CN104045696B - L 1 Protein of Human Papillomavirus Type 16 of recombination and application thereof - Google Patents

Abstract

The present invention is the L 1 Protein of Human Papillomavirus Type 16 and application thereof of recombination, a kind of polynucleotides genetic fragment of the HPV16 L1 albumen of new coding recombination is provided, the carrier comprising the genetic fragment includes the host cell of carrier, and the HPV16 L1 albumen pentamers and the anti-HPV16 types infection being made of the pentamer by the genetic fragment accurate translation vaccine for cervical cancer.

Description

L 1 Protein of Human Papillomavirus Type 16 of recombination and application thereof

Technical field

The present invention relates to the prevention of human papilloma virus infection and/or treatments.More particularly it relates to one The L 1 Protein of Human Papillomavirus Type 16 of kind of recombination, and the pentamer that is made from it, vaccine containing the albumen and its are preventing HPV16 type viruses infect, especially the purposes in the cervical carcinoma disease caused by preventing the infection of HPV16 type viruses.

Background technology

Human papilloma virus (Human Papillomavirus, abbreviation HPV) is propagated by close contact DNA virus.In tissue, HPV main infections skin and mucous membrane tissue.HPV can be divided into high-risk type and low dangerous type two Kind, long-term persistent infection high-risk-type can be carcinogenic, such as cervical carcinoma, life threatening.Low risk HPV can lead to genital lesion, such as Condyloma acuminatum influences quality of life.Cervical carcinoma is the second largest malignant tumour of women, and the morbidity in the annual whole world is probably 540,000 (2013), there are about 240,000 death, and fortunately, cervical carcinoma is uniquely to develop the cancer of vaccine.On June 8th, 2006, The Gardasil of Merck companies of (FDA) the official approval U.S. of U.S. Food and Drug Administration (i.e. MSD Corp.) production HPV preventative vaccines list；It is the HPV16/18/6/11 L1 VLP tetravalence cervical carcinomas expressed and purified by saccharomyces cerevisiae Preventative vaccine is approved for the uterine neck caused by 6 ~ 26 years old girl of prevention and the infection of the type of women HPV16,18,6,11 Cancer, precancerous lesion and genital wart, this be FDA by first tumor vaccine (Villa, Costa et al. in the world 2005, Villa, Ault et al. 2006, Bryan 2007, Olsson, Villa et al. 2007, Goldstone and Vuocolo 2012).The trade name Cervarix of subsequent Britain GlaxoSmithKline PLC (GSK) company production HPV preventative vaccines also successfully list, it be origin be derived from insect expression system HPV16/18 L1 VLP divalent palace Neck cancer preventative vaccine.But both preventative vaccines are expensive, strongly limit in developing country and backward areas Use, thus develop a kind of high-titer HPV vaccines of low cost be just particularly important (Jansen and Shaw 2004, Buonaguro, Tornesello et al. 2009, Campo and Roden 2010, Frazer, Leggatt et al. 2011, Hariri, Dunne et al. 2011, Lehtinen and Dillner 2013, Shaw 2013)。

HPV belongs to Papovaviridae (Papovaviridae) Papillomavirus, for no coating DNA virus.Disease Virus gene group is double-strand closed-circular DNA, and size is about 7.2~8kb, has 8 open frames.Genome can be divided by the difference of function For three regions：Early stage area (E), about 4. 5kb encode E1, E2, E4~E7 totally 6 and virus replication, transcribe and convert and is related Non-structural protein；Late region (L), about 2. 5kb encode Major capsid protein L1 and secondary capsid protein L2；Long control region (LCR), between the areas L end and the areas E initiating terminal, it is about 800~900bp, does not encode any albumen, containing DNA replication dna, expression Controlling element.

HPV viruse particle diameter is 55~60nm, and nucleocapsid is symmetrical in 20 face bodies, by the five of 72 Major capsid protein L1s Aggressiveness and secondary capsid protein L2 compositions.Numerous studies confirm that HPV L1 albumen is the major target proteins of HPV vaccines.A variety of To may be formed at morphosis similar to natural viral particle without L2 albumen auxiliary for the HPV L1 albumen expressed in expression system Viruslike particle (Virus-L1keParticle, VLP).Recombination HPV L1-VLP vaccines have been successfully listed and are used to prevent HPV infection and thus caused by the diseases such as cervical carcinoma, condyloma acuminatum, and fully demonstrate L1-VLP and have and wild homologous virus Identical antigenicity and immunogenicity.In terms of the tertiary structure of composition VLP, antigenic determinant is distributed in the base of composition VLP The surface of this structural unit pentamer（Xiaojiang S. Chen,Robert L. Garcea, Ilya Goldberg , Gregory Casini and Stephen C.(2000) . HarrisonStructure of Small Virus-like Particles Assembled from the L1 Protein of Human Papillomavirus 16.Molecular Cell, Vol. 5, 557–567.Brooke Bishop, Jhimli Dasgupta, Michael Klein, Robert L. Garcea, Neil D. Christensen, Rui Zhaoand Xiaojiang S. Chen.(2007). Crystal Structures of Four Types of Human Papillomavirus L1 Capsid Proteins. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 43, pp. 31803–31811）, illustrate HPV The pentamer that the antigenicity and immunogenicity of L1-VLP is derived from or formed depending on L1.Therefore, recombination L1 albumen pentamer with VLP equally has complete epitope, can also be used as antigen and is used for preparing vaccine.

The key of HPV vaccine developments is largely can efficiently to prepare HPV L1 albumen.Current more common expression system Eukaryotic expression system and prokaryotic expression system can be divided into.Common eukaryotic expression system has pox viruses express system, insect bar Shape virus expression systems, yeast expression system.Expressed HPV L1 albumen native conformations destroy few in eukaryotic expression system, The spontaneous formation VLP of energy often need to only carry out simply purifying and can be obtained VLP.But due to the expression of eukaryotic expression system Measure low, toxigenic capacity is high, and extreme difficulties are brought to large-scale industrial production.Escherichia coli table is utilized in prokaryotic expression system It is had been reported up to system expression HPVL1 albumen.But since the HPV L1 albumen expressed by Escherichia coli loses it naturally mostly Conformation cannot generate the protection antibody for HPV.Although above-mentioned albumen is purified by occlusion body, renaturation and etc. also may be used HPV VLP are obtained, but loss of proteins amount is big in renaturation process, yield is low, it is difficult to be applied in large-scale production.HPV L1 Although full length sequence albumen can also in Escherichia coli with correct conformation it is soluble express, be dissolved in the cracking supernatant of thalline In, but expression quantity is relatively low, and foreign protein type is more in supernatant and amount is big, and it is suitable to be therefrom purified into destination protein difficulty Greatly, large-scale production can not be still applied to.

Therefore, this field there is still a need at low cost, purity is high, yield is high, effect is good HPV L1 protein productions technologies and Large-scale industrial production treats the new method of vaccine for cervical cancer.

Invention content

The object of the present invention is to provide a kind of new HPV16 L1 albumen, and the pentamer albumen particle that is made from it and contain The vaccine of the pentamer albumen particle.

The present invention relates to a kind of polynucleotides genetic fragment of the HPV16 L1 albumen of new coding recombination is provided, comprising should The carrier of genetic fragment including the host cell of carrier, and gathered by the HPV16 L1 albumen five of the genetic fragment accurate translation The vaccine of body and the anti-HPV16 types infection being made of the pentamer.

The invention discloses a kind of amino acid sequence of the HPV16 L1 albumen of recombination, the amino acid sequence of the albumen exists 8-15 amino acid whole of N-terminal or arbitrary portion are replaced by 2-10 amino acid sequence, and amino acid sequence is by G, S, A three Any combination mode；H4 structural domains are replaced by 2-10 amino acid sequence, and amino acid sequence is by any group of G, S, A three Conjunction mode.

HPV16 L1 albumen of the present invention is further that its amino acid sequence C-terminal truncates 0,1,2 to 21 Amino acid.

HPV16 L1 albumen of the present invention, preferably by 8-15 amino acid quilt before its amino acid sequence N-terminal GSGGG, ASASG or GSGAG replace, and H4 structural domains are preferably replaced by GGGSG or GAGAS.

HPV16 L1 albumen as described embodiments, preferably its amino acid sequence are 8 before N-terminal, 10,12 or 15 amino acid It is preferred that being replaced by GSGGG or ASASG amino acid sequences.C-terminal preferably truncates 10-21 amino acid, more preferably truncates 10,21 Amino acid.

HPV16 L1 albumen as described embodiments, sequence include sequence SEQ ID NO：2、SEQ ID NO：4、SEQ ID NO：6、 SEQ ID NO：8 or SEQ ID NO：10.

The present invention discloses a kind of polynucleotide sequence of coding albumen.It includes polynucleotide sequence that the present invention, which discloses a kind of, The expression vector of gene.The present invention discloses a kind of cell including expression vector.

The present invention discloses a kind of HPV16 L1 albumen pentamers, and the albumen pentamer is by five HPV16 L1 protein monomer shapes At.

The present invention discloses a kind of HPV vaccines, which includes HPV16 L1 albumen pentamers and medicinal adjuvant.

The present invention discloses a kind of preparation method of HPV vaccines, and this method is：

A. clone or synthesize the genetic fragment of recombination HPV16 L1 albumen；

B. the HPV16 L1 albumen of recombination is expressed in Escherichia coli or yeast expression system；

C. the pentamer being made of HPV16 L1 albumen is purified；

D.HPV16 L1 albumen pentamers are added medicinal adjuvant and vaccine are made.

The purifying of step C is preferably by affinity chromatography chromatogram purification HPV16 L1 fusion tag albumen in the above method.

