21 host cells.The BL21 cells of conversion are applied on the LB plating mediums containing ampicillin, are cultivated through 37 DEG C,
Picking monoclonal colonies are inoculated in LB liquid medium and cultivate 12 hours for 37 DEG C, and 1ml bacterium solutions is therefrom taken to prepare glycerol tube strain
In -70 DEG C of preservations.
PCR reaction systems are specifically drawn comprising 20 μ g DNA profilings, lx PCR buffer solutions, forward and reverse in above steps
The Taq archaeal dna polymerases of object (concentration is 0.2 μ Μ), 1.5mM magnesium ions, 1.0 units；Reaction condition is：95 DEG C of denaturation Celsius
5 minutes, amplify through 36 PCR cycles, each cycle for 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 2 minutes, reaction product is at 72 DEG C
It is lower to incubate 10 minutes, then stop reaction.
Embodiment 3：The structure of engineering bacteria with HPV58L1 sequences 6
1, HPV58L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence
SEQ ID NO：5, it is originated from GeneBank, Serial No. GenBank:FN870694.1.
2, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With forward primer sequence：5’-
CGCGGATCCGGAAAGGAAGATC CATTAAATAAA-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures
Point, AccIII site sequences are TCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：
5 '-GCTCTCCTCGAGTTATGCACGGGTA GTAGGGGCCG A-3 ', 5 ' ends introduce restriction enzyme
The sites XhoI, XhoI site sequences are CTCGAG.PCR reacts, and amplification obtains HPV58B.
3, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With the restriction enzyme BamH containing introducing
I site forward primer sequence：5’-CGCGGAGGATCC GGA GCC GGA GCAGACGTAAACGTTTTCCAT-3’；It is tied in H4
3 ' ends of structure introduce the sites restriction enzyme A ccIII, and AccIII site sequences are TCCGGA, reverse primer sequences：
5’-GCTCTCTCCGGA TCC GGC TCC TTGCCAGTCC TCCAAAATAT C-3’；It reacts, expands through PCR
Obtain HPV58A.
4, HPV58A segments and HPV58B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make
HPV58A and HPV58B segments are connected with T4DNA ligases, is allowed to form one and deletes H4 structural domains, original H4 structures
Domain is encoded the HPV58C of the nucleoside base sequence substitution of connecting peptides GAGSG.
5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV58c and table with T4 ligases
Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments
HPV58C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured
It is classified as SEQ ID NO：6.
Method of remaining operating procedure with reference to embodiment 1.
Embodiment 4：The structure of engineering bacteria with HPV58L1 sequences 8
1, HPV58L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence
SEQ ID NO：7, it is originated from GeneBank, Serial No. GenBank:HE574702.1.
2, contain SEQ ID NO：7 genetic fragments do the template of PCR reactions.With forward primer sequence：5’-
CGCGGATCCGGAAAGGAAGATC CATTAAATAA A-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures
Point, AccIII site sequences are TCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：
5 '-GCTCTCCTCGAGTTAGGGCTTTGCT TTAAGGCCTG A-3 ', 5 ' ends introduce restriction enzyme
The sites XhoI, XhoI site sequences are CTCGAG.It is reacted through PCR, amplification obtains HPV58B.
3, contain SEQ ID NO：7 genetic fragments do the template of PCR reactions.With the restriction enzyme Nhe containing introducing
I site forward primer sequence：5’-CGCGGAGCTAGCGCC TCC GGAGCAGACGTAAACGTTTTCCAT-3’；In H4 structures
3 ' ends introduce restriction enzyme A ccIII sites, AccIII site sequences are TCCGGA, reverse primer sequences：
5’-GCTCTCTCCGGA TCC TCC TCC TTGCCAGTCC TCCAAAATAT T-3’；It reacts, expands through PCR
Obtain HPV58A.
4, HPV58A segments and HPV58B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make
HPV58A and HPV58B segments are connected with T4DNA ligases, is allowed to form one and deletes H4 structural domains, original H4 structures
Domain is encoded the HPV58C of the nucleoside base sequence substitution of connecting peptides GGGSG.
5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV58c and table with T4 ligases
Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments
HPV58C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured
It is classified as SEQ ID NO：8.
Method of remaining operating procedure with reference to embodiment 1.
Embodiment 5：The structure of engineering bacteria with HPV58L1 sequences 10
1, HPV58L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence
SEQ ID NO：9, it is originated from GeneBank, Serial No. GenBank:AF335603.1.
2, contain SEQ ID NO：9 genetic fragments do the template of PCR reactions.With forward primer sequence：5’-
CGCGGATCCGGAAAGGAAGATC CATTAAATAA A-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures
Point, AccIII site sequences are TCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：
5 '-GCTCTCCTCGAGTTATTTTTTAACC TTTTTGCGTT T-3 ', 5 ' ends introduce restriction enzyme
The sites XhoI, XhoI site sequences are CTCGAG.It is reacted through PCR, amplification obtains HPV58B.