The present invention discloses HPV vaccines and prevents and/or treatment includes during HPV16 infects and leads to the drug of disease preparing Using.

First aspect present invention provides a kind of polynucleotides genetic fragment of coding recombination HPV16 L1 albumen.

Second aspect of the present invention provides a kind of expression vector of structure, and it includes the recombinations of the coding of first aspect present invention The polynucleotides genetic fragment of HPV16 L1 albumen.The carrier is suitble to drive allogeneic dna sequence DNA thin in bacterium, insect or mammal Accurate translation HPV16 L1 albumen in born of the same parents.In one embodiment, the expression vector preferred pGEX-6p-1 or pGEX-4T- 2。

The third aspect of the present invention provides a kind of engineering bacteria cell of structure, which includes first aspect present invention The expression vector of polynucleotides genetic fragment or second aspect.The engineering bacteria host cell can be bacterial cell, such as Escherichia coli can be eukaryocyte, such as yeast cells or insect cell.

Fourth aspect present invention provides a kind of Pharmaceutical composition, and it includes the polynucleotides genes of first aspect present invention The engineering bacteria cell and expression product HPV16 L1 pentamers of the expression vector or the third aspect of segment or second aspect structure Albumen.

Invention also provides the polynucleotide sequence, the expression vector structures that prepare above-mentioned coding recombination HPV16 L1 albumen It builds, the method for engineering bacteria cell transformation and Pharmaceutical composition.

The method that the present invention obtains HPV16 L1 albumen comprising the HPV16 L1 albumen of recombination is expressed in expression system And its pentamer, the cracking supernatant containing the recombinant protein is then subjected to purification process.It is specific to obtain HPV16 L1 albumen five The method of aggressiveness includes：

1. clone or artificial synthesized coding HPV16 L1 full-length proteins genes or truncated protein gene from clinical sample Segment.

2. expressing the L1 albumen of recombination in Escherichia coli or yeast expression system.

3. purifying HPV16 L1 recombinant proteins.

In one embodiment, the preferred method of acquisition recombination HPV16 L1 albumen includes：

1-15, the ends 1.N amino acid whole or arbitrary portion are replaced by GSGGG, H4 structural domains are replaced by GGGSG sequences HPV16 L1 recombinant proteins.

2. expressing the L1 albumen of recombination in Escherichia coli or yeast expression system.

3. purifying HPV16 L1 recombinant proteins.

N-terminal truncates 8 amino acid and is replaced by GSGGG in 1 scheme of preferred embodiment, and H4 structural domains are by GGGSG sequences Substitution, while C-terminal truncates 21 amino acid, SEQ ID NO：2.

N-terminal truncates 8 amino acid and is replaced by GSGGG in 2 scheme of preferred embodiment, and H4 structural domains are by GGGSG Sequence replaces, while C-terminal truncates 10 amino acid, SEQ ID NO：4.

N-terminal truncates 15 amino acid and is replaced by GSGAG in 3 scheme of preferred embodiment, and H4 structural domains are by GAGSG Sequence replaces, while C-terminal truncates 10 amino acid, SEQ ID NO：6.

N-terminal truncates 15 amino acid and is replaced by ASASG in 4 scheme of preferred embodiment, and H4 structural domains are by GGGSG Sequence replaces, while C-terminal truncates 21 amino acid, SEQ ID NO：8.

N-terminal truncates 8 amino acid and is replaced by GSGGG in 5 scheme of preferred embodiment, and H4 structural domains are by GGGSG Sequence replaces, while C-terminal reservation does not truncate, SEQ ID NO：10.

8 amino acid are replaced by GSGGG before N-terminal in 6 scheme of embodiment of comparison, and H4 structural domains do not replace, and C-terminal retains It does not truncate.

The present invention separately provides Pharmaceutical composition of the present invention and is preparing prevention or the infection for the treatment of HPV16 types and leading to disease medicine Application in object.

The invention further relates to a kind of prevention cervical carcinoma or the vaccines of HPV infection, and it includes the HPV16 L1 that the present invention recombinates Pentamer, or the polymer that is made of pentamer, including 1,2,3,4,5 ... 200 pentamer.It is preferred that the vaccine is also It is selected from HPV16 L1 pentamers including at least one, HPV16 L1 pentamer HPV18 L1 pentamers, HPV31 L1 pentamers, HPV33 L1 pentamers, HPV45 L1 pentamers, HPV52 L1 pentamers, HPV58 L1 pentamers, and by above-mentioned pentamer The polymer of composition.The vaccine usually also includes vaccine excipient or carrier.

Preferably, every dose of amount containing the HPV16 L1 pentamer albumens of the invention recombinated of the vaccine is 1 μ g-200 μ g, It is preferred that 5 μ g-50 μ g.The vaccine contains the HPV16 L1 pentamers that the present invention recombinates and HPV18 L1 according to 0.5-2：1 ratio The vaccine of composition, the HPV16 L1 and HPV31 L1 of recombination are according to 0.5-2：1 ratio composition vaccine, the HPV16 L1 of recombination with HPV33 L1 are according to 0.5-2：The vaccine of 1 ratio composition, the HPV16 L1 and HPV45 L1 of recombination are according to 0.5-2：1 ratio forms Vaccine, the HPV16 L1 and HPV52 L1 of recombination are according to 0.5-2：1 ratio composition vaccine, the HPV16 L1 of recombination with HPV58 L1 are according to 0.5-2：The vaccine of 1 ratio composition, and the HPV16 L1 pentamers by recombinating and above-mentioned various HPV L1 The divalent of pentamer composition, tetravalence, pentavalent, sexavalence, septivalency vaccine or is further combined HPV6 and 11 shapes at trivalent on this basis At nine valence vaccines.

The invention further relates to a kind of methods prepared for preventing cervical carcinoma or HPV infection vaccine, and it includes present invention weights The HPV16 L1 pentamers of group, or the polymer that is made of pentamer with it is optional it is one or more be selected from HPV16,16,18, The pentamer and vaccine carrier or excipient of 31,33,45,52 and 58 HPV types mix.

The invention further relates to the HPV16 L1 pentamers recombinated comprising the present invention, or the poly being made of pentamer Body is being prepared for preventing the purposes in cervical carcinoma or HPV16 infection vaccines.

The explanation of relational language and explanation in the present invention

According to the present invention, term " escherichia expression system " refers to by Escherichia coli（Bacterial strain）It is formed with expression vector, Wherein Escherichia coli（Bacterial strain）From available on the market, illustrate but be not limited to herein：GI698, ER2566, BL21 (DE3), B834 (DE3), BLR (DE3) etc..

According to the present invention, term " carrier " word, which refers to, to be inserted the polynucleotides of certain coding albumen and make Albumen obtains a kind of nucleic acid delivery vehicle of expression.Carrier can make its carrying by conversion, transduction or transfection host cell Inhereditary material element expressed in host cell.For example, carrier includes：Plasmid, bacteriophage, coemid etc..

According to the present invention, term " vaccine excipient or carrier " refers to selected from one or more, including but not limited to：pH Conditioning agent, surfactant, adjuvant, ionic strength reinforcing agent.For example, pH adjusting agent citing but it is not limited to phosphate buffer, Surfactant includes cation, anion or nonionic surface active agent.It illustrates but is not limited to：Tween-80.Adjuvant It illustrates but is not limited to aluminium hydroxide, aluminum phosphate, unformed aluminium hydroxyphosphate sulfate, Fu Shi Freund's complete adjuvants.Ionic strength reinforcing agent It illustrates but is not limited to sodium chloride.

According to the present invention, term " chromatography " includes but not limited to：Ion-exchange chromatography, hydrophobic interaction chromatograph, Adsorption chromatography（Such as hydroxylapatite chromatography）, gel filtration（Gel exclusion）Chromatography, affinity chromatography.

According to the present invention, term " HPV16 L1 H4 structural domains " refers to " FGLQPPP in HPV16 L1 DNA sequence dnas GGTLEDTYRF

VTSQAIACQK HTPPAP ", the 404th amino acids in the L1 sequences that Genebank accession number is ACN91182 Corresponding amino acid position to 436 or in other HPV16 L1 sequences.

According to the present invention, in the method for the recombination HPV16 L1 albumen that the present invention obtains, buffer solution refers to can be certain The solution of maintenance pH stable in range, including but not limited to, Tris buffer solutions, phosphate buffer, HEPES buffer solution, MOPS buffer solutions etc..

According to the present invention, the prokaryotic host cell is broken include but not limited to by homogenizer broken, homogeneous crusher machine, One or more method in ultrasonication, grinding, high-pressure extrusion, bacteriolyze enzymatic treatment is realized；

According to the present invention, in the method for the recombination HPV16 L1 albumen that the present invention obtains, salt used includes but unlimited Then neutral salt, especially alkali metal salt, ammonium salt, hydrochloride, sulfate, sulfate, bicarbonate, phosphate or phosphoric acid hydrogen One or more of salt, especially NaCI, KCI, NH4CI, (NH4) 2S04.It is preferred that NaCI.Reducing agent used include but It is not limited to DTT, 2 one mercaptoethanols.Amount used includes but not limited to lOmM-lOOmM.

According to the present invention, the acceptable form of patient can be used in the vaccine, including but not limited to injection or nasal cavity or Oral cavity sucks or vagina administration, optimizing injection.

According to the present invention, term " valence " refers to the quantity for the genotype that the component of composition vaccine is included.For example The vaccine of HPV16 and 18 type antigens composition is known as " divalent " vaccine.

The present inventor it has been investigated that, by the genetic recombination to HPV16 L1 albumen n end, C-terminal and the regions H4, recycle Escherichia expression system carries out expression and can be obtained a large amount of recombination GST-HPV16 L1 pentamer fusion proteins, the GST- The HPV16 L1 pentamer albumens of high yield can be obtained in HPV16 L1 pentamer albumens after affinitive layer purification, and purity is at least 85% or more.HPV16 L1 pentamer albumens after being further purified, which can reach 98% or more purity and can induce, is directed to HPV16 Protection antibody.The present invention is based on the above inventions to have completed, and the vaccine for preventing cervical carcinoma for large-scale industrial production provides A kind of new method.

Increase GSGGG or GSGAG in N-terminal in the present invention, and blended with GST albumen, is greatly improved L1 albumen Solubility, and digesting efficiency is improved, purifying cost is reduced, while GST albumen is cut off using protease hydrolyzed method, eliminated The introducing of external source impurity；Replace H4 structural domains with GSGGG or GAGAS, L1 pentamer albumens can be prevented further to polymerize, to Pentamer albumen that is uniform, stablizing is obtained, such as by the experiment of embodiment 12, finds the albumen of different aminoacids sequence composition Product stability is different.The protein product that wherein protein product of the sequence H4 structural domains by substitution is unsubstituted with H4 structural domains Compared to more stable；C-terminal, which blocks amino acid, can effectively avoid C-terminal degradation, reduction product caused by protein degradation impure, To influence the stability of pentamer albumen vaccine.

The HPV16 L1 albumen that sequence pair H4 structural domain house of correction of the present invention obtains can be only formed pentamer, and this pentamer With good immunogenicity, infection of the HPV16 to human body can be prevented with the neutralizing antibody for HPV16 of induced high titers, It is a kind of good vaccine form.In addition, the recombination HPV16 L1 albumen used in the present invention is retaining overall length HPV16 L1 eggs While white antigenicity and pentamer particle assembling ability, it is easy to express in eukaryotic expression system and prokaryotic expression system, Increase the dissolubility of albumen, improve yield, reduce production cost, can be applied to large-scale industrial production.

With reference to as detailed below with after attached drawing, what the advantageous effect of these and other aspects of the invention will be apparent.This The disclosed all bibliography in place are completely incorporated as referring to herein.

Description of the drawings

Scheme HPV16 L1 pentamers transmission electron microscope observing (100,000 times) result prepared by l embodiments 1；The results show that regarding The pentamer of the visible a diameter of 12nm in Yezhong or so, granular size are consistent with theoretical size, uniformity.

The dynamic light scattering observed result for the HPV16 L1 pentamers that Fig. 2-A are prepared according to embodiment 1, as a result shows five The grain size and particle size distribution figure of aggressiveness.

The dynamic light scattering observed result for the pentamer that Fig. 2-B are prepared according to embodiment 6, as a result shows the grain size of pentamer With particle size distribution figure.

The high pressure Liquid-Phase Molecular Sieve chromatogram of 1 HPV16 L1 pentamer albumens of Fig. 3 embodiments, display is pure through height in figure The pentamer albumen purity of change.

After HPV16 L1 pentamer vaccinated mices prepared by Fig. 4 embodiments, after second booster immunization 3 weeks, inspection The average titer for surveying neutralizing antibody is horizontal.

With reference to embodiment to further citing description of the invention.These embodiments are non-limiting.

Embodiment l：The structure of engineering bacteria with HPV16 L1 sequences 2

1, HPV16 L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence SEQ ID NO：1.

2, contain SEQ ID NO：1 genetic fragment does the template of PCR reactions.With forward primer sequence：5’- CGCGGATCCGGAAA AGAAGATCCCCTTAAAAAA -3’；The sites restriction enzyme A ccIII are introduced at 5 ' ends of H4 structures, AccIII site sequences areTCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：5’-GCTCTCCTCGAG TTA TAATGTAAAT TTTGGTTTGG C -3 ', 5 ' ends introduce the sites restriction enzyme XhoI, XhoI site sequences ForCTCGAG.HPV16B is obtained through PCR reaction amplifications.

3, contain SEQ ID NO：1 genetic fragment does the template of PCR reactions.With the restriction enzyme BamH containing introducing I site, BamH I site sequences areGGATCC, forward primer sequence：5’-CGCGGAGGATCC GGA GGA GGA GCCACT GTCTACTTGC CTCCT-3’；The sites restriction enzyme A ccIII are introduced at 3 ' ends of H4 structures, AccIII site sequences areTCCGGA, reverse primer sequences：GCTCTCTCCGGATCC TCC TCC ATTCCAGTCC TCCAAAATAG；It is reacted through PCR Amplification amplification obtains HPV16A.

4, HPV16A segments and HPV16B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make HPV16A and HPV16B segments are connected with T4 DNA ligases, is allowed to be formed one and deletes H4 structural domains, former H4 structural domains It is encoded the HPV16C of the nucleoside base sequence substitution of connecting peptides GGGSG.

5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV16c and table with T4 ligases Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments HPV16C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured It is classified as SEQ ID NO：2.

6, connection product preferably converts large intestine bar through electrotransformation or CaCl2 methods by recombinant plasmid transformed to Escherichia coli Bacterium BL21 host cells.The BL21 cells of conversion are applied on the LB plating mediums containing ampicillin, are cultivated through 37 DEG C, Picking monoclonal colonies are inoculated in LB liquid medium and cultivate 12 hours for 37 DEG C, and 1ml bacterium solutions is therefrom taken to prepare glycerol tube strain In -70 DEG C of preservations.

PCR reaction systems are specifically drawn comprising 20 μ g DNA profilings, lx PCR buffer solutions, forward and reverse in above steps Object（Concentration is 0.2 μ Μ), the Taq archaeal dna polymerases of 1.5mM magnesium ions, 1.0 units；Reaction condition is：95 DEG C Celsius Denaturation 5 minutes, through 36 PCR cycle amplification, each cycle for 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 2 minutes, instead It answers product to be incubated at 72 DEG C 10 minutes, then stops reaction.

Embodiment 2：The structure of engineering bacteria with HPV16 L1 sequences 4

1, the target gene segment of HPV16 L1 full length genes contains wild type purchased from Beijing An Zhen hospital-based outpatient obstetrical clinic The clinical cytology sample waste of HPV16 viruses, nucleotides sequence are classified as SEQ ID NO：3.

2, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With forward primer sequence：5’- CGCGGATCCGGAAA AGAAGATCCCCTTAAAAAA -3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures Site, AccIII site sequences areTCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：5’- GCTCTCCTCGAGTTA AGAGGTAGAT GAGGTGGTGG G -3 ', 5 ' ends introduce the sites restriction enzyme XhoI, XhoI site sequences areCTCGAG.It is reacted through PCR, amplification obtains HPV16B.

3, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With the restriction enzyme BamH containing introducing I site forward primer sequence：5’-CGCGGAGGATCCGGA GGA GGA GCCACT GTCTACTTGC CTCCT -3’； 3 ' ends of H4 structures introduce the sites restriction enzyme A ccIII, and AccIII site sequences areTCCGGA, reverse primer sequences： GCTCTCTCCGGATCC TCC TCC ATTCCAGTCC TCCAAAATAG；It is reacted through PCR, amplification obtains HPV16A.

4, HPV16A segments and HPV16B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make HPV16A and HPV16B segments are connected with T4 DNA ligases, is allowed to be formed one and deletes H4 structural domains, former H4 structural domains It is encoded the HPV16C of the nucleoside base sequence substitution of connecting peptides GGGSG.

5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV16c and table with T4 ligases Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments HPV16C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured It is classified as SEQ ID NO：4.

6, connection product preferably converts large intestine bar through electrotransformation or CaCl2 methods by recombinant plasmid transformed to Escherichia coli Bacterium BL21 host cells.The BL21 cells of conversion are applied on the LB plating mediums containing ampicillin, are cultivated through 37 DEG C, Picking monoclonal colonies are inoculated in LB liquid medium and cultivate 12 hours for 37 DEG C, and 1ml bacterium solutions is therefrom taken to prepare glycerol tube strain In -70 DEG C of preservations.

PCR reaction systems are specifically drawn comprising 20 μ g DNA profilings, lx PCR buffer solutions, forward and reverse in above steps Object（Concentration is 0.2 μ Μ), the Taq archaeal dna polymerases of 1.5mM magnesium ions, 1.0 units；Reaction condition is：95 DEG C Celsius Denaturation 5 minutes, through 36 PCR cycle amplification, each cycle for 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 2 minutes, instead It answers product to be incubated at 72 DEG C 10 minutes, then stops reaction.

Embodiment 3：The structure of engineering bacteria with HPV16 L1 sequences 6

1, HPV16 L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence SEQ ID NO：5.

2, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With forward primer sequence：5’- CGCGGATCCGGAAA AGAAGATCCCCTTAAAAAA-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures Point, AccIII site sequences areTCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：5’-GCTCTCCTCGAG TTA AGAGGTAGAT GAGGTGGTGG G-3 ', 5 ' ends introduce the sites restriction enzyme XhoI, and XhoI site sequences areCTCGAG.PCR reacts, and amplification obtains HPV16B.

3, contain SEQ ID NO：3 genetic fragments do the template of PCR reactions.With the restriction enzyme BamH containing introducing I site forward primer sequence：5’-CGCGGAGGATCCGGA GCC GGA GTCCCAGTATCTAAGGTTGTA-3’；It is tied in H4 3 ' ends of structure introduce the sites restriction enzyme A ccIII, and AccIII site sequences areTCCGGA, reverse primer sequences：5’- GCTCTCTCCGGATCC GGC TCC ATTCCAGTCC TCCAAAATAG -3’；It is reacted through PCR, amplification obtains HPV16A.