3, contain SEQ ID NO：9 genetic fragments do the template of PCR reactions.With the restriction enzyme BamH containing introducing
I site forward primer sequence：5’-CGCGGAGGATCCGGA GGA GGACTAGCTATTTTATTTTGCGTC-3’；In H4 structures
3 ' ends introduce restriction enzyme A ccIII sites, AccIII site sequences are TCCGGA, reverse primer sequences：
5’-GCTCTCTCCGGA TCC TCC TCCTTGCCAGTCC TCCAAAATAT T-3’；It reacts, expands through PCR
Obtain HPV58A.
4, HPV58A segments and HPV58B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make
HPV58A and HPV58B segments are connected with T4DNA ligases, is allowed to form one and deletes H4 structural domains, original H4 structures
Domain is encoded the HPV58C of the nucleoside base sequence substitution of connecting peptides GGGSG.
5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV58c and table with T4 ligases
Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments
HPV58C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured
It is classified as SEQ ID NO：10.
Method of remaining operating procedure with reference to embodiment 1.
Embodiment 6：The structure of engineering bacteria with HPV58L1 sequences 11
Contain SEQ ID NO with synthesis：1 genetic fragment does the template of PCR reactions, and 8 amino acid are by GSGGG before N-terminal
Substitution, C-terminal do not truncate amino acid, method PCR amplification in accordance with the above-mentioned embodiment 1, and it is SEQ to obtain its purpose amino acid sequence
ID NO：11.
Embodiment 7：Recombinate great expression and the purifying of humanpapilloma virus 58 L1 protein
Protein expression：Take out the strain that freezes of embodiment 1-6, tablet activation, 37 DEG C of culture 14- respectively in -70 DEG C
20h chooses lawn in 80mL seed culture mediums, 37 DEG C of culture 10-12h；Then 50L seeding tanks are inoculated in cultivate at 37 DEG C
10-12h；It is inoculated in later in 500L fermentation tanks, fermented and cultured, induced expression；Thalline were collected by centrifugation after induced expression.With
Thalline is resuspended in pH7.4 phosphate buffers, is crushed later, and breaking method is available but is not limited to：High-pressure homogenization, ultrasonic disruption or
The chemically or physically means such as lysozyme dissolving.Centrifugation obtains supernatant.Lowry methods detection total protein concentration can be used, use Elisa
Method detects L1 contents.
Protein purification：Supernatant is available but is not limited to saltout, isoelectric precipitation, ion-exchange chromatography, affinity chromatography, molecule
The isolation and purification methods such as sieve, obtain the pentamer of the HPV58L1 of purity 98%.Electricity consumption sem observation purified product, diameter are
The pentamer albumen of 10nm or so.
The specific steps are purify the L1 albumen in supernatant solution through affinity chromatography for purification process：Pre-install glutathione-fine jade
Lipolysaccharide resin (the Glutathione Sepharose 4B of GE companies production) chromatographic column.Take a concentration of 50%
The homogenate of Glutathione Sepharose 4B resins is put into chromatographic column (needs 5-10ml resins even per 200ml albumen clear liquids
Slurry).With the buffer solution A of 5-10 times of bed volume, (group is divided into：The NaCl of the Tric-HCl of 50mmol/L, 200mmol/,
The EDTA of 1mmol/L, pH8.0) washing resin, then albumen clear liquid is added in chromatographic column, is uniformly mixed with resin and in room
Filtered solution is released in the lower effect of temperature after twenty minutes, and resin column is washed with the buffer solution A of 10 times of bed volumes.By accurate protease
(Prescission Protease, abbreviation PP enzyme) is diluted with buffer solution A, cycle digestion 120min in loading and column.Release enzyme
Liquid is cut, eluted with suitable buffer solution A and collects destination protein.
Ion-exchange chromatogram purification：By the destination protein of above-mentioned collection Source Q or Mono Q (GE companies) anion
Exchange column carries out ion-exchange chromatography, collects destination protein.
Molecular sieve chromatography purifies：Gel of the destination protein molecular weight that ion-exchange chromatography is collected in 10-600kDa
Filter medium carries out sieve chromatography, the final high-purity HPV58L1 pentamer albumens for obtaining purity and being more than 98%.
Embodiment 8：The morphologic detection of HPV58L1 pentamers
It send Shanghai Sangon Biotech Company to be sequenced the embodiment 1-6 engineered strains built, measures the target DNA sequence being inserted into plasmid
The amino acid sequence of row, coding is SEQID NO：2、SEQID NO：4、SEQID NO：6、SEQID NO：8、SEQID NO：
10、SEQID NO：Shown in 11, wherein embodiment 1-5 takes and generation the result shows that H4 structural domains had not existed in original full length sequence
Be coding connecting peptides GGGSG or GAGSG sequence " GGA GGA GGA TCC GGA " or " GGA GCC GGA TCC
GGA " nucleotide sequences.
The product that the engineered strain that embodiment 1-6 methods obtain is obtained using the method expression and purification of embodiment 7
HPV58L1 pentamer albumens, transmission electron microscope observing (100,000 times), the results show that visible a diameter of 13nm or so in the visual field
Pentamer, granular size are consistent with theoretical size, uniformity.The electromicroscopic photograph for wherein implementing sample obtained by 1 sequence is shown in attached drawing
1。
Carry out grain diameter measurement.Instrument is the dynamic light scattering particle instrument of Malvern Zetasizer NanoZS, is used
Algorithm is Regulation algorithms.Sample measures after 0.22u m membrane filtrations, the results are shown in Table 1.The result shows that six kinds
The almost the same 12.89-14.48nm of pentamer average grain diameter, but monodispersity index PdI (homogeneity for showing albumen) exists significantly
The monodispersity index of difference, wherein embodiment 1-5 samples is smaller, illustrates that sample is very uniform.The monodispersity index of 6 sample of embodiment
It is larger, illustrate that sample is inhomogenous.