4, HPV16A segments and HPV16B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make HPV16A and HPV16B segments are connected with T4 DNA ligases, is allowed to be formed one and deletes H4 structural domains, original H4 knots Structure domain is encoded the HPV16C of the nucleoside base sequence substitution of connecting peptides GGGSG.

5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV16c and table with T4 ligases Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments HPV16C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured It is classified as SEQ ID NO：6.

Method of remaining operating procedure with reference to embodiment 1.

Embodiment 4：The structure of engineering bacteria with HPV16 L1 sequences 8

1, HPV16 L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence SEQ ID NO：7.

2, contain SEQ ID NO：7 genetic fragments do the template of PCR reactions.With forward primer sequence：5’- CGCGGATCCGGAAA AGAAGATCCCCTTAAAAAA-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures Point, AccIII site sequences areTCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：5’-GCTCTCCTCGAG TTA TTTTCCTAAT GTAAATTTGG G -3 ', 5 ' ends introduce the sites restriction enzyme XhoI, XhoI site sequences ForCTCGAG.It is reacted through PCR, amplification obtains HPV16B.

3, contain SEQ ID NO：7 genetic fragments do the template of PCR reactions.With the restriction enzyme Nhe containing introducing The sites I forward primer sequence：5’-CGCGGAGCTAGCGCC TCC GGA GTCCCAGTATCTAAGGTTGTA-3’；In H4 3 ' ends of structure introduce the sites restriction enzyme A ccIII, and AccIII site sequences areTCCGGA, reverse primer sequences：5’- GCTCTCTCCGGATCC TCC TCC ATTCCAGTCC TCCAAAATAG -3’；It is reacted through PCR, amplification obtains HPV16A.

4, HPV16A segments and HPV16B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make HPV16A and HPV16B segments are connected with T4 DNA ligases, is allowed to be formed one and deletes H4 structural domains, original H4 knots Structure domain is encoded the HPV16C of the nucleoside base sequence substitution of connecting peptides GGGSG.

5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV16c and table with T4 ligases Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments HPV16C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured It is classified as SEQ ID NO：8.

Method of remaining operating procedure with reference to embodiment 1.

Embodiment 5：The structure of engineering bacteria with HPV16 L1 sequences 10

1, HPV16 L1 full length genes are synthesized by Jin Wei intelligence bio tech ltd (GENEWIZ), nucleotide sequence SEQ ID NO：9.

2, contain SEQ ID NO：9 genetic fragments do the template of PCR reactions.With forward primer sequence：5’- CGCGGATCCGGAAA AGAAGATCCCCTTAAAAAA-3’；Restriction enzyme A ccIII is introduced at 5 ' ends of H4 structures Point, AccIII site sequences areTCCGGA.Downstream includes XhoI restriction enzyme sites, reverse primer sequences：5’-GCTCTCCTCGAG TTA CAGCTTACGT TTTTTGCGTT T -3 ', 5 ' ends introduce the sites restriction enzyme XhoI, XhoI site sequences ForCTCGAG.It is reacted through PCR, amplification obtains HPV16B.

3, contain SEQ ID NO：9 genetic fragments do the template of PCR reactions.With the restriction enzyme BamH containing introducing I site forward primer sequence：5’-CGCGGAGGATCCGGA GGA GGA GCCACTGTCTACTTGCCTCCT -3’；In H4 3 ' ends of structure introduce the sites restriction enzyme A ccIII, and AccIII site sequences areTCCGGA, reverse primer sequences：5’- GCTCTCTCCGGATCC TCC TCC ATTCCAGTCC TCCAAAATAG -3’；It is reacted through PCR, amplification obtains HPV16A.

4, HPV16A segments and HPV16B use restriction enzyme A ccIII digestions jointly, form special cohesive end, make HPV16A and HPV16B segments are connected with T4 DNA ligases, is allowed to be formed one and deletes H4 structural domains, original H4 knots Structure domain is encoded the HPV16C of the nucleoside base sequence substitution of connecting peptides GGGSG.

5, expression plasmid pGEX-4T-2 is digested with BamH I and XhoI, then connects HPV16c and table with T4 ligases Up to plasmid.BamH I/XhoI digestions are identified to obtain the positive expression clone pGEX-4T-2- for being inserted into L1 protein gene segments HPV16C.Using M13 (+)/(-) primer, the amino acid sequence that the purpose nucleotide sequence being inserted into plasmid is correct, encodes is measured It is classified as SEQ ID NO：10.

Method of remaining operating procedure with reference to embodiment 1.

Embodiment 6：The structure of engineering bacteria with HPV16 L1 sequences 11

Contain SEQ ID NO with synthesis：1 genetic fragment does the template of PCR reactions, and 8 amino acid are by GSGGG before N-terminal Substitution, C-terminal do not truncate amino acid, method PCR amplification in accordance with the above-mentioned embodiment 1, and it is SEQ to obtain its purpose amino acid sequence ID NO：11.

Embodiment 7：Recombinate great expression and the purifying of HPV16 L1 albumen

Protein expression：Take out the strain that freezes of embodiment 1- 6, tablet activation, 37 DEG C of culture 14- respectively in -70 DEG C 20h chooses lawn in 80mL seed culture mediums, 37 DEG C of culture 10-12h；Then 50L seeding tanks are inoculated in cultivate at 37 DEG C 10-12h；It is inoculated in later in 500L fermentation tanks, fermented and cultured, induced expression；Thalline were collected by centrifugation after induced expression.With Thalline is resuspended in pH7.4 phosphate buffers, is crushed later, and breaking method is available but is not limited to：High-pressure homogenization, ultrasonic disruption or The chemically or physically means such as lysozyme dissolving.Centrifugation obtains supernatant.Lowry methods detection total protein concentration can be used, use Elisa Method detects L1 contents.

Protein purification：Supernatant is available but is not limited to saltout, isoelectric precipitation, ion-exchange chromatography, affinity chromatography, molecule The isolation and purification methods such as sieve, obtain the pentamer of purity 98%HPV16 L1.Electricity consumption sem observation purified product, diameter are 10nm The pentamer albumen of left and right.

The specific steps are purify the L1 albumen in supernatant solution through affinity chromatography for purification process：Pre-install glutathione-fine jade Lipolysaccharide resin (4 B of Glutathione Sepharose of GE companies production) chromatographic column.Take a concentration of 50% The homogenate of 4 B-tree fat of Glutathione Sepharose is put into chromatographic column (needs 5-10ml resins even per 200ml albumen clear liquids Slurry).With the buffer solution A of 5-10 times of bed volume, (group is divided into：50mmol/L Tric-HCl, 200mmol/L NaCl, 1mmol/LEDTA, pH 8.0) washing resin, then albumen clear liquid is added in chromatographic column, is uniformly mixed with resin and in room temperature Filtered solution is released in lower effect after twenty minutes, and resin column is washed with the buffer solution A of 10 times of bed volumes.By accurate protease （Prescission Protease, abbreviation PP enzymes）It is diluted with buffer solution A, cycle digestion 120min in loading and column.Release enzyme Liquid is cut, eluted with suitable buffer solution A and collects destination protein.

Ion-exchange chromatogram purification：By the destination protein of above-mentioned collection Source Q or Mono Q（GE companies）Anion Exchange column carries out ion-exchange chromatography, collects destination protein.

Molecular sieve chromatography purifies：Gel of the destination protein molecular weight that ion-exchange chromatography is collected in 10-600kDa Filter medium carries out sieve chromatography, the final high-purity HPV16 L1 pentamer albumens for obtaining purity and being more than 98%.

Embodiment 8：The morphologic detection of HPV16 L1 pentamers

It send Shanghai Sangon Biotech Company to be sequenced the embodiment 1-6 engineered strains built, measures the target DNA sequence being inserted into plasmid The amino acid sequence of row, coding is SEQID NO：2、SEQID NO：4、SEQID NO：6、SEQID NO：8、SEQID NO： 10 、SEQID NO：Shown in 11, wherein embodiment 1-5 the result shows that H4 structural domains had not existed in original full length sequence, take and Instead of be coding connecting peptides GGGSG or GAGSG sequence " GGA GGA GGA TCC GGA " or " GGA GCC GGA TCC GGA " nucleotide sequences.

The product HPV16 that the engineered strain that embodiment 1-6 methods obtain is obtained using the method expression and purification of embodiment 7 L1 pentamer albumens, transmission electron microscope observing (100,000 times), the results show that the five of visible a diameter of 10nm or so poly- in the visual field Body, granular size are consistent with theoretical size, uniformity.The electromicroscopic photograph for wherein implementing sample obtained by 1 sequence is shown in attached drawing 1.

Carry out grain diameter measurement.Instrument is the dynamic light scattering particle instrument of Malvern Zetasizer NanoZS, is used Algorithm is Regulation algorithms.Sample measures after 0.22 u m membrane filtrations, the results are shown in Table 1.The result shows that six kinds The almost the same 12.85-13.96nm of pentamer average grain diameter, but monodispersity index PdI（Show the homogeneity of albumen）There are notable The monodispersity index of difference, wherein embodiment 1-5 samples is smaller, illustrates that sample is very uniform.The monodispersity index of 6 sample of embodiment It is larger, illustrate that sample is inhomogenous.