1 pentamer average grain diameter of table and monodispersity index
The hydrated molecule dynamics average grain diameter of HPV58L1 pentamer particles wherein prepared by embodiment 1 is
12.53nm, monodispersity index PdI are 0.034 (being specifically shown in attached drawing 2-A)；HPV58L1 pentamer particles prepared by embodiment 6
Hydrated molecule dynamics average grain diameter be 14.19nm, monodispersity index PdI be 0.168 (being specifically shown in attached drawing 2-B).
Embodiment 9：Albumen stoste purity detecting
Chromatographic column is TSK-GEL G3000SWxl or identical fillers, the chromatographic column of separating ranges 10KDa-500KDa；With
The 0.1mol/l phosphate buffers of pH6.8 (weigh disodium hydrogen phosphate 25.8g, sodium dihydrogen phosphate 4.37g adds ultra-pure water to make molten
Solution, with phosphoric acid tune pH to 6.8, ultra-pure water constant volume is at 1000ml) it is mobile phase；Flow velocity is 1ml/min；Detection wavelength 280nm；Column
25 DEG C of temperature, applied sample amount cannot be less than 20ug, and sample main peak theoretical cam curve is not less than 1000, and tailing factor is less than 2.0, continuously into
5 needle of sample, the relative standard deviation of peak area are not greater than 3%.
The HPV albumen stostes of 7 gained of Example, diluted concentration is 1mg/ml respectively, and applied sample amount 20ul injects high pressure liquid
Chromatography detects according to the method described above, by area percentage calculate purity, as a result see the table below 2 and attached drawing 3 (implement 1 prepared by
HPV58L1 pentamers sieve chromatography chromatogram), all processing purity of protein are all higher than 98%.
The purity of the albumen stoste after purification of table 2
Embodiment 10：Preparation containing HPV58L1 pentamer albumen vaccines
The HPV58L1 pentamer albumen stostes pH7.2 purified through 7 step of embodiment after respectively being prepared by embodiment 1-6
Borate buffer salt be diluted to the protein liquid of 100 μ g/ml, 50 μ g/ml aluminium hydroxides assistant is added in the protein liquid after taking 1ml to dilute
Agent is sufficiently mixed absorption 2 hours, that is, obtains the HPV58L1 pentamer albumen vaccines of 40 μ g/ml, be kept in dark place in 4 DEG C.
Embodiment 11：The immunogenicity determining of HPV58L1 pentamer vaccines
The immunogenicity of mouse：HPV58L1 pentamer albumen vaccine thinner for vaccine prepared by embodiment 10 is distinguished
It is diluted to dosage shown in table 1, BALB/C mice, each processing group 10 are injected intraperitoneally with every 0.5mL.It is immunized every 3 weeks once,
It is immunized 2 times altogether.Every mice serum is taken respectively within three weeks, measured respectively with experimental method using in cape horn fever poison cell after being immunized every time
The neutralizing antibody titers of HPV58 are directed in mice serum after being immunized every time.The results are shown in Table 3, in second of booster immunization 3
Zhou Hou, the average titer for detecting neutralizing antibody are horizontal as shown in Fig. 4.
In 3 cape horn fever poison cell of table and experimental method detection HPV58L1 pentamer albumens neutralizing antibody is horizontal
The result shows that HPV58L1 pentamer albumen Mice Inoculateds prepared by embodiment, can produce after 3 weeks immune for the first time
Raw neutralizing antibody；Neutralizing antibody after secondary immunity can reach very high level, and it is as shown in the table respectively.The results show,
The HPV L1 pentamer albumens vaccines of sample preparation obtained by each embodiment can generate neutralizing antibody in animal body.Illustrate this
Invent the HPV L1 pentamer albumen vaccines prepared has immunogenicity in human clinical trial, can prevent or treat
Disease caused by HPV58 viruses.
Embodiment 12：Humanpapilloma virus 58 L1 protein yield compares
By the engineering bacteria for implementing 1-6 methods structure with reference to the method for embodiment 7, humanpapilloma virus 58 L1 protein, calculation expression amount are prepared
(total protein concentration being detected with Lowry methods, with Elisa methods detection L1 contents), places the 6-20 hours stability for comparing albumen later,
The results are shown in Table 4.
4 protein content of table and stability experiment
The result shows that the protein product stability of different aminoacids sequence composition is different.Wherein SEQ ID NO：2、SEQ
ID NO：4、SEQ ID NO：6、SEQ ID NO：8 and SEQ ID NO：10, the SEQ ID NO not being transformed than H4 structural domain：11
Humanpapilloma virus 58 L1 protein purified product is prepared, the 6-15 hours stability for comparing albumen is placed, contains SEQ ID NO：The egg of 11 sequences
White purified product was precipitated at 6 hours, contained SEQ ID NO：2、SEQ ID NO：4、SEQ ID NO：6SEQ ID NO：
8 and SEQ ID NO：The protein purification products of 10 sequences were observed at 15 hours not to be precipitated, still keeps stablizing.
SEQUENCE LISTING
<110>Beijing Health Guard Biotechnology Co., Ltd.
<120>Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1
<130> 2014
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 1575
<212> DNA
<213>Artificial sequence
<400> 1
atggtgctga ttttatgttg caccctagtt attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtgttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttagtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgttggca taagtggtca tccttattta aataaatttg atgacactga aactggtaac 480
agatataccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcaa 840
atgtttgtta gacacttttt taatagggct ggaacccttg gcgagcctgt cccgaatgac 900
ctttatatta aagggtccgg taatactgca ggtatccaaa gtagtgcatt ttttccaact 960
cctagtggct ccatagttac ctcagaatca caactattta ataagcctta ttggctacag
1020
cgtgcacaag gtcataacaa tgacatttgc tggggcaatc agttatttgt taccgtggtt
1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaaaga agatacatat
1140
aaaaataata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt
1200
tttcagcttt gcaaaattac actaactgca gaggtaatga catatataca tactatgaat
1260
tcagatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag
1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa
1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt
1440
tctgcagatc tggatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa
1500
gcaaagccca gactaaaacg ttcagcccct actacccgtg caccatccac caaacgcaaa
1560
aaggttaaaa aataa 1575
<210> 2
<211> 472
<212> PRT
<213>Artificial sequence
<400> 2
Gly Ser Gly Gly Gly Leu Val Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His
130 135 140
Pro Tyr Leu Asn Lys Phe Asp Asp Thr Glu Thr Gly Asn Arg Tyr Thr
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Thr Leu Gly Glu Pro Val Pro Asn Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Gly Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Asp Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Asp Thr Tyr Lys Asn Asn Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Val Met Thr Tyr Ile His Thr Met
405 410 415
Asn Ser Asp Ile Leu Glu Asp Trp Gln Gly Gly Gly Ser Gly Lys Glu
420 425 430
Asp Pro Leu Asn Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys
435 440 445
Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu
450 455 460
Gln Ser Gly Leu Lys Ala Lys Pro
465 470
<210> 3
<211> 1575
<212> DNA
<213>Artificial sequence
<400> 3
atggtgctga ttttatgttg caccctagtt attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtgttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttagtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgttggca taagtggtca tccttattta aataaatttg atgacactga aactggtaac 480
agatataccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcaa 840
atgtttgtta gacacttttt taatagggct ggaacccttg gcgagcctgt cccgaatgac 900
ctttatatta aagggtccgg taatactgca ggtatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag
1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt
1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaaaga agatacatat
1140
aaaaataata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt
1200
tttcagcttt gcaaaattac actaactgca gaggtaatga catatataca tactatgaat
1260
tcagatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag
1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa
1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt
1440
tctgcagatc tggatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa
1500
gcaaagccca gactaaaacg ttcagcccct actacccgtg caccatccac caaacgcaaa
1560
aaggttaaaa aataa 1575
<210> 4
<211> 483
<212> PRT
<213>Artificial sequence
<400> 4
Gly Ser Gly Gly Gly Leu Val Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His
130 135 140
Pro Tyr Leu Asn Lys Phe Asp Asp Thr Glu Thr Gly Asn Arg Tyr Thr
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Thr Leu Gly Glu Pro Val Pro Asn Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Gly Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Asp Thr Tyr Lys Asn Asn Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Val Met Thr Tyr Ile His Thr Met
405 410 415
Asn Ser Asp Ile Leu Glu Asp Trp Gln Gly Gly Gly Ser Gly Lys Glu
420 425 430
Asp Pro Leu Asn Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys
435 440 445
Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu
450 455 460
Gln Ser Gly Leu Lys Ala Lys Pro Arg Leu Lys Arg Ser Ala Pro Thr
465 470 475 480
Thr Arg Ala
<210> 5
<211> 1575
<212> DNA
<213>Artificial sequence
<400> 5