1 pentamer average grain diameter of table and monodispersity index

Albumen stoste after purification	Average grain diameter（nm）	Monodispersity index PdI
			1 HPV16 L1 pentamers of embodiment	12.85	0.029
2 HPV16 L1 pentamers of embodiment	13.45	0.043
			3 HPV16 L1 pentamers of embodiment	13.86	0.035
4 HPV16 L1 pentamers of embodiment	13.78	0.039
			5 HPV16 L1 pentamers of embodiment	13.96	0.076
6 HPV16 L1 pentamers of embodiment	13.93	0.133

The hydrated molecule dynamics average grain diameter of HPV16 L1 pentamer particles wherein prepared by embodiment 1 is 12.85nm, monodispersity index PdI are 0.029（It is specifically shown in attached drawing 2-A）；HPV16 L1 pentamers prepared by embodiment 6 The hydrated molecule dynamics average grain diameter of grain is 13.93nm, and monodispersity index PdI is 0.133（It is specifically shown in attached drawing 2-B）.

Embodiment 9：Albumen stoste purity detecting

Chromatographic column is TSK-GEL G3000 SWxl or identical fillers, the chromatographic column of separating ranges 10KDa-500 KDa； With the 0.1mol/l phosphate buffers of pH6.8（Disodium hydrogen phosphate 25.8g is weighed, sodium dihydrogen phosphate 4.37g adds ultra-pure water to make Dissolving, with phosphoric acid tune pH to 6.8, ultra-pure water constant volume is at 1000ml）For mobile phase；Flow velocity is 1ml/min；Detection wavelength 280nm； 25 DEG C of column temperature, applied sample amount cannot be less than 20ug, and sample main peak theoretical cam curve is not less than 1000, and tailing factor is less than 2.0, continuously 5 needle of sample introduction, the relative standard deviation of peak area are not greater than 3%.

The HPV albumen stostes of 7 gained of Example, diluted concentration is 1mg/ml respectively, and applied sample amount 20ul injects high pressure liquid Chromatography detects according to the method described above, calculates purity by area percentage, as a result see the table below 2 and attached drawing 3（Implement prepared by 1 HPV16 L1 pentamers sieve chromatography chromatogram）, all processing purity of protein are all higher than 98%.

The purity of the albumen stoste after purification of table 2

Albumen stoste after purification	Purity（%）
		1 HPV16 L1 pentamers of embodiment	99.80
2 HPV16 L1 pentamers of embodiment	99.03
		3 HPV16 L1 pentamers of embodiment	99.85
4 HPV16 L1 pentamers of embodiment	99.45
		5 HPV16 L1 pentamers of embodiment	99.32
6 HPV16 L1 pentamers of embodiment	97.25

Embodiment 10：Preparation containing HPV16 L1 pentamer albumen vaccines

The HPV16 L1 pentamer albumen stostes pH7.2 purified through 7 step of embodiment after respectively being prepared by embodiment 1-6 Borate buffer salt be diluted to the protein liquid of 100 μ g/ml, 50 μ g/ml aluminium hydroxides assistant is added in the protein liquid after taking 1ml to dilute Agent is sufficiently mixed absorption 2 hours, that is, obtains the HPV16 L1 pentamer albumen vaccines of 40 μ g/ml, be kept in dark place in 4 DEG C.

Embodiment 11：The immunogenicity determining of HPV16 L1 pentamer vaccines

The immunogenicity of mouse：HPV16 L1 pentamer albumen vaccine thinner for vaccine prepared by embodiment 10 is distinguished It is diluted to dosage shown in table 1, BALB/C mice, each processing group 10 are injected intraperitoneally with every 0.5mL.It is immunized every 3 weeks once, It is immunized 2 times altogether.Every mice serum is taken respectively within three weeks, measured respectively with experimental method using in cape horn fever poison cell after being immunized every time The neutralizing antibody titers of HPV16 are directed in mice serum after being immunized every time.The results are shown in Table 3, in second of booster immunization 3 Zhou Hou, the average titer for detecting neutralizing antibody are horizontal as shown in Fig. 4.

In 3 cape horn fever poison cell of table and experimental method detection HPV16 L1 pentamer albumens neutralizing antibody is horizontal

The result shows that HPV16 L1 pentamer albumen Mice Inoculateds prepared by embodiment, can produce after 3 weeks immune for the first time Raw neutralizing antibody；Neutralizing antibody after secondary immunity can reach very high level, and it is as shown in the table respectively.The results show, The HPV L1 pentamer albumens vaccines of sample preparation obtained by each embodiment can generate neutralizing antibody in animal body.Illustrate this Invent the HPV L1 pentamer albumen vaccines prepared has immunogenicity in human clinical trial, can prevent or treat Disease caused by HPV16 viruses.

Embodiment 12：HPV16 L1 protein yields compare

It will implement method of the engineering bacteria with reference to embodiment 7 of 1-6 methods structure, prepare HPV16 L1 albumen, calculation expression Amount (detects total protein concentration, with Elisa methods detection L1 contents) with Lowry methods, places the 6-20 hours stabilizations for comparing albumen later Property, the results are shown in Table 4.

4 protein content of table and stability experiment

Protein types	Expression obtains the percentage that L1 albumen accounts for total protein	Protein stability
			Contain SEQ ID NO：2 albumen	22..3%	At 4 DEG C>15 hours
Contain SEQ ID NO：4 albumen	19.4%	At 4 DEG C>15 hours
			Contain SEQ ID NO：6 albumen	14.5%	At 4 DEG C>15 hours
Contain SEQ ID NO：8 albumen	18.3%	At 4 DEG C>15 hours
			Contain SEQ ID NO：10 albumen	18.1%	At 4 DEG C>15 hours
Contain SEQ ID NO：11 albumen	7.5%	It precipitates within 6 hours at 4 DEG C

The result shows that the protein product stability of different aminoacids sequence composition is different.Wherein SEQ ID NO：2、SEQ ID NO：4、SEQ ID NO：6、SEQ ID NO：8 and SEQ ID NO：10, the SEQ ID NO not being transformed than H4 structural domain：11 HPV16 L1 protein purification products are prepared, the 6-15 hours stability for comparing albumen is placed, contains SEQ ID NO：11 sequences Protein purification products were precipitated at 6 hours, contained SEQ ID NO：2、SEQ ID NO：4、SEQ ID NO：6 SEQ ID NO：8 and SEQ ID NO：The protein purification products of 10 sequences were observed at 15 hours not to be precipitated, still keeps stablizing.

SEQUENCE LISTING

<110>Beijing Health Guard Biotechnology Co., Ltd.

<120>L 1 Protein of Human Papillomavirus Type 16 of recombination and application thereof