atggtgctga ttttatgttg caccctagtt attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataagaaagt attagttccc aaggtatcag gcttacagta tagggtcttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttggtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgtaggca taagtggtca tccttattta aataaatttg atgacactga aaccagtaac 480
agatatcccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcaa 840
atgtttgtta gacacttttt taatagggct ggaaaacttg gcgaggctgt cccagatgac 900
ctttatatta aagggtccgg taatactgca gttatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag
1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt
1080
gataccactc gtagcactaa tatgacatta tgcactgaag taaataagga aggtacatat
1140
aaaaatgata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt
1200
tttcagcttt gcaaaattac actaactgca gaggtaatga catatataca tactatgaat
1260
tcagatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag
1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa
1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt
1440
tctgcggatc tggatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa
1500
gcaaagccca gactcaaacg ttcggcccct actacccgtg caccatccac caaacgcaaa
1560
aaggttaaaa aataa 1575
<210> 6
<211> 476
<212> PRT
<213>Artificial sequence
<400> 6
Gly Ser Gly Ala Gly Ala Asp Val Asn Val Phe His Ile Phe Leu Gln
1 5 10 15
Met Ser Val Trp Arg Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val
20 25 30
Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ser Arg Thr Ser
35 40 45
Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg Leu Leu Ala Val Gly Asn Pro
50 55 60
Tyr Phe Ser Ile Lys Ser Pro Asn Asn Asn Lys Lys Val Leu Val Pro
65 70 75 80
Lys Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Val Arg Leu Pro Asp
85 90 95
Pro Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr
100 105 110
Gln Arg Leu Val Trp Ala Cys Val Gly Leu Glu Ile Gly Arg Gly Gln
115 120 125
Pro Leu Gly Val Gly Ile Ser Gly His Pro Tyr Leu Asn Lys Phe Asp
130 135 140
Asp Thr Glu Thr Ser Asn Arg Tyr Pro Ala Gln Pro Gly Ser Asp Asn
145 150 155 160
Arg Glu Cys Leu Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile
165 170 175
Gly Cys Lys Pro Pro Thr Gly Glu His Trp Gly Lys Gly Val Ala Cys
180 185 190
Asn Asn Asn Ala Ala Ala Thr Asp Cys Pro Pro Leu Glu Leu Phe Asn
195 200 205
Ser Ile Ile Glu Asp Gly Asp Met Val Asp Thr Gly Phe Gly Cys Met
210 215 220
Asp Phe Gly Thr Leu Gln Ala Asn Lys Ser Asp Val Pro Ile Asp Ile
225 230 235 240
Cys Asn Ser Thr Cys Lys Tyr Pro Asp Tyr Leu Lys Met Ala Ser Glu
245 250 255
Pro Tyr Gly Asp Ser Leu Phe Phe Phe Leu Arg Arg Glu Gln Met Phe
260 265 270
Val Arg His Phe Phe Asn Arg Ala Gly Lys Leu Gly Glu Ala Val Pro
275 280 285
Asp Asp Leu Tyr Ile Lys Gly Ser Gly Asn Thr Ala Val Ile Gln Ser
290 295 300
Ser Ala Phe Phe Pro Thr Pro Ser Gly Ser Ile Val Thr Ser Glu Ser
305 310 315 320
Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn
325 330 335
Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr
340 345 350
Thr Arg Ser Thr Asn Met Thr Leu Cys Thr Glu Val Asn Lys Glu Gly
355 360 365
Thr Tyr Lys Asn Asp Asn Phe Lys Glu Tyr Val Arg His Val Glu Glu
370 375 380
Tyr Asp Leu Gln Phe Val Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala
385 390 395 400
Glu Val Met Thr Tyr Ile His Thr Met Asn Ser Asp Ile Leu Glu Asp
405 410 415
Trp Gln Gly Ala Gly Ser Gly Lys Glu Asp Pro Leu Asn Lys Tyr Thr
420 425 430
Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln
435 440 445
Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Leu Lys Ala Lys
450 455 460
Pro Arg Leu Lys Arg Ser Ala Pro Thr Thr Arg Ala
465 470 475
<210> 7
<211> 1575
<212> DNA
<213>Artificial sequence
<400> 7
atggtgctga ttttatgttg caccctagct attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtcttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttggtctg ggcatgtgta ggccttaaaa taggtagggg acagccattg 420
ggtgttggcg taagtggtca tccttattta aataaatttg atgacactga aaccagtaac 480
agatatcccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcag 840
atgtttgtta gacacttttt taatagggct ggaaaacttg gcgaggctgt cccggatgac 900
ctttatatta aagggtccgg taatactgca gttatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag
1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt
1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaagga aggtacatat
1140
aaaaatgata attttaagga atatgtacgt catgttgaag aatatgactt acagtttgtt
1200
tttcagcttt gcaaaattac actaactgca gagataatga catatataca tactatggat
1260
tccaatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag
1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa
1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt
1440
tctgcagatc tagatcagtt tcctttggga ccaaagtttt tattacaatc aggccttaaa
1500
gcaaagccca gactaaaacg ttcggcccct actacccgtg caccatccac caaacgcaaa
1560
aaggttaaaa aataa 1575
<210> 8
<211> 465
<212> PRT
<213>Artificial sequence
<400> 8
Ala Ser Ala Ser Gly Ala Asp Val Asn Val Phe His Ile Phe Leu Gln
1 5 10 15
Met Ser Val Trp Arg Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val
20 25 30
Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ser Arg Thr Ser
35 40 45
Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg Leu Leu Ala Val Gly Asn Pro
50 55 60
Tyr Phe Ser Ile Lys Ser Pro Asn Asn Asn Lys Lys Val Leu Val Pro
65 70 75 80
Lys Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Val Arg Leu Pro Asp
85 90 95
Pro Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr
100 105 110
Gln Arg Leu Val Trp Ala Cys Val Gly Leu Lys Ile Gly Arg Gly Gln
115 120 125
Pro Leu Gly Val Gly Val Ser Gly His Pro Tyr Leu Asn Lys Phe Asp
130 135 140
Asp Thr Glu Thr Ser Asn Arg Tyr Pro Ala Gln Pro Gly Ser Asp Asn
145 150 155 160
Arg Glu Cys Leu Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile
165 170 175
Gly Cys Lys Pro Pro Thr Gly Glu His Trp Gly Lys Gly Val Ala Cys
180 185 190
Asn Asn Asn Ala Ala Ala Thr Asp Cys Pro Pro Leu Glu Leu Phe Asn
195 200 205
Ser Ile Ile Glu Asp Gly Asp Met Val Asp Thr Gly Phe Gly Cys Met
210 215 220
Asp Phe Gly Thr Leu Gln Ala Asn Lys Ser Asp Val Pro Ile Asp Ile
225 230 235 240
Cys Asn Ser Thr Cys Lys Tyr Pro Asp Tyr Leu Lys Met Ala Ser Glu
245 250 255
Pro Tyr Gly Asp Ser Leu Phe Phe Phe Leu Arg Arg Glu Gln Met Phe
260 265 270
Val Arg His Phe Phe Asn Arg Ala Gly Lys Leu Gly Glu Ala Val Pro
275 280 285
Asp Asp Leu Tyr Ile Lys Gly Ser Gly Asn Thr Ala Val Ile Gln Ser
290 295 300
Ser Ala Phe Phe Pro Thr Pro Ser Gly Ser Ile Val Thr Ser Glu Ser
305 310 315 320
Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn
325 330 335
Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr
340 345 350
Thr Arg Ser Thr Asn Met Thr Leu Cys Thr Glu Val Thr Lys Glu Gly
355 360 365
Thr Tyr Lys Asn Asp Asn Phe Lys Glu Tyr Val Arg His Val Glu Glu
370 375 380
Tyr Asp Leu Gln Phe Val Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala
385 390 395 400
Glu Ile Met Thr Tyr Ile His Thr Met Asp Ser Asn Ile Leu Glu Asp
405 410 415
Trp Gln Gly Gly Gly Ser Gly Lys Glu Asp Pro Leu Asn Lys Tyr Thr
420 425 430
Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln
435 440 445
Phe Pro Leu Gly Pro Lys Phe Leu Leu Gln Ser Gly Leu Lys Ala Lys
450 455 460
Pro
465
<210> 9
<211> 1575
<212> DNA
<213>Artificial sequence
<400> 9
atggtgctga ttttatgttg caccctagct attttatttt gcgtcgcaga cgtaaacgtt 60
ttccatattt ttttgcagat gtccgtgtgg cggcctagtg aggccactgt gtacctgcct 120
cctgtgcctg tgtctaaggt tgtaagcact gatgaatatg tgtcacgcac aagcatttat 180
tattatgctg gcagttccag acttttggct gttggcaatc catatttttc catcaaaagt 240
cccaataaca ataaaaaagt attagttccc aaggtatcag gcttacagta tagggtcttt 300
agggtgcgtt tacctgatcc caataaattt ggttttcctg atacatcttt ttataaccct 360
gatacacaac gtttggtctg ggcatgtgta ggccttgaaa taggtagggg acagccattg 420
ggtgttggcg taagtggtca tccttgttta aataaatttg atgacactga aaccagtaac 480
agatatcccg cacagccagg gtctgataac agggaatgct tatctatgga ttataaacaa 540
acacaattat gtttaattgg ctgtaaacct cccactggtg agcattgggg taaaggtgtt 600
gcctgtaaca ataatgcagc tgctactgat tgtcctccat tggaactttt taattctatt 660
attgaggatg gtgacatggt agatacaggg tttggatgca tggactttgg tacattgcag 720
gctaataaaa gtgatgtgcc tattgatatt tgtaacagta catgcaaata tccagattat 780
ttaaaaatgg ccagtgaacc ttatggggat agtttgttct tttttcttag acgtgagcag 840
atgtttgtta gacacttttt taatagggct ggaaaacttg gcgaggctgt cccggatgac 900
ctttatatta aagggtccgg taatactgca gttatccaaa gtagtgcatt ttttccaact 960
cctagtggct ctatagttac ctcagaatca caattattta ataagcctta ttggctacag
1020
cgtgcacaag gtcataacaa tggcatttgc tggggcaatc agttatttgt taccgtggtt
1080
gataccactc gtagcactaa tatgacatta tgcactgaag taactaagga aggtacatat
1140
aaaaatgata attttaagga atatgtacgt catgttgaag agtatgactt acagtttgtt
1200
tttcagcttt gcaaaattac actaactgca gagataatga catatataca tactatggat
1260
tccaatattt tggaggactg gcaatttggt ttaacacctc ctccgtctgc cagtttacag
1320
gacacatata gatttgttac ctcccaggct attacttgcc aaaaaacagc accccctaaa
1380
gaaaaggaag atccattaaa taaatatact ttttgggagg ttaacttaaa ggaaaagttt
1440
tctgcagatc tagatcagtt tcctttggga cgaaagtttt tattacaatc aggccttaaa
1500
gcaaagccca gactaaaacg ttcggcccct actacccgtg caccatccac caaacgcaaa
1560
aaggttaaaa aataa 1575
<210> 10
<211> 493
<212> PRT
<213>Artificial sequence
<400> 10
Gly Ser Gly Gly Gly Leu Ala Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His
130 135 140