<130> 2013

<160> 11

<170> PatentIn version 3.3

<210> 1

<211> 1510

<212> DNA

<213>Artificial sequence

<400> 1

atgtctcttt ggctgcctag tgaggccact gtctacttgc ctcctgtccc agtatctaag 60

gttgtaagca cggatgaata tgttgcacgc acaaacatat attatcatgc aggaacatcc 120

agactacttg cagttggaca tccctatttt cctattaaaa aacctaacaa taacaaaata 180

ttagttccta aagtatcagg attacaatac agggtattta gaatacattt acctgacccc 240

aataagtttg gttttcctga cacctcattt tataatccag atacacagcg gctggtttgg 300

gcctgtgtag gtgttgaggt aggtcgtggt cagccattag gtgtgggcat tagtggccat 360

cctttattaa ataaattgga tgacacagaa aatgctagtg cttatgcagc aaatgcaggt 420

gtggataata gagaatgtat atctatggat tacaaacaaa cacaattgtg tttaattggt 480

tgcaaaccac ctatagggga acactggggc aaagggtccc catgtaccaa tgttgcagta 540

aatccaggtg attgtccacc attagagtta ataaacacag ttattcagga tggtgatatg 600

gttgatactg gctttggtgc tatggacttt actacattac aggctaacaa aagtgaagtt 660

ccactggata tttgtacatc tatttgcaaa tatccagatt atattaaaat ggtgtcagaa 720

ccatatggcg acagcttatt tttttattta cgaagggaac aaatgtttgt tagacattta 780

tttaataggg ctggtgctgt tggtgaaaat gtaccagacg atttatacat taaaggctct 840

gggtctactg caaatttagc cagttcaaat tattttccta cacctagtgg ttctatggtt 900

acctctgatg cccaaatatt caataaacct tattggttac aacgagcaca gggccacaat 960

aatggcattt gttggggtaa ccaactattt gttactgttg ttgatactac acgcagtaca 1020

aatatgtcat tatgtgctgc catatctact tcagaaacta catataaaaa tactaacttt 1080

aaggagtacc tacgacatgg ggaggaatat gatttacagt ttatttttca actgtgcaaa 1140

ataaccttaa ctgcagacgt tatgacatac atacattcta tgaattccac tattttggag 1200

gactggaatt ttggtctaca acctccccca ggaggcacac tagaagatac ttataggttt 1260

gtaacatccc aggcaattgc ttgtcaaaaa catacacctc cagcacctaa agaagatccc 1320

cttaaaaaat acactttttg ggaagtaaat ttaaaggaaa agttttctgc agacctagat 1380

cagtttcctt taggacgcaa atttttacta caagcaggat tgaaggccaa accaaaattt 1440

acattaggaa aacgaaaagc tacacccacc acctcatcta cctctacaac tgctaaacgc 1500

aaaaaacgta 1510

<210> 2

<211> 451

<212> PRT

<213>Artificial sequence

<400> 2

Gly Ser Gly Gly Gly Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser

1 5 10 15

Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn Ile Tyr Tyr

20 25 30

His Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro Tyr Phe Pro

35 40 45

Ile Lys Lys Pro Asn Asn Asn Lys Ile Leu Val Pro Lys Val Ser Gly

50 55 60

Leu Gln Tyr Arg Val Phe Arg Ile His Leu Pro Asp Pro Asn Lys Phe

65 70 75 80

Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val

85 90 95

Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro Leu Gly Val

100 105 110

Gly Ile Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp Thr Glu Asn

115 120 125

Ala Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg Glu Cys Ile

130 135 140

Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro

145 150 155 160

Pro Ile Gly Glu His Trp Gly Lys Gly Ser Pro Cys Thr Asn Val Ala

165 170 175

Val Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn Thr Val Ile

180 185 190

Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asp Phe Thr

195 200 205

Thr Leu Gln Ala Asn Lys Ser Glu Val Pro Leu Asp Ile Cys Thr Ser

210 215 220

Ile Cys Lys Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu Pro Tyr Gly

225 230 235 240

Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe Val Arg His

245 250 255

Leu Phe Asn Arg Ala Gly Ala Val Gly Glu Asn Val Pro Asp Asp Leu

260 265 270

Tyr Ile Lys Gly Ser Gly Ser Thr Ala Asn Leu Ala Ser Ser Asn Tyr

275 280 285

Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala Gln Ile Phe

290 295 300

Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile

305 310 315 320

Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser

325 330 335

Thr Asn Met Ser Leu Cys Ala Ala Ile Ser Thr Ser Glu Thr Thr Tyr

340 345 350

Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Tyr Asp

355 360 365

Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val

370 375 380

Met Thr Tyr Ile His Ser Met Asn Ser Thr Ile Leu Glu Asp Trp Asn

385 390 395 400

Gly Gly Gly Ser Gly Lys Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp

405 410 415

Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro

420 425 430

Leu Gly Arg Lys Phe Leu Leu Gln Ala Gly Leu Lys Ala Lys Pro Lys

435 440 445

Phe Thr Leu

450

<210> 3

<211> 1518

<212> DNA

<213>Artificial sequence

<400> 3

atgtctcttt ggctgcctag tgaggccact gtctacttgc ctcctgtccc agtatctaag 60

gttgtaagca cggatgaata tgttgcacgc acaaacatat attatcatgc aggaacatcc 120

agactacttg cagttggaca tccctatttt cctattaaaa aacctaacaa taacaaaata 180

ttagttccta aagtatcagg attacaatac agggtattta gaatacattt acctgacccc 240

aataagtttg gttttcctga cacctcattt tataatccag atacacagcg gctggtttgg 300

gcctgtgtag gtgttgaggt aggtcgtggt cagccattag gtgtgggcat tagtggccat 360

cctttattaa ataaattgga tgacacagaa aatgctagtg cttatgcagc aaatgcaggt 420

gtggataata gagaatgtat atctatggat tacaaacaaa cacaattgtg tttaattggt 480

tgcaaaccac ctatagggga acactggggc aaagggtccc catgtaccaa tgttgcagta 540

aatccaggtg attgtccacc attagagtta ataaacacag ttattcagga tggtgatatg 600

gttgatactg gctttggtgc tatggacttt actacattac aggctaacaa aagtgaagtt 660

ccactggata tttgtacatc tatttgcaaa tatccagatt atattaaaat ggtgtcagaa 720

ccatatggcg acagcttatt tttttattta cgaagggaac aaatgtttgt tagacattta 780

tttaataggg ctggtgctgt tggtgaaaat gtaccagacg atttatacat taaaggctct 840

gggtctactg caaatttagc cagttcaaat tattttccta cacctagtgg ttctatggtt 900

acctctgatg cccaaatatt caataaacct tattggttac aacgaacaca gggccacaat 960

aatggcattt gttggggtaa ccaactattt gtaactgttg ttgatactac acgcagtaca 1020

aatatgtctt tatgtgctgc catatctact tcagaaacta catataaaaa tactaacttt 1080

aaggagtacc tacgacatgg ggaggaatat gatttacagt ttatttttca actgtgcaaa 1140

ataaccttaa ctgcagacgt tatgacatac atacattcta tgaattctac tattttggag 1200

gactggaatt ttggtctaca acctccccca ggaggcacac tagaagatac ttataggttt 1260

gtaacatccc aggcaattgc ttgtcaaaaa catacacctc cagcacctaa agaagatccc 1320

cttaaaaaat acactttttg ggaagtaaat ttaaaggaaa agttttctgc agacctagat 1380

cagtttcctt taggacgcaa atttttacta caagcaggat tgaaggccaa accaaaattt 1440

acattaggaa aacgaaaagc tacacccacc acctcatcta cctctacaac tgctaaacgc 1500

aaaaaacgta agctgtaa 1518

<210> 4

<211> 464

<212> PRT

<213>Artificial sequence

<400> 4

Gly Ser Gly Gly Gly Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser

1 5 10 15

Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn Ile Tyr Tyr

20 25 30

His Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro Tyr Phe Pro

35 40 45

Ile Lys Lys Pro Asn Asn Asn Lys Ile Leu Val Pro Lys Val Ser Gly

50 55 60

Leu Gln Tyr Arg Val Phe Arg Ile His Leu Pro Asp Pro Asn Lys Phe

65 70 75 80

Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val

85 90 95

Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro Leu Gly Val

100 105 110

Gly Ile Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp Thr Glu Asn

115 120 125

Ala Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg Glu Cys Ile

130 135 140

Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro

145 150 155 160

Pro Ile Gly Glu His Trp Gly Lys Gly Ser Pro Cys Thr Asn Val Ala

165 170 175

Val Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn Thr Val Ile

180 185 190

Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asp Phe Thr

195 200 205

Thr Leu Gln Ala Asn Lys Ser Glu Val Pro Leu Asp Ile Cys Thr Ser

210 215 220

Ile Cys Lys Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu Pro Tyr Gly

225 230 235 240

Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe Val Arg His

245 250 255

Leu Phe Asn Arg Ala Gly Ala Val Gly Glu Asn Val Pro Asp Asp Leu

260 265 270

Tyr Ile Lys Gly Ser Gly Ser Thr Ala Asn Leu Ala Ser Ser Asn Tyr

275 280 285

Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala Gln Ile Phe

290 295 300

Asn Lys Pro Tyr Trp Leu Gln Arg Thr Gln Gly His Asn Asn Gly Ile

305 310 315 320

Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser

325 330 335

Thr Asn Met Ser Leu Cys Ala Ala Ile Ser Thr Ser Glu Thr Thr Tyr

340 345 350

Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Tyr Asp

355 360 365

Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val

370 375 380

Met Thr Tyr Ile His Ser Met Asn Ser Thr Ile Leu Glu Asp Trp Asn

385 390 395 400

Gly Gly Gly Ser Gly Lys Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp

405 410 415

Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro

420 425 430

Leu Gly Arg Lys Phe Leu Leu Gln Ala Gly Leu Lys Ala Lys Pro Lys

435 440 445

Phe Thr Leu Gly Lys Arg Lys Ala Thr Pro Thr Thr Ser Ser Thr Ser

450 455 460

<210> 5

<211> 1518

<212> DNA

<213>Artificial sequence

<400> 5

atgtctcttt ggctgcctag tgaggccact gtctacttgc ctcctgtccc agtatctaag 60