Pro Cys Leu Asn Lys Phe Asp Asp Thr Glu Thr Ser Asn Arg Tyr Pro
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Lys Leu Gly Glu Ala Val Pro Asp Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Val Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Gly Thr Tyr Lys Asn Asp Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Ile Met Thr Tyr Ile His Thr Met
405 410 415
Asp Ser Asn Ile Leu Glu Asp Trp Gln Gly Gly Gly Ser Gly Lys Glu
420 425 430
Asp Pro Leu Asn Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys
435 440 445
Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu
450 455 460
Gln Ser Gly Leu Lys Ala Lys Pro Arg Leu Lys Arg Ser Ala Pro Thr
465 470 475 480
Thr Arg Ala Pro Ser Thr Lys Arg Lys Lys Val Lys Lys
485 490
<210> 11
<211> 521
<212> PRT
<213>Artificial sequence
<400> 11
Gly Ser Gly Gly Gly Leu Val Ile Leu Phe Cys Val Ala Asp Val Asn
1 5 10 15
Val Phe His Ile Phe Leu Gln Met Ser Val Trp Arg Pro Ser Glu Ala
20 25 30
Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp
35 40 45
Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg
50 55 60
Leu Leu Ala Val Gly Asn Pro Tyr Phe Ser Ile Lys Ser Pro Asn Asn
65 70 75 80
Asn Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val
85 90 95
Phe Arg Val Arg Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr
100 105 110
Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly
115 120 125
Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His
130 135 140
Pro Tyr Leu Asn Lys Phe Asp Asp Thr Glu Thr Gly Asn Arg Tyr Thr
145 150 155 160
Ala Gln Pro Gly Ser Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys
165 170 175
Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Thr Gly Glu His
180 185 190
Trp Gly Lys Gly Val Ala Cys Asn Asn Asn Ala Ala Ala Thr Asp Cys
195 200 205
Pro Pro Leu Glu Leu Phe Asn Ser Ile Ile Glu Asp Gly Asp Met Val
210 215 220
Asp Thr Gly Phe Gly Cys Met Asp Phe Gly Thr Leu Gln Ala Asn Lys
225 230 235 240
Ser Asp Val Pro Ile Asp Ile Cys Asn Ser Thr Cys Lys Tyr Pro Asp
245 250 255
Tyr Leu Lys Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Phe
260 265 270
Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala Gly
275 280 285
Thr Leu Gly Glu Pro Val Pro Asn Asp Leu Tyr Ile Lys Gly Ser Gly
290 295 300
Asn Thr Ala Gly Ile Gln Ser Ser Ala Phe Phe Pro Thr Pro Ser Gly
305 310 315 320
Ser Ile Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro Tyr Trp Leu
325 330 335
Gln Arg Ala Gln Gly His Asn Asn Asp Ile Cys Trp Gly Asn Gln Leu
340 345 350
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys
355 360 365
Thr Glu Val Thr Lys Glu Asp Thr Tyr Lys Asn Asn Asn Phe Lys Glu
370 375 380
Tyr Val Arg His Val Glu Glu Tyr Asp Leu Gln Phe Val Phe Gln Leu
385 390 395 400
Cys Lys Ile Thr Leu Thr Ala Glu Val Met Thr Tyr Ile His Thr Met
405 410 415
Asn Ser Asp Ile Leu Glu Asp Trp Gln Phe Gly Leu Thr Pro Pro Pro
420 425 430
Ser Ala Ser Leu Gln Asp Thr Tyr Arg Phe Val Thr Ser Gln Ala Ile
435 440 445
Thr Cys Gln Lys Thr Ala Pro Pro Lys Glu Lys Glu Asp Pro Leu Asn
450 455 460
Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp
465 470 475 480
Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Leu
485 490 495
Lys Ala Lys Pro Arg Leu Lys Arg Ser Ala Pro Thr Thr Arg Ala Pro
500 505 510
Ser Thr Lys Arg Lys Lys Val Lys Lys
515 520
Claims (11)
1. a kind of humanpapilloma virus 58 L1 protein of recombination, it is characterised in that the amino acid sequence of the albumen such as SEQ ID NO：2、SEQ
ID NO：4、SEQ ID NO：6 or SEQ ID NO：Shown in 8.
2. encoding the polynucleotides of the albumen of claim 1.
3. the expression vector of the polynucleotides comprising claim 2.
4. the cell of the expression vector comprising claim 3.
5. a kind of humanpapilloma virus 58 L1 protein pentamer, it is characterised in that the albumen pentamer is by five identical humanpapilloma virus 58 L1 protein monomers
It is formed, the sequence such as SEQ ID NO of the humanpapilloma virus 58 L1 protein monomer：2、SEQ ID NO：4、SEQ ID NO：6 or SEQ ID
NO：Shown in 8.
6. a kind of humanpapilloma virus 58 L1 protein VLP, it is characterised in that albumen VLP is gathered by the humanpapilloma virus 58 L1 protein five described in claim 5
Body is formed.
7. a kind of HPV vaccines, it is characterised in that the vaccine includes humanpapilloma virus 58 L1 protein pentamer described in claim 5 and medicinal
Adjuvant.
8. a kind of HPV vaccines, it is characterised in that the vaccine includes the humanpapilloma virus 58 L1 protein VLP and medicinal assistant described in claim 6
Agent.