gttgtaagca cggatgaata tgttgcacgc acaaacatat attatcatgc aggaacatcc 120

agactacttg cagttggaca tccctatttt cctattaaaa aacctaacaa taacaaaata 180

ttagttccta aagtatcagg attacaatac agggtattta gaatacattt acctgacccc 240

aataagtttg gttttcctga cacctcattt tataatccag atacacagcg gctggtttgg 300

gcctgtgtag gtgttgaggt aggtcgtggt cagccattag gtgtgggcat tagtggccat 360

cctttattaa ataaattgga tgacacagaa aatgctagtg cttatgcagc aaatgcaggt 420

gtggataata gagaatgtat atctatggat tacaaacaaa cacaattgtg tttaattggt 480

tgcaaaccac ctatagggga acactggggc aaagggtccc catgtaccaa tgttgcagta 540

aatccaggtg attgtccacc attagagtta ataaacacag ttattcagga tggtgatatg 600

gttgatactg gctttggtgc tatggacttt actacattac aggctaacaa aagtgaagtt 660

ccactggata tttgtacatc tatttgcaaa tatccagatt atattaaaat ggtgtcagaa 720

ccatatggcg acagcttatt tttttattta cgaagggaac aaatgtttgt tggacattta 780

tttaataggg ctggtgctgt tggtgaaaat gtaccagacg atttatacat taaaggctct 840

gggtctactg caaatttagc cagttcaaat tattttccta cacctagtgg ttctatggtt 900

acctctgatg cccaaatatt caataaacct tattggttac aacgagcaca gggccacaat 960

aatggcattt gttggggtaa ccaactattt gttactgttg ttgatactac acgcagtaca 1020

aatatgtcat tatgtgctgc catatctact tcagaaacta catataaaaa tactaacttt 1080

aaggagtacc tacgacatgg ggaggaatat gatttacagt ttatttttca actgtgcaaa 1140

ataaccttaa ctgcagacgt tatgacatac atacattcta tgaattctac tattttggag 1200

gactggaatt ttggtctaca acctccccca ggaggcacac tagaagatac ttataggttt 1260

gtaacatccc aggcaattgc ttgtcaaaaa catacacctc cagcacctaa agaagatccc 1320

cttaaaaaat acactttttg ggaagtaaat ttaaaggaaa agttttctgc agacctagat 1380

cagtttcctt taggacgcaa atttttacta caagcaggat tgaaggccaa accaaaattt 1440

acattaggaa aacgaaaagc tacacccacc acctcatcta cctctacaac tgctaaacgc 1500

aaaaaacgta agctgtaa 1518

<210> 6

<211> 457

<212> PRT

<213>Artificial sequence

<400> 6

Gly Ser Gly Ala Gly Val Pro Val Ser Lys Val Val Ser Thr Asp Glu

1 5 10 15

Tyr Val Ala Arg Thr Asn Ile Tyr Tyr His Ala Gly Thr Ser Arg Leu

20 25 30

Leu Ala Val Gly His Pro Tyr Phe Pro Ile Lys Lys Pro Asn Asn Asn

35 40 45

Lys Ile Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val Phe Arg

50 55 60

Ile His Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe

65 70 75 80

Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly Val Glu

85 90 95

Val Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His Pro Leu

100 105 110

Leu Asn Lys Leu Asp Asp Thr Glu Asn Ala Ser Ala Tyr Ala Ala Asn

115 120 125

Ala Gly Val Asp Asn Arg Glu Cys Ile Ser Met Asp Tyr Lys Gln Thr

130 135 140

Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Ile Gly Glu His Trp Gly

145 150 155 160

Lys Gly Ser Pro Cys Thr Asn Val Ala Val Asn Pro Gly Asp Cys Pro

165 170 175

Pro Leu Glu Leu Ile Asn Thr Val Ile Gln Asp Gly Asp Met Val Asp

180 185 190

Thr Gly Phe Gly Ala Met Asp Phe Thr Thr Leu Gln Ala Asn Lys Ser

195 200 205

Glu Val Pro Leu Asp Ile Cys Thr Ser Ile Cys Lys Tyr Pro Asp Tyr

210 215 220

Ile Lys Met Val Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Tyr Leu

225 230 235 240

Arg Arg Glu Gln Met Phe Val Gly His Leu Phe Asn Arg Ala Gly Ala

245 250 255

Val Gly Glu Asn Val Pro Asp Asp Leu Tyr Ile Lys Gly Ser Gly Ser

260 265 270

Thr Ala Asn Leu Ala Ser Ser Asn Tyr Phe Pro Thr Pro Ser Gly Ser

275 280 285

Met Val Thr Ser Asp Ala Gln Ile Phe Asn Lys Pro Tyr Trp Leu Gln

290 295 300

Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe

305 310 315 320

Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Ser Leu Cys Ala

325 330 335

Ala Ile Ser Thr Ser Glu Thr Thr Tyr Lys Asn Thr Asn Phe Lys Glu

340 345 350

Tyr Leu Arg His Gly Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu

355 360 365

Cys Lys Ile Thr Leu Thr Ala Asp Val Met Thr Tyr Ile His Ser Met

370 375 380

Asn Ser Thr Ile Leu Glu Asp Trp Asn Gly Ala Gly Ser Gly Lys Glu

385 390 395 400

Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys

405 410 415

Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu

420 425 430

Gln Ala Gly Leu Lys Ala Lys Pro Lys Phe Thr Leu Gly Lys Arg Lys

435 440 445

Ala Thr Pro Thr Thr Ser Ser Thr Ser

450 455

<210> 7

<211> 1518

<212> DNA

<213>Artificial sequence

<400> 7

atgtctcttt ggctgcctag tgaggccact gtctacttgc ctcctgtccc agtatctaag 60

gttgtaagca cggatgaata tgttgcacgc acaaacatat attatcatgc aggaacatcc 120

agactacttg cagttggaca tccctatttt cctattaaaa aacctaacaa taacaaaata 180

ttagttccta aagtatcagg attacaatac agggtattta gaatacattt acgtgacccc 240

aataagtttg gttttcctga cacctcattt tacaatccag atacacagcg gctggtttgg 300

gcctgtgtag gtgttgaggt aggtcgtggt cagccattag gtgtaggcat tagtggccat 360

cctttattaa ataaattgga tgacacagaa aatgctagtg cttatgcagc aaatgcaggt 420

gtggataata gagaatgtat atctatggat tacaaacaaa cacaattgtg tttaattggt 480

tgcaaaccac ctatagggga acactggggc aaagggtccc catgtaacaa tgttgcagta 540

aatccaggtg attgtccacc attagagtta ataaacacag ttattcagga tggtgatatg 600

gttgataccg gctttggtgc tatggacttt actacattac aggctaacaa aagtgaagtt 660

ccactggata tttgtacatc tatttgcaaa tatccagatt atattaaaat ggtgtcagaa 720

ccatatggcg acagcttatt tttttattta cgaagggaac aaatgtttgt tagacattta 780

tttaataggg ctggtgctgt tggtgaaaat gtaccagacg atttatacat taaaggctct 840

gggtctactg caaatttagc cagttcaaat tattttccta cacctagtgg ttctatggtt 900

acctctgatg cccaaatatt taataaacct tattggttac aacgagcaca gggccacaat 960

aatggcattt gttggggtaa ccaactgttt gttactgttg ttgatactac acgcagtaca 1020

aatatgtcat tatgtgctgc catatctact tcagaaccta catataaaaa tactaacttt 1080

aaagagtacc tacgacatgg ggaggaatat gatttacagt ttatttttca actgtgcaaa 1140

ataaccttaa ctgcagacgt tatgtcatac atacattcta tgaattccac tattttggag 1200

gactggaatt ttggtttaca acctcctcca ggaggcacac tagaagatac ttataggttt 1260

gtaacatccc aggcaattgc ttgtcaaaaa catacacctc cagcacctaa agaagatccc 1320

cttaaaaaat acactttttg ggaagtaaat ttaaaggaaa agttttctgc agacctagat 1380

cagtttcctt taggacgcaa atttttacta caagcaggat tgaaggccaa acccaaattt 1440

acattaggaa aacgaaaagc tacacccacc acctcatcta cctctacaac tgctaaacgc 1500

aaaaaacgta agctgtaa 1518

<210> 8

<211> 446

<212> PRT

<213>Artificial sequence

<400> 8

Ala Ser Ala Ser Gly Val Pro Val Ser Lys Val Val Ser Thr Asp Glu

1 5 10 15

Tyr Val Ala Arg Thr Asn Ile Tyr Tyr His Ala Gly Thr Ser Arg Leu

20 25 30

Leu Ala Val Gly His Pro Tyr Phe Pro Ile Lys Lys Pro Asn Asn Asn

35 40 45

Lys Ile Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val Phe Arg

50 55 60

Ile His Leu Arg Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe

65 70 75 80

Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val Gly Val Glu

85 90 95

Val Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His Pro Leu

100 105 110

Leu Asn Lys Leu Asp Asp Thr Glu Asn Ala Ser Ala Tyr Ala Ala Asn

115 120 125

Ala Gly Val Asp Asn Arg Glu Cys Ile Ser Met Asp Tyr Lys Gln Thr

130 135 140

Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Ile Gly Glu His Trp Gly

145 150 155 160

Lys Gly Ser Pro Cys Asn Asn Val Ala Val Asn Pro Gly Asp Cys Pro

165 170 175

Pro Leu Glu Leu Ile Asn Thr Val Ile Gln Asp Gly Asp Met Val Asp

180 185 190

Thr Gly Phe Gly Ala Met Asp Phe Thr Thr Leu Gln Ala Asn Lys Ser

195 200 205

Glu Val Pro Leu Asp Ile Cys Thr Ser Ile Cys Lys Tyr Pro Asp Tyr

210 215 220

Ile Lys Met Val Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe Tyr Leu

225 230 235 240

Arg Arg Glu Gln Met Phe Val Arg His Leu Phe Asn Arg Ala Gly Ala

245 250 255

Val Gly Glu Asn Val Pro Asp Asp Leu Tyr Ile Lys Gly Ser Gly Ser

260 265 270

Thr Ala Asn Leu Ala Ser Ser Asn Tyr Phe Pro Thr Pro Ser Gly Ser

275 280 285

Met Val Thr Ser Asp Ala Gln Ile Phe Asn Lys Pro Tyr Trp Leu Gln

290 295 300

Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe

305 310 315 320

Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Ser Leu Cys Ala

325 330 335

Ala Ile Ser Thr Ser Glu Pro Thr Tyr Lys Asn Thr Asn Phe Lys Glu

340 345 350

Tyr Leu Arg His Gly Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu

355 360 365

Cys Lys Ile Thr Leu Thr Ala Asp Val Met Ser Tyr Ile His Ser Met

370 375 380

Asn Ser Thr Ile Leu Glu Asp Trp Asn Gly Gly Gly Ser Gly Lys Glu

385 390 395 400

Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys

405 410 415

Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu

420 425 430

Gln Ala Gly Leu Lys Ala Lys Pro Lys Phe Thr Leu Gly Lys

435 440 445

<210> 9

<211> 1518

<212> DNA

<213>Artificial sequence

<400> 9

atgtctcttt ggctgcctag tgaggccact gtctacttgc ctcctgtccc agtatctaaa 60

gttgtaagca cggatgaata tgttgcacgc acaaacatat attatcatgc aggaacatcc 120

agactacttg cagttggaca tccctatttt cctattaaaa aacctaacaa taacaaaata 180

ttagttccta aagtatcagg attacaatac agggtattta gaatatattt acctgacccc 240

aataagtttg gttttcctga cacctcattt tacaatccag atacacagcg gctggtttgg 300

gcctgtgtag gtgttgaggt aggtcgtggt cagccattag gtgtgggcat tagtggccat 360

cctttattaa ataaattgga tgacacagaa aatgctagtg cttatgcagc aaatgcaggt 420

gtggataata gagaatgtat atctatggat tacaaacaaa cacaattgtg tttaattggt 480

tgcaaaccac ctatagggga acactggggc aaagggtccc catgtaacaa tgttgcagta 540

actccaggtg attgtccacc attagagtta ataaacacag ttattcagga tggtgatatg 600

gttgataccg gctttggtgc tatggacttt actacattac aggctaacaa aagtgaagtt 660

ccactggata tttgtacgtc tatttgcaaa tatccagatt atattaaaat ggtgtcagaa 720

ccatatggcg acagcttatt tttttattta cgaagggaac aaatgtttgt tagacattta 780

tttaataggg ctggtgctgt tggtgaaaat gtaccagacg atttatacat taaaggctct 840

gggcctactg caaatttagc cagttcaaat tattttccta cacctagtgg ttctatggtt 900

acctctgatg cccaaatatt taataaacct tattggttac aacgagcaca gggccacaat 960

aatggcattt gttggggtaa ccaactattt gttactgttg ttgatactac acgcagtaca 1020

aatatgtcat tatgtgctgc catatctact tcagaaccta catataaaaa tactaacttt 1080

aaagagtacc tacgacatgg ggaggaatat gatttacagt ttatttttca actgtgcaaa 1140

ataaccttaa ctgcagacgt tatgacatac atacattcta tgaattccac tattttggag 1200

gactggaatt ttggtttaca acctcctcca ggaggcacac tagaagatac ttataggttt 1260

gtaacatccc aggcaattgc ttgtcaaaaa catacacctc cagcacctaa agaagatccc 1320

cttaaaaaat atactttttg ggaagtaaat ttaaaagaaa agttttctgc agacctagat 1380

cagtttcctt taggacgcaa atttttacta caggcaggat ttaaggccaa accaaaattt 1440

acattaggaa aacgaaaagc tacacccacc acctcatcta cctctacaac tgctaaacgc 1500

aaaaaacgta agctgtaa 1518

<210> 10

<211> 474

<212> PRT

<213>Artificial sequence

<400> 10

Gly Ser Gly Gly Gly Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser

1 5 10 15

Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn Ile Tyr Tyr

20 25 30

His Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro Tyr Phe Pro

35 40 45

Ile Lys Lys Pro Asn Asn Asn Lys Ile Leu Val Pro Lys Val Ser Gly

50 55 60

Leu Gln Tyr Arg Val Phe Arg Ile Tyr Leu Pro Asp Pro Asn Lys Phe

65 70 75 80

Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val

85 90 95

Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro Leu Gly Val

100 105 110

Gly Ile Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp Thr Glu Asn

115 120 125

Ala Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg Glu Cys Ile

130 135 140

Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro

145 150 155 160

Pro Ile Gly Glu His Trp Gly Lys Gly Ser Pro Cys Asn Asn Val Ala

165 170 175

Val Thr Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn Thr Val Ile

180 185 190

Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met Asp Phe Thr

195 200 205

Thr Leu Gln Ala Asn Lys Ser Glu Val Pro Leu Asp Ile Cys Thr Ser

210 215 220

Ile Cys Lys Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu Pro Tyr Gly

225 230 235 240

Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe Val Arg His

245 250 255

Leu Phe Asn Arg Ala Gly Ala Val Gly Glu Asn Val Pro Asp Asp Leu

260 265 270

Tyr Ile Lys Gly Ser Gly Pro Thr Ala Asn Leu Ala Ser Ser Asn Tyr

275 280 285

Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala Gln Ile Phe

290 295 300

Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile

305 310 315 320

Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser

325 330 335

Thr Asn Met Ser Leu Cys Ala Ala Ile Ser Thr Ser Glu Pro Thr Tyr

340 345 350

Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Tyr Asp

355 360 365

Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val

370 375 380

Met Thr Tyr Ile His Ser Met Asn Ser Thr Ile Leu Glu Asp Trp Asn

385 390 395 400

Gly Gly Gly Ser Gly Lys Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp

405 410 415

Glu Val Asn Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro

420 425 430

Leu Gly Arg Lys Phe Leu Leu Gln Ala Gly Phe Lys Ala Lys Pro Lys

435 440 445

Phe Thr Leu Gly Lys Arg Lys Ala Thr Pro Thr Thr Ser Ser Thr Ser

450 455 460

Thr Thr Ala Lys Arg Lys Lys Arg Lys Leu

465 470

<210> 11

<211> 560

<212> PRT

<213>Artificial sequence

<400> 11

Gly Ser Gly Gly Gly Val Tyr Val Pro Pro Pro Asn Pro Val Ser Lys

1 5 10 15

Val Val Ala Thr Asp Ala Tyr Val Lys Arg Thr Asn Ile Phe Tyr His

20 25 30

Ala Ser Ser Ser Arg Leu Leu Ala Val Gly His Pro Tyr Tyr Ser Ile

35 40 45

Lys Lys Val Asn Lys Thr Val Val Pro Lys Val Ser Gly Ser Gly Gly

50 55 60

Gly Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser

65 70 75 80

Thr Asp Glu Tyr Val Ala Arg Thr Asn Ile Tyr Tyr His Ala Gly Thr

85 90 95

Ser Arg Leu Leu Ala Val Gly His Pro Tyr Phe Pro Ile Lys Lys Pro

100 105 110

Asn Asn Asn Lys Ile Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg

115 120 125

Val Phe Arg Ile His Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp

130 135 140

Thr Ser Phe Tyr Asn Pro Asp Thr Gln Arg Leu Val Trp Ala Cys Val

145 150 155 160

Gly Val Glu Val Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly

165 170 175

His Pro Leu Leu Asn Lys Leu Asp Asp Thr Glu Asn Ala Ser Ala Tyr

180 185 190

Ala Ala Asn Ala Gly Val Asp Asn Arg Glu Cys Ile Ser Met Asp Tyr

195 200 205

Lys Gln Thr Gln Leu Cys Leu Ile Gly Cys Lys Pro Pro Ile Gly Glu

210 215 220

His Trp Gly Lys Gly Ser Pro Cys Thr Asn Val Ala Val Asn Pro Gly

225 230 235 240

Asp Cys Pro Pro Leu Glu Leu Ile Asn Thr Val Ile Gln Asp Gly Asp

245 250 255

Met Val Asp Thr Gly Phe Gly Ala Met Asp Phe Thr Thr Leu Gln Ala

260 265 270

Asn Lys Ser Glu Val Pro Leu Asp Ile Cys Thr Ser Ile Cys Lys Tyr

275 280 285

Pro Asp Tyr Ile Lys Met Val Ser Glu Pro Tyr Gly Asp Ser Leu Phe

290 295 300

Phe Tyr Leu Arg Arg Glu Gln Met Phe Val Arg His Leu Phe Asn Arg

305 310 315 320

Ala Gly Ala Val Gly Glu Asn Val Pro Asp Asp Leu Tyr Ile Lys Gly

325 330 335

Ser Gly Ser Thr Ala Asn Leu Ala Ser Ser Asn Tyr Phe Pro Thr Pro

340 345 350

Ser Gly Ser Met Val Thr Ser Asp Ala Gln Ile Phe Asn Lys Pro Tyr

355 360 365

Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn

370 375 380

Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met Ser

385 390 395 400

Leu Cys Ala Ala Ile Ser Thr Ser Glu Thr Thr Tyr Lys Asn Thr Asn

405 410 415

Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Tyr Asp Leu Gln Phe Ile

420 425 430

Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val Met Thr Tyr Ile

435 440 445

His Ser Met Asn Ser Thr Ile Leu Glu Asp Trp Asn Phe Gly Leu Gln

450 455 460

Pro Pro Pro Gly Gly Thr Leu Glu Asp Thr Tyr Arg Phe Val Thr Ser

465 470 475 480

Gln Ala Ile Ala Cys Gln Lys His Thr Pro Pro Ala Pro Lys Glu Asp

485 490 495

Pro Leu Lys Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys Phe

500 505 510

Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln

515 520 525

Ala Gly Leu Lys Ala Lys Pro Lys Phe Thr Leu Gly Lys Arg Lys Ala

530 535 540

Thr Pro Thr Thr Ser Ser Thr Ser Thr Thr Ala Lys Arg Lys Lys Arg

545 550 555 560

Claims (9)

1. a kind of HPV16L1 albumen of recombination, which is characterized in that the amino acid sequence of the HPV16L1 albumen of the recombination be with Any one in lower sequence：

SEQ ID NO：2；

SEQ ID NO：4；

SEQ ID NO：6；

SEQ ID NO：8；

SEQ ID NO：10.

2. the polynucleotides of the HPV16L1 albumen of coding recombination described in claim 1.

3. including the expression vector of the polynucleotides described in claim 2.

4. including the cell of the expression vector described in claim 3.

5. a kind of HPV16L1 albumen pentamer, which is characterized in that the albumen pentamer is by five identical HPV16L1 albumen Monomer is formed, the sequence such as SEQ ID NO of the HPV16L1 protein monomers：2、SEQ ID NO：4、SEQ ID NO：6、SEQ ID NO：8 or SEQ ID NO：Shown in 10.

6. a kind of HPV vaccines, which is characterized in that the HPV vaccines include the HPV16L1 albumen pentamers described in claim 5 And medicinal adjuvant.

7. the preparation method of HPV vaccines as claimed in claim 6, which is characterized in that this method is：

A, the genetic fragment of the HPV16L1 albumen of clone or composite coding recombination described in claim 1；

B, the HPV16L1 albumen of recombination described in claim 1 is expressed in Escherichia coli or yeast expression system；

C, the pentamer being made of the HPV16L1 albumen of recombination described in claim 1 is purified；

D, vaccine is made in HPV16L1 albumen pentamer addition medicinal adjuvant.

8. HPV16L1 albumen pentamer as claimed in claim 5 is preparing the drug for preventing HPV16 infection and its leading to disease In application.

9. HPV vaccines as claimed in claim 6 are preparing the application in preventing HPV16 infection and its leading to the drug of disease.