9. the preparation method of HPV vaccines as claimed in claim 7, it is characterised in that this method is：
A) gene of the humanpapilloma virus 58 L1 protein of clone or composite coding recombination described in claim 1；
B) humanpapilloma virus 58 L1 protein of recombination is expressed in Escherichia coli or yeast expression system；
C) pentamer being made of humanpapilloma virus 58 L1 protein is purified；
D) humanpapilloma virus 58 L1 protein pentamer is added medicinal adjuvant and vaccine is made.
10. humanpapilloma virus 58 L1 protein pentamer as claimed in claim 5 prevents HPV58 infection and its caused disease preparing
Application in drug.
11. HPV vaccines as claimed in claim 7 or 8 are in preparing the drug for preventing HPV58 infection and its caused disease
Using.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410054216.6A CN103992395B (en) | 2013-02-18 | 2014-02-18 | Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310052472.7 | 2013-02-18 | ||
| CN2013100524727 | 2013-02-18 | ||
| CN201310052472 | 2013-02-18 | ||
| CN201410054216.6A CN103992395B (en) | 2013-02-18 | 2014-02-18 | Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103992395A CN103992395A (en) | 2014-08-20 |
| CN103992395B true CN103992395B (en) | 2018-07-27 |
Family
ID=51306758
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410054216.6A Active CN103992395B (en) | 2013-02-18 | 2014-02-18 | Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103992395B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713087B (en) * | 2014-11-12 | 2020-05-08 | 北京康乐卫士生物技术股份有限公司 | Human papilloma virus 58 monoclonal antibody and application thereof |
| CN106831961B (en) * | 2015-12-04 | 2019-11-05 | 厦门大学 | A kind of mutant of human papillomavirus type 58 L1 albumen |
| CN114716562B (en) * | 2021-01-04 | 2023-11-10 | 中国医学科学院基础医学研究所 | Human papilloma virus 58 chimeric protein and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MY139500A (en) * | 2003-11-12 | 2009-10-30 | Merck Sharp & Dohme | Optimized expression of hpv 58 l1 in yeast |
| CN101116745B (en) * | 2006-08-04 | 2011-05-11 | 长春百克生物科技股份公司 | Human papilloma virus sample particle vaccines |
| CN101245099A (en) * | 2007-02-14 | 2008-08-20 | 马润林 | Amino acid sequence of recombined human papilloma virus L1 capsid protein and uses thereof |
| CN101481408A (en) * | 2008-01-07 | 2009-07-15 | 马润林 | Modification sequence of recombinant human mammilla tumor virus L1 capsid protein for preventing high polymerization |
-
2014
- 2014-02-18 CN CN201410054216.6A patent/CN103992395B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103992395A (en) | 2014-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103936840B (en) | Human papillomavirus 33 type L 1 protein of recombination and application thereof | |
| CN101293918B (en) | Shorten human papilloma virus 16 type L1 protein | |
| CN105039359B (en) | 16 type recombinant human papilloma virus-like particle and preparation method thereof | |
| DK2716653T3 (en) | TRUNCATED L1 PROTEIN OF HUMANT PAPILLOMAVIRUS TYPE 33 | |
| WO2008145020A1 (en) | A truncated l1 protein of human papillomavirus 11 | |
| EP2589604B1 (en) | Truncated l1 protein of human papillomavirus type 52 | |
| US9738691B2 (en) | Truncated L1 protein of human papillomavirus type 58 | |
| KR20210018351A (en) | Mutant of type 39 human papillomavirus L1 protein | |
| JP2019502404A (en) | Mutation of human papillomavirus type 11 L1 protein | |
| WO2008145021A1 (en) | A truncated l1 protein of human papillomavirus 6 | |
| WO2021013060A1 (en) | Chimeric human papillomavirus type 51 l1 protein | |
| CN103992395B (en) | Recombinate the VLP vaccines and preparation method thereof of HPV-58 types L1 | |
| CN104045696B (en) | L 1 Protein of Human Papillomavirus Type 16 of recombination and application thereof | |
| CN103819543B (en) | 6 type L1 albumen of human papilloma virus of recombination and application thereof | |
| CN114127092A (en) | Multivalent immunogenic compositions of human papillomavirus | |
| WO2008134935A1 (en) | Truncated human papillomavirus type 18 l1 proteins | |
| CN104045695B (en) | HPV 18 L1 albumen of recombination and application thereof | |
| WO2021013079A1 (en) | Chimeric human papillomavirus 56-type l1 protein | |
| WO2021013078A1 (en) | Chimeric human papilloma virus 52 type l1 protein | |
| WO2021013070A1 (en) | Chimeric human papillomavirus 35 type l1 protein | |
| CN104211782B (en) | The type L1 albumen of HPV 45 of truncation | |
| WO2021013077A1 (en) | Chimeric human papillomavirus type 58 l1 protein | |
| WO2021013067A1 (en) | Chimeric human papillomavirus type 6 l1 protein | |
| WO2021013062A1 (en) | Chimeric human papillomavirus type 31 l1 protein | |
| WO2004062584A2 (en) | Therapeutic and prophylactic vaccine for the treatment and prevention of papillomavirus infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |