CN105002190A - 11-type recombinant human papilloma virus virus-like particle and preparation method thereof - Google Patents

11-type recombinant human papilloma virus virus-like particle and preparation method thereof Download PDF

Info

Publication number
CN105002190A
CN105002190A CN201410672159.8A CN201410672159A CN105002190A CN 105002190 A CN105002190 A CN 105002190A CN 201410672159 A CN201410672159 A CN 201410672159A CN 105002190 A CN105002190 A CN 105002190A
Authority
CN
China
Prior art keywords
hpv11
protein
leu
lys
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410672159.8A
Other languages
Chinese (zh)
Other versions
CN105002190B (en
Inventor
许铮
刘永江
伍树明
潘勇昭
陈健平
高文双
银飞
陈丹
沈迩萃
王雅君
夏丽
任永峰
陈小江
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BEIJING HEALTH GUARD BIOTECHNOLOGY Co Ltd
Original Assignee
BEIJING HEALTH GUARD BIOTECHNOLOGY Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BEIJING HEALTH GUARD BIOTECHNOLOGY Co Ltd filed Critical BEIJING HEALTH GUARD BIOTECHNOLOGY Co Ltd
Priority to CN201410672159.8A priority Critical patent/CN105002190B/en
Publication of CN105002190A publication Critical patent/CN105002190A/en
Application granted granted Critical
Publication of CN105002190B publication Critical patent/CN105002190B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to an 11-type recombinant human papilloma virus virus-like particle and its preparation method. The specific technical key point is to provide a new recombinant coded polynucleotide gene fragment of an HPV11 L1 protein, a vector containing the gene fragment, a host cell containing the vector, an HPV11 L1 fusion protein translated and expressed by the gene fragment, a pentamer and VLP composed of the pentamer. The invention also discloses an application of the pentamer, a VLP protein and a vaccine composition composed of the VLP protein in the preparation of drugs for preventing HPV11 infection.

Description

11 type recombinant human papilloma virus virus-like particles and preparation method thereof
Technical field
The present invention relates to human papillomavirus virus-like particleand preparation method thereof.More specifically, the present invention relates to a kind of pentamer and virus-like particle (Virus-like Particle, VLP) and preparation method thereof of human mammilla tumor virus L 1 albumen of restructuring, and containing being somebody's turn to do virus-like particlethe application of vaccine composition in prevention of human papillomavirus infection.
Background technology
Human papillomavirus (Human Papillomavirus is called for short HPV), mainly through human body close contact, as the virus spread through sex intercourse, can cause the multiple proliferative epithelial lesion of the mankind, comprise papilloma (wart) and tumor-like lesion.Specifically, the disease that HPV brings out mainly comprises 3 large classes, the 1st class: the malignant changes such as the cancer of uterine neck, vagina, female vulva, penis and anus and the tumor of head and neck of some type.The cervical cancer patient of 100% is all that HPV infects and causes, the anus cancer of 90%, and the vulva of 40%, vagina and penis, the oropharynx of 12% and the mouth cancers of 3% infect owing to HPV.2nd class: benign lesion, as the Genital warts such as verruca plana, pointed condyloma, is a kind of sexually transmitted disease (STD), very common in the crowd that sexual behaviour is active.Although Genital warts can not cause serious consequence as cancer; but the clinical symptom that pathology can cause patient comparatively painful is usually as cusalgia, hemorrhage and pain; produce embarrassment, anxiety simultaneously and to feel oneself inferior etc. negative and psychoreaction, and the process of repeatedly treating wastes a large amount of medical resources.Worldwide estimate that the Genital warts caused by non-carcinogenic HPV (mainly 6 and 11 types) has 3,000 ten thousand, wherein 20 ~ 50% pathology in also include the polyinfection of high-risk HPV.3rd class: HPV infects can also cause recurrent respiratory papilloma (RRP), this be a kind of rare, there is potential fatefulue disease, mainly occur in adolescence, sometimes, a large amount of papillomas can cause has difficulty in breathing and causes less age death of child.So prevention or treatment HPV infect very great to human health meaning.
HPV is the double-stranded DNA virus without cyst membrane, primarily of virus coat and genomic dna composition (Bernard, Burk et al. 2011).HPV virus coat is by 360 L1 protein (forming 72 pentamers) and the icosahedral structure of virus that forms of 72 L2 protein at the most, diameter 55 ~ 60 nm (Howley and Lowy 2007).Virus capsid protein matter has self-assembly characteristic, L1 protein separately or form viral all particles (Virus-like Particle with L2 protein co-assemble in vitro, VLP) (Chen, Garcea et al. 2000, Finnen, Erickson et al. 2003, Buck, Cheng et al. 2008, Wang and Roden 2013).
Because HPV can not cell cultures in vitro, the specific antigens of this virus be obtained, recombinant vaccine can only be prepared by the method for recombinant DNA technology.The virus-like particle VLPs that restructuring Ll or L1/L2 assembling is formed, virus-free DNA, security is good, have with natural viral Particle Phase like epitope, neutralizing antibody IgG and IgA can be produced after stimulating body, therefore HPV VLPs can be used as preventative vaccine, thus greatly reduces the possibility (Howley and Lowy 2007) causing producing related neoplasms because infecting HPV.
The key of HPV vaccine development to prepare high purity, stable HPV antigen in a large number.In HPV vaccine antigen technology of preparing, the expression system of production HPV antigen comparatively conventional at present can be divided into eukaryotic expression system and prokaryotic expression system.Conventional eukaryotic expression system has pox viruses express system, insect baculovirus expression system, yeast expression system.The formation VLP that HPV L1 energy expressed in eukaryotic expression system is spontaneous, often only need carry out simple purifying can obtain VLP.But because the expression amount of eukaryotic expression system is low, toxigenic capacity is high, brings extreme difficulties to large-scale industrial production.Utilize escherichia expression system to express HPV L1 protein in prokaryotic expression system to have been reported.But the HPV L1 protein solubility expressed by intestinal bacteria is low, purification process known at present obtains HPV VLP by the steps such as salt-free precipitation or sex change renaturation final purifying from the numerous and diverse enchylema of kinds of protein mostly.Such as: open by procaryotic cell expression and the polymeric method of preparation HPV L1 in patent CN02129070.9, wherein purifying process comprises by 3.3M Urea treatment and dialysis renaturation process; Also be by urea-denatured process to the purification process of L1-GST fused protein in WO-0204007 patent and carry out dialysis renaturation; Also there is open L1 protein purification method to be comprise phosphoric acid buffer ultrafiltration dialysis and centrifugal in the prior art, make target protein precipitate the step of redissolving again.But in these purge processes, protein losses amount is large, and yield is low, is difficult to apply in scale operation.
In the homogeneity of HPV vaccine antigen protein matter VLP, the grain size dispersity of the HPV L1 VLP assembled in prior art has use polyd value to represent, polyd value <15% illustrates that particle has good homogeneity, illustrate between 15% to 30% that particle has larger unhomogeneity, be greater than 30% explanation particle homogeneous completely not.The HPV L1 VLP prepared in prior art is much in 15%.Another illustrates that the index of uniform particle diameter is PdI value, and PdI value is size distribution coefficient, is less than 0.05 for highly homogeneous sample; 0.05 ~ 0.1 is as the criterion homogeneous sample, and 0.1 ~ 0.3 is the poor sample of homogeneity, is greater than 0.3 for inhomogenous sample.The PdI disclosing the mixed protein liquid of two type HPV L1 VLP in US7205125B2 patent is 0.07.
Therefore, this area still need that cost is low, purity is high, output is high, the novel method of stay-in-grade HPV L1 protein production technology and large-scale industrial production restructuring HPV L1 VLP.
Summary of the invention
The object of the invention is the nucleotide sequence of the coding HPV11 L1 protein of openly a kind of optimization, comprise the carrier of this nucleotide sequence, comprise the host cell of carrier, and by the HPV L1 protein of this polynucleotide sequence accurate translation, Tag-HPV-L1 recombinant protein, the pentamer formed by this L1 protein and VLP, and the vaccine infected as the prevention HPV that antigen forms by this pentamer and VLP.
first aspect present invention provides a kind of gene through codon optimized HPV11 L1, its nucleotides sequence is classified as SEQ NO:2.
second aspect present invention provides a kind of expression vector of structure,it comprises the gene through codon optimized HPV11 L1 of first aspect present invention.Described carrier is applicable to driving allogeneic dna sequence DNA accurate translation HPV L1 protein in bacterium.In one embodiment, described expression vector preferred pGEX-6p-1, pGEX-4T-2, pMAL or pET28a.
a third aspect of the present invention provides a kind of engineering bacteria cell of structure,this cell comprises the gene of first aspect present invention, or the expression vector of second aspect.Described engineering bacteria host cell is intestinal bacteria, in one embodiment, and the preferred BL21 cell strain of described host cell.
fourth aspect present invention provides a kind of Tag-HPV11 L1 fusion rotein,wherein label Tag is 6*His.Tag, GST.Tag, SUMO.Tag, MBP.Tag, 6*His-SUMO.Tag or GST-SUMO.Tag; L1 is that HPV11 L1 full length protein and/or C hold brachymemma 5,10,15 or no more than 30 amino acid and/or N to hold brachymemma 2,4,6 or no more than 10 amino acid whose L1 protein.
The nucleotides sequence of coding Tag-HPVL1 fusion rotein GST-HPV11 L1 is classified as SEQ NO:3, SEQ NO:11, the nucleotides sequence of GST-SUMO-HPV11 L1 is classified as SEQ NO:4, SEQ NO:12, the nucleotide sequence SEQ NO:5 of MBP, SEQ NO:13, the nucleotides sequence of 6*His-HPV11 L1 is classified as SEQ NO:6, and the nucleotides sequence of 6*His-SUMO-HPV11 L1 is classified as SEQ NO:7.
The aminoacid sequence SEQ NO:10 of the aminoacid sequence of coding Tag-HPVL1 fusion rotein GST-HPV11 L1 to be the aminoacid sequence of SEQ NO:8, GST-SUMO-HPV11 L1 be SEQ NO:9, MBP.
the pentamer of the HPV L1 that fifth aspect present invention provides Tag-HPVL1 fused protein to obtain after purifying, and the VLP assembled by pentamer.hPV11 L1 pentamer albumen median size 10 ~ 15nm PdI<0.1 in a preferred embodiment.Median size 45 ~ 65nm PdI<0.1 of HPV11 L1VLP in a preferred embodiment.
sixth aspect present invention provides a kind of vaccine composition,it comprises the pentamer of HPV L1 of the present invention or the VLP of HPV L1, comprises pharmaceutically useful vehicle and medicinal adjuvant further in described composition.
Absorption preparation will be carried out with aluminum hydroxide adjuvant normal saline solution according to albumen and aluminium content 1:10 ratio respectively containing HPV11 L1 pentamer or VLP albumen stoste (preparing gained according to aforesaid method) in one embodiment and can obtain recombinate HPV L1 protein pentamer or VLP vaccine, stand-by 4 DEG C of preservations.
on the other hand, the present invention also provides a kind of method obtaining Tag-HPVL1 fusion rotein, comprises the steps:
A. by replacing the codon of the translation same protein of HPV11 L1 gene order with the codon of intestinal bacteria preference, the gene of the codon optimized HPV11 L1 of escherichia expression system preference is obtained;
B. the coli expression carrier of HPV11 L1 gene is built;
C. the escherichia coli expression engineering strain of Tag-HPV11 L1 is built;
D. abduction delivering purifying obtains fusion rotein Tag-HPV11 L1.
Above-mentionedly prepare prokaryotic host cell in fusion rotein Tag-HPV11 L1 method and be selected from but be not limited to GI698, ER2566, BL21 (DE3), XA90, B834 (DE3), BLR (DE3).
Above-mentionedly prepare expression condition in fusion rotein Tag-HPV11 L1 method and be: under 20 ~ 37 DEG C of temperature condition, abduction delivering 3 ~ 20 hours.Preferred under 28 DEG C of temperature condition in a specific embodiment, abduction delivering 16 hours.
the present invention also provides a kind of method obtaining HPV11 L1 pentamer, comprises the steps:
A) with affinity chromatography method absorption fusion rotein Tag-HPV11 L1;
B) add proteolytic enzyme excision Tag label, obtain HPV11 L1 pentamer protein;
C) purifying HPVL1 pentamer protein, obtain purity >98%, the L1 pentamer protein of median size 10 ~ 15nm PdI<0.1.
Be the site-specific proteolytic enzyme of excision Tag label for proteolytic enzyme described in above-mentioned preparation HPV11 L1 pentamer method: restructuring HRV 3CP, zymoplasm, SUMO proteolytic enzyme, SENP1 or TEV protease.
In above-mentioned preparation HPV11 L1 pentamer method, purification process is selected from but is not limited to ion exchange chromatography, hydrophobic chromatography method, molecular sieve (or claiming gel-filtration or size-exclusion) chromatography; Preferably purifying comprises ion exchange chromatography and molecular sieve chromatography.
In above-mentioned preparation HPV11 L1 pentamer method, purification process also comprises use reductive agent, such as, add DTT.
HPV11 L1 pentamer albumen median size 10 ~ 15nm PdI<0.1 is obtained after final purifying in above-mentioned preparation HPV11 L1 pentamer method.
present invention also offers a kind of method that HPV11 L1 pentamer is assembled into VLP, comprise the steps:
The L1 pentamer protein liquid of median size 10 ~ 15nm PdI<0.1 is mixed with assembling damping fluid, final acquisition pH value is 5.0 ~ 5.9, salt concn is 500 ~ 2000 mM, the HPV11 L1 VLP protein liquid of median size 45 ~ 65nm PdI<0.1, preferred acquisition pH value is 5.7, and salt concn is the HPV11 L1 VLP protein liquid of 1300 mM.
Assembling damping fluid includes but not limited to Tris damping fluid, phosphate buffered saline buffer, acetate buffer solution, HEPES damping fluid, MOPS damping fluid, citrate buffer, histidine buffering liquid, borate buffer etc.
Above-mentioned HPV11 L1 pentamer is assembled in the method for VLP can also add protective material in HPV11 L1-VLP protein liquid, such as: 0.01 ~ 0.1 Polysorbate 80.
on the other hand, present invention also offers the pentamer of HPV L1, VLP and comprise the vaccine of pentamer or VLPthe application of composition in the medicine of preparation prevention HPV infection.
According to the present invention, vaccine of the present invention can adopt the acceptable form of patient, includes but not limited to that injection or nasal cavity or oral cavity suck or vagina administration, optimizing injection and intramuscularly.
the explanation of relational language and explanation in the present invention
According to the present invention, term " escherichia expression system " refers to and is made up of intestinal bacteria (bacterial strain) and carrier, wherein intestinal bacteria (bacterial strain) derive from available on the market, illustrate at this but be not limited to: GI698, ER2566, BL21 (DE3), XA90, DH (5a), B834 (DE3), BLR (DE3).
According to the present invention, term " carrier " word refers to and the polynucleotide of certain coded protein can be inserted wherein and make protein obtain a kind of nucleic acid launch vehicle of expressing.Carrier can by transforming, and transduction or transfection host cell, the genetic material element making it carry obtains expression in host cell.For example, carrier comprises: plasmid; Phage; Coemid etc.
According to the present invention, " vaccine vehicle or carrier " refer to and are selected from one or more, include but not limited to: pH adjusting agent, tensio-active agent, adjuvant, ionic strength toughener term.Such as, pH adjusting agent is illustrated but is not limited to phosphate buffered saline buffer, and tensio-active agent comprises positively charged ion, negatively charged ion or nonionic surface active agent.Illustrate but be not limited to: Polysorbate 80.Adjuvant is illustrated but is not limited to aluminium hydroxide, aluminum phosphate, Fu Shi Freund's complete adjuvant, Fu Shi Freund's incomplete adjuvant etc.Ionic strength toughener is illustrated but is not limited to sodium-chlor.
According to the present invention, term " chromatogram " includes but not limited to: ion-exchange chromatography (such as cation-exchange chromatography, anion-exchange chromatography), hydrophobic interaction chromatograph, adsorption chromatography chromatography (such as hydroxylapatite chromatography), molecular sieve chromatography chromatography (gel-filtration or molecular exclusion chromatography), affinity chromatography method.
According to the present invention, in the restructuring HPV L1 method of protein that the present invention obtains, damping fluid refers to a kind of solution that greatly can reduce pH amplitude of fluctuation when adding a small amount of acid or alkali and water, include but not limited to Tris damping fluid, phosphate buffered saline buffer, acetate buffer solution, HEPES damping fluid, MOPS damping fluid, citrate buffer, histidine buffering liquid, borate buffer etc.
According to the present invention, described cytoclasis include but not limited to broken by homogenizer, clarifixator is broken, ultrasonication, grinding, high-pressure extrusion, in N,O-Diacetylmuramidase process one or multinomial method realize;
According to the present invention, in the restructuring HPV L1 method of protein that the present invention obtains, salt used includes but not limited to it is neutral salt, particularly an alkali metal salt, ammonium salt, hydrochloride, vitriol, supercarbonate, one or more in phosphoric acid salt or hydrophosphate, particularly NaCI, KCl, CaCl2, NH4Cl, KCI, NH4CI, MgSO4, (NH4) 2SO4.Preferred NaCI.Reductive agent used includes but not limited to DTT, 2 mercapto ethanol.Amount used includes but not limited to 2mM ~ lO0mM, preferably 10 ~ 15mM.
Beneficial effect
The invention provides a kind of synthetic gene, this gene order carried out codon optimized nucleotide sequence according to colibacillary codon preference, this sequence encoding HPV L1 protein amino acid sequence.Research finds that the nucleotide sequence of codon optimization is significantly increased relative to the expression amount of the L1 albumen without codon optimized nucleotide sequence.
Escherichia expression system disclosed by the invention have expression amount high, be easy to cultivate and operation and the advantage such as production cost is low.But only use this expression system to be still difficult to directly obtain the HPV L1 albumen of great amount of soluble, its reason is the as easy as rolling off a log formation inclusion body of L1 albumen, i.e. the insoluble polymer of abiology activity.In addition, even if obtain a large amount of inclusion bodys, in order to obtain the albumen of biologic activity, also sex change, renaturation process must be carried out to inclusion body, the albumen of this process often large losses.In order to solve this difficult problem, the present invention adopts integration technology, by L1 gene with have assist protein correctly to fold albumen as glutathione S-transferase (GST), SUMO, MBP, 6*His-SUMO or GST-SUMO etc. carry out amalgamation and expression, not only the solubility of albumen and yield increase, and GST-SUMO-HPVL1, 6*His-SUMO-HPVL1 makes do not have the residual of exogenous amino acid at HPV L1 protein N terminal, find the fusion tag that GST-SUMO wherein expresses as recombinant protein HPV L1 and molecular chaperones simultaneously, there is protease inhibitor hydrolysis, remarkable increase expression of recombinant proteins amount and promotion target protein correctly fold, improve the functions such as solubility.Therefore the technological line that the present invention adopts have employed label protein integration technology when building HPV L1 protein expression vector, the fusion rotein formed by label protein and L1 albumen on the one hand improves the solubility of target protein, improve output, affinity chromatography and proteolytic ferment excision can be utilized to merge the purifying feature that matter stamp methods carries out target protein by GST fusion tag on the other hand, thus achieve single step purification from the cell pyrolysis liquid of broad categories and can obtain the HPV L1 albumen that purity reaches more than 70%, substantially increase purification efficiency, thus improve the output of end product HPV L1 albumen.
Provided by the inventionly first to express, separation and purification to obtain after highly purified HPV L1 pentamer albumen Artificial Control assembling again and form the technological line of VLP, can solve current known technology exist from foreign protein miscellaneous cytoclasis liquid, direct purification VLP purity is low, degraded ratio is high, the problem that yield is low, obtains high purity pentamer assembled in vitro VLP and VLP preservation condition.
In addition, the present inventor have been surprisingly found that a kind of new assembling condition and method: i.e. cryogenic freezing process construction from part.The VLP obtained by the method inhomogenous for the particle diameter assembled before freeze thawing protein (PdI is greater than 0.1) can be become size coincidence theory expection and also homogeneous, the VLP that PdI is less than 0.1, the VLP that contrast prior art obtains is more stable, and different salt concn, pH value range can be stored in widely in damping fluid, the dilution of final vaccine preparation of being more convenient for and preparation.
The present invention, through the HPV L1 VLP protein of gained of recombinating, has good immunogenicity, can the neutralizing antibody for homotype HPV of induced high titers, and HPV is to the infection of human body in prevention, is a kind of good vaccine form.
With reference to as detailed below and accompanying drawingafter, these and other aspect of the present invention will be obvious.All reference disclosed herein all completely to be quoted as a reference at this.
Accompanying drawing explanation
Fig. 1: GST-HPV11 L1 protein is affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is protein mass marker Lane: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kdat, and left swimming lane is the resin of affine absorption GST-L1, and right swimming lane is the resin of GST and L1 after enzymolysis.
Fig. 2: GST-SUMO-HPV11 L1 protein through affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is for being protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and left swimming lane is the resin of affine absorption GST-SUMO-L1, and right swimming lane is the resin of GST-SUMO and L1 after enzymolysis.
Fig. 3: MBP-HPV11 L1 protein through affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is for being protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and left swimming lane is the resin of affine absorption MBP-L1, and right swimming lane is the resin of MBP and L1 after enzymolysis.
Fig. 4: 6*HIS-SUMO-HPV11 L1 protein through affine with enzymolysis after SDS-PAGE gel electrophoresis figure.M swimming lane is for being protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and left swimming lane is the resin of affine absorption 6*HIS-SUMO-L1, and right swimming lane is the resin of 6*HIS-SUMO and L1 after enzymolysis.The fused albumen with 6*HIS-SUMO label is not cut by gel electrophoresis figure display proteolytic enzyme.
Fig. 5: the restructuring HPV11 L1 pentamer protein s DS-PAGE gel electrophoresis figure of the present invention after molecular sieve chromatography purifying.M swimming lane is protein mass standard (being from top to bottom: 94kDa, 66kDa, 45kDa, 33kDa, 26kDa, 20kda), and another swimming lane is HPV L1 albumen.
The dynamic light scattering observed result of Fig. 6: HPV11 L1 pentamer.The particle size diameter of result display pentamer is 13.05nM, size-grade distribution PdI is 0.046.
The dynamic light scattering observed result of Fig. 7: HPV11 L1 VLP.The particle size diameter of result display VLP is 62.00 nM, size-grade distribution PdI is 0.055.
The transmission electron microscope photo of Fig. 8: HPV11 L1 pentamer albumen.
The transmission electron microscope photo of Fig. 9: HPV11 L1 VLP albumen.
The high-pressure liquid phase molecular sieve chromatography figure of Figure 10: HPV11 L1 pentamer protein, shows in figure and is greater than 98% through highly purified L1 pentamer lipidated protein.
The high-pressure liquid phase molecular sieve chromatography figure of Figure 11: HPV11 L1 VLP protein, shows in figure and is greater than 98% through highly purified VLP lipidated protein.
After each experimental group vaccinated mice of Figure 12: HPV11 L1 pentamer, at second time booster immunization after 4 weeks, detect the average titer level of neutralizing antibody.
After each experimental group vaccinated mice of Figure 13: HPV11 L1 VLP, at second time booster immunization after 4 weeks, detect the average titer level of neutralizing antibody.
Below in conjunction with embodiment, the present invention is illustrated description further.These embodiments are nonrestrictive.
EXAMPLE l: the Design and synthesis of codon optimized HPV L1 gene
Gene order derives from published various HPV sequence on PUBMED.With reference to intestinal bacteria, to selected various HPV DNA sequence dna, all HPV DNA sequence dnas of codon optimized rear synthesis are carried out to the preference of genetic transcription codon.According to synthetic DNA primers, synthetic gene is utilized to carry out pcr amplification for template.The codon optimised sequence of gained is verified by determined dna sequence.
The various DNA sequence dna of HPV before optimizing and after optimizing:
SEQ NO.1: the DNA sequence dna of the HPV11 type L1 before optimization
SEQ NO.2: the DNA sequence dna of the HPV11 type L1 after optimization
Embodiment 2: the structure of recombinant vectors pGEX-6P-1-GST-HPV11 L1 and qualification:
The DNA fragmentation primer of amplification HPV11 L1: (restriction enzyme site is BamHI and XhoI respectively)
Forward-HPV11 L1-ApaI:5’ACTTCA GGATCC ATGTGGCGTC CGTCTGACTCTA
Reverse-HPV11 L1-XhoI:5’ATCTCA CTCGAGCTA TTTTTTGGTT TTGGTACGTTT
pcr amplification reaction system:10 x Pfu buffer 20 μ L, Pfu enzyme 4 μ L, 10 mM dNTP 2.5 μ L, 5 ' Primer (5 μMs) 10 μ L, 3 ' Primer (5 μMs) 10 μ L, template DNA 50 ng, adds d2H2O to 200 μ L.
gene PCR amplification condition:95 DEG C of 3 min; 95 DEG C of 30 sec, 58 DEG C of 30 sec, 72 DEG C of 4 min; Circulate 32 times; 72 DEG C of 10 min.
L1 gene fragment containing BamH I and XhoI restriction enzyme site and vector pGEX-6P-1 are carried out the process of BamH I/XhoI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pGEX-6P-1 containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
The screening connecting and carry out recon in product to Host Strains DH5 α is transformed after ligation.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order afterwards by Shanghai Sheng Gong biotech firm, the nucleotides sequence obtaining merging restructuring GST-HPV11-L1 protein is classified as SEQ NO.3, and aminoacid sequence is SEQ NO.8.
With reference to the fusion recombinant vectors GST-HPV-L1 of this embodiment method preparation with GST label, its gene order SEQ NO.11.
Embodiment 3: recombinant vectors pGEX-6P-1m-GST-SUMO-HPV11 L1 vector construction
PGEX-6p-1m vector construction: the unique ApaI restriction enzyme site being carrier for the ApaI restriction enzyme site (GGGCCC) making multienzyme cut location proximate, under the prerequisite not changing lacI gene protein expressed sequence, by the synonym GGT that the Gly codon GGC in another ApaI recognition sequence GGGCCC of commercially available pGEX-6p-1 carrier is changed into it by point mutation technology, ApaI(3890 can be eliminated).ApaI is become can be used to the site of inserting expressing gene by such transformation.
The DNA fragmentation primer of amplification SUMO: (restriction enzyme site is ApaI and BamHI respectively)
Forward -SUMO-ApaI: ACTTCA GGGCCCTCTGACCAGGAAGCTAAACCGTC
Reverse-SUMO-BamHI: CGC GGATCCACCGGTCTGTTCCTGGTAAAC
The DNA fragmentation primer of amplification HPV11 L1: (restriction enzyme site is BamHI and XhoI respectively)
Forward-HPV11 L1-ApaI:5’ACTTCA GGATCC ATGTGGCGTC CGTCTGACTCTA
Reverse-HPV11 L1-XhoI:5’ATCTCA CTCGAGCTA TTTTTTGGTT TTGGTACGTTT
pcr amplification reaction system:10 x Pfu buffer 20 μ L, Pfu enzyme 4 μ L, 10 mM dNTP 2.5 μ L, 5 ' Primer (5 μMs) 10 μ L, 3 ' Primer (5 μMs) 10 μ L, template DNA 50 ng, adds d2H2O to 200 μ L.
gene PCR amplification condition:95 DEG C of 1.5 min; 95 DEG C of 30 sec, 58 DEG C of 30 sec, 72 DEG C of 1 min; Circulate 32 times; 72 DEG C of 10 min.
the same above-described embodiment of gene PCR amplification condition.
Enzyme cuts connection: the SUMO gene fragment containing ApaI and BamHI restriction enzyme site and vector pGEX-6P-1m are carried out the process of Apa I/ BamHI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pGEX-6P-1m containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15h.
Transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Jin Weizhi bio tech ltd, Suzhou afterwards, obtaining merging recombinant vectors pGSTSUMO-6p-1m.
Enzyme cuts connection again: the L1 gene fragment containing BamHI and Xho1 restriction enzyme site and recombinant vectors pGSTSUMO-6p-1m are carried out the process of BamHI/Xho1 double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pGSTSUMO-6p1m containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
Again transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening is carried out enlarged culturing and carries out the extraction of plasmid, checked order by Jin Weizhi bio tech ltd, Suzhou afterwards, obtain the fusion recombinant vectors GST-SUMO-L1 with GST-SUMO label, its gene order SEQ NO.4, aminoacid sequence is SEQ NO.9.
With reference to the fusion recombinant vectors GST-SUMO-L1 of this embodiment method preparation with GST-SUMO label, its gene order SEQ NO.12.
Embodiment 4: the structure of recombinant vectors pMAL-MBP-HPV11 L1
The DNA fragmentation primer of amplification HPV11 L1: (restriction enzyme site is EcoRI and HindIII respectively)
Forward-HPV11 L1-EcoRI:5’ ACTTCA GAATTC ATGTGGCGTC CGTCTGACTCTA
Reverse-HPV11 L1-HindIII:5’ ATCTCA AAGCTTCTA TTTTTTGGTT TTGGTACGTTT
L1 gene fragment containing EcoRI and HindIII restriction enzyme site and carrier pMAL are carried out the process of EcoRI/HindIII double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pMAL containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
The screening connecting and carry out recon in product to Host Strains DH5 α is transformed after ligation.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order afterwards by Shanghai Sheng Gong biotech firm, obtain the gene order SEQ NO.5 merging restructuring MBP-HPV11-L1 protein, aminoacid sequence is SEQ NO.10.
With reference to the fusion recombinant vectors MBP-HPV-L1 of this embodiment method preparation with MBP label, its gene order SEQ NO.13.
Embodiment 5: the structure of recombinant vectors pET28a-6*His-HPV11 L1
The DNA fragmentation primer of amplification HPV11 L1: (restriction enzyme site is NdeI and XhoI, pET28a respectively)
Forward-HPV11 L1-NdeI:5’ GACTTCA CATATGATGTGGCGTC CGTCTGACTCTA
Reverse-HPV11 L1-XhoI:5’ CATCTCA CTCGAGCTA TTTTTTGGTT TTGGTACGTTT
L1 gene fragment containing NdeI and XhoI restriction enzyme site and carrier pMAL are carried out the process of NdeI/XhoI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pET28a containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
The screening connecting and carry out recon in product to Host Strains DH5 α is transformed after ligation.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Shanghai Sheng Gong biotech firm afterwards, obtaining the gene order SEQ NO.6 merging restructuring MBP-HPV11-L1 protein.
Embodiment 6: recombinant vectors 6*His-SUMO-HPV11 L1 vector construction
The DNA fragmentation primer of amplification SUMO: (restriction enzyme site is NdeI and BamHI respectively)
Forward -SUMO-NdeI: GGAATTC CATATGTCTGACCAGGAAGCTAAACCGTC
Reverse-SUMO-BamHI: CGC GGATCCACCGGTCTGTTCCTGGTAAAC
The DNA fragmentation primer of amplification HPV11 L1: (restriction enzyme site is BamHI and XhoI respectively)
Forward-HPV11 L1-ApaI:5’ACTTCA GGATCC ATGTGGCGTC CGTCTGACTCTA
Reverse-HPV11 L1-XhoI:5’ATCTCA CTCGAGCTA TTTTTTGGTT TTGGTACGTTT
SUMO gene, L1 gene PCR amplification condition, reaction system are with described in above-described embodiment.
Enzyme cuts connection: the SUMO gene fragment containing NdeI and BamHI restriction enzyme site and carrier pET-28a are carried out the process of NdeI/ BamHI double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pET28a containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
Transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Jin Weizhi bio tech ltd, Suzhou afterwards, obtaining merging recombinant vectors pETSUMO-28a.
Enzyme cuts connection again: the L1 gene fragment containing BamHI and Xho1 restriction enzyme site and recombinant vectors pETSUMO-28a are carried out the process of BamHI/Xho1 double digestion, utilize T4 DNA ligase that the gene fragment of recovery is carried out ligation with the pETSUMO-28a containing corresponding sticky end afterwards, 16 DEG C of 10 ~ 15 h.
Again transform qualification: after ligation, transform the screening connecting and carry out recon in product to Host Strains DH5 α.The mono-clonal bacterium colony of screening carried out enlarged culturing and carries out the extraction of plasmid, being checked order by Shanghai Sheng Gong biotech firm afterwards, obtaining the gene order SEQ NO.7 merging restructuring MBP-HPV11-L1 protein.
Embodiment 7: restructuring HPV L1 pentamer protein expression
By the recombinant vectors transformation of E. coli BL21 host cell of correct for sequencing result embodiment 2,3,4,5 and 6, and carry out the expression of HPV L1 albumen as the engineering bacteria of expressing recombinant protein.Recombinant base is 2YT substratum (10 g/L tryptones; 5 g/L yeast powders; 10 g/L NaCl).Picking contains the thalline list spot of recombinant plasmid in 10ml 2YT substratum (containing 100 μ g/ml penbritins), and 230 revs/min (rpm), 37 DEG C of shaking culture are spent the night.5 ml that transfer spend the night bacterium in 500 ml(containing 100 μ g/ml penbritins) in 2YT liquid nutrient medium, 37 DEG C of concussions are cultured to recombinant bacterial strain when growing to OD600nm ≈ 0.4 ~ 1, add the IPTG induction of final concentration 0.2mM, under the condition of 28 DEG C, carry out the abduction delivering of more than 6h recombinant protein.
Cell harvesting and fragmentation :carry out centrifugal to fermenting culture, abandon supernatant, results bacterial sediment, weighs; Use buffer L(pH 8.0,50 mM Tris, 200 mM NaCl, 5mM DTT) washing precipitation, be then resuspended in buffer L and carried out ultrasonic disruption, by supercentrifuge, centrifugal (16000 rpm are carried out to broken bacterium liquid subsequently, 30 min, 4 DEG C), collect supernatant liquor.
Embodiment 8: restructuring HPV L1 pentamer albumen is in the detection of expression in escherichia coli amount
Before adopting ELISA sandwich assay to detect affinity chromatography loading, Tag-HPV L1 pentamer albumen is in expression in escherichia coli amount, sample and trial-product:
coated antibody:make anti-HPV11 L1 mouse monoclonal by oneself.
reference substance:make highly purified HPV11 L1 albumen by oneself.
trial-product:with sample diluting liquid by trial-product tag-HPV11 L1be diluted to concentration in reference substance gradient dilution concentration range.
enzyme labelled antibody:the rabbit anti-HPV11 L1 albumen of homemade horseradish peroxidase-labeled resists more.
result calculates:calculate the mean value of parallel hole, with reference substance series concentration OD 450absorption value makes straight-line equation to its corresponding L1 proteantigen, and between Duplicate Samples sample wells, the variation coefficient must not be greater than 10%, linear regression equation R 2must not 0.980 be less than, by the OD of trial-product 450absorption value substitutes into Equation for Calculating and goes out trial-product L1 proteantigen content after dilution, then is multiplied by corresponding extension rate and is L1 proteantigen content in trial-product, in table 1.
Tag-HPV L1 proteantigen content after table 1 detects and expresses
Embodiment 9: restructuring HPV L1 pentamer protein affinity chromatography
affinity chromatography with GST label recombinant protein:gST agarose affinity chromatography medium 5ml is loaded in affinity column, with buffer L(pH 8.0,50 mM Tris, 200 mM NaCl, 5mM DTT) balance chromatography column, then in loading embodiment 8 with the protein liquid of GST or GST-SUMO label, after with Buffer L be washed till without protein flow out, affine complete.With 5mL Buffer L suspension affinity media, sampling detects and in conjunction with the total amount of L1 protein in calculation medium.
affinity chromatography with MBP label recombinant protein:amylose-Resin affinity chromatography medium 5ml is loaded in affinity column, with buffer L(pH 8.0,50 mM Tris, 200 mM NaCl, 5mM DTT) balance chromatography column, then in loading embodiment 8 with the protein liquid of GST or GST-SUMO label, after with Buffer L be washed till without protein flow out, affine complete.With 5mL Buffer L suspension affinity media, sampling detects and in conjunction with the total amount of L1 protein in calculation medium.
affinity chromatography with 6*HIS label recombinant protein:get 5ml Ni-NTA gel dress post, post slowly adds balance liquid (50mmol/L NaH2PO4, the 300mmol/L Nacl of 10 times of column volumes, 20mmol/L imidazole, pH value to 8 is adjusted with NaOH), fully to balance Ni-NTA gel, flow velocity is 1ml/min.The supernatant liquor with 6*His label after filtering in Example 8, after entering gel completely, continue detergent gel with the balance liquid of 10 times of column volumes, preservation flow velocity is 1ml/min.Be eluted to balance liquid and flow out without protein, affine complete.Sampling detects and in conjunction with the total amount of L1 protein in calculation medium.
Embodiment 10: the enzyme of restructuring Tag-HPV L1 protein cuts purifying
Enzyme amount is added according to target protein matter and proteolytic enzyme mass ratio 100:1, protein HRV 3CP wherein with GST-HPV-L1 is cut, protein with GST-SUMO-HPV-L1 and 6*His-SUMO-HPV-L1 SENP1 proteolytic cleavage, with the protein Factor Xa proteolytic cleavage of Mbp-HPV-L1, protein with 6*His-HPV-L1 Thrombin proteolytic cleavage, respectively after Double digestion 2h, wash-out collects the HPV11 L1 pentamer protein soln of gained after each proteolytic cleavage respectively.
3C enzyme enzyme is cut the L1 protein soln SDS-PAGE detected through gel electrophoresis after GST label, the results are shown in Figure 1 affinity chromatography electrophoresis result, experiment shows, the target protein of 90% can be cut.Fig. 2 is the protein of SENP1 proteolytic cleavage with GST-SUMO-HPV-L1, by SDS-PAGE detected through gel electrophoresis.Fig. 3 is the protein of Factor Xa proteolytic cleavage with Mbp-HPV-L1, by SDS-PAGE detected through gel electrophoresis.Fig. 1-Fig. 3 obtains the HPV11 L1 albumen of 55kDa.
Thrombin proteolytic enzyme does not cut the protein of 6*His-HPV-L1; Cut the protein soln SDS-PAGE detected through gel electrophoresis of 6*His-SUMO-L1 with SENP1 enzyme, the results are shown in Figure 4, display SENP1 proteolytic enzyme fails to cut the fused albumen with 6*His-SUMO label.
Embodiment 11: restructuring HPV L1 pentamer protein purification
Molecular sieve chromatography purifying: the enzyme that a upper embodiment is collected is cut the HPV11 L1 pentamer protein after purifying and carries out purifying respectively, can first through the HPV11 L1 pentamer protein of ion-exchange chromatography collection, or directly use the gel filter medium of Superdex200 (production of GE company) to carry out further sieve chromatography without ion-exchange step, molecular sieve moving phase is pH8.0,10 mM Tris, 100 mM NaCl, collect the cut of HPV11 L1 pentamer protein ultraviolet absorption peak.
Working sample purity after purifying: by the protein soln sampling SDS-PAGE detected through gel electrophoresis of collecting, target protein matter HPV11 L1 pentamer final purity after sieve chromatography purifying is all greater than 98%, refer to Fig. 5, the restructuring HPV11 L1 pentamer protein s DS-PAGE gel electrophoresis figure after molecular sieve chromatography purifying.
Working sample protein concentration: carry out protein concentration detection by Bradford method, standard specimen 2mg/ml BAS preparation is used to be diluted to 500ug/ul from 100ug/ul, example reaction system gets the BSA+200ulBradford working fluid of 10ul dilution: typical curve is y=0.0013 x-0.0294, R2=0.9986, the OD of working sample 595, substitute into typical curve, the protein concentration of calculation sample.
Note: sample sets 1 is that GST-HPV L1 obtains HPV L1 pentamer protein solution after molecular sieve purification; Sample sets 2 is that GST-SUMO-HPV L1 obtains HPV L1 pentamer protein solution after molecular sieve purification; Sample sets 3 is that Mbp-HPV L1 obtains HPV L1 pentamer protein solution after molecular sieve purification.
Embodiment 12: restructuring HPV11 L1 pentamer protein group dresses up VLP
Be placed under following salt concn (NaCl) and pH value condition, HPV L1 pentamer solution example group 1,2 and 3, place after stablizing, use the dynamic light scattering particle instrument of Malvern Zetasizer NanoZS, (size distribution FACTOR P dI value is grain size dispersity index, is less than 0.05 for highly homogeneous sample to carry out particle diameter and particle size distribution measuring; 0.05 ~ 0.1 is as the criterion homogeneous sample, and 0.1 ~ 0.3 is the poor sample of homogeneity, is greater than 0.3 for inhomogenous sample), the assembling of HPV11 L1 pentamer albumen obtains the VLP(of uniform particle diameter pdI < 0.05).
The droplet measurement of HPV11 L1 VLP is assembled under the different pH of table 3 and salt concentration conditions
Note: sample sets 1 is that GST-HPV L1 obtains HPV L1 VLP protein solution after molecular sieve purification; Sample sets 2 is that GST-SUMO-HPV L1 obtains HPV L1VLP protein solution after molecular sieve purification; Sample sets 3 is that Mbp-HPV L1 obtains HPV L1VLP protein solution after molecular sieve purification.
Embodiment 13: dynamic light scattering (DLS) is to L1 pentamer and VLP protein particle size determination
Instrument is the dynamic light scattering particle instrument of Malvern Zetasizer NanoZS, get HPV11 L1 pentamer that each sample group finally obtains and HPV11 L1 VLP protein detects, survey the homogeneity that median size and monodispersity index PdI(show protein), illustrate the L1 pentamer that each group of sample is finally prepared and VLP albumen homogeneous.The pentamer protein that wherein sample sets 2 is finally obtained and the HPV11 L1 VLP protein size distribution that its assembling obtains refer to accompanying drawing 6 He7.
The preparation of embodiment 14:HPV11 L1 pentamer and VLP
According to the technology that the above embodiment of the present invention 1-13 adopts, preparation has sequence 11,12, the HPV11 L1 albumen of 13, above albumen all can obtain the albumen that purity reaches more than 98% by purifying, obtains the HPV11 L1 pentamer albumen of median size 10 ~ 15nm PdI<0.1.Further assembling obtains the HPV11 L1VLP albumen of median size 45 ~ 65nm PdI<0.1.
The morphologic detection of embodiment 15:HPV11 L1 pentamer and VLP
transmission electron microscope observing:the HPV11 L1-VLP protein that the HPV11 L1 pentamer protein obtained by each purifying in embodiment, assembling obtain, utilizes transmission electron microscope platform to observe by Instite of Biophysics, Chinese Academy of Sciences.Freezing sample preparation and flow process of taking pictures:
1) by liquid nitrogen box filled with liquid nitrogen, when liquid level does not seethe with excitement, ethane is slowly injected the copper bowl of cooling, make it to be cooled to liquid state.
2) copper mesh is done wetting ability process at PDC-32 type plasma cleaning device.
3) in the freezing sample preparation device of Vitrobot TM Mark IV, by the pentamer of 3.5 μ L and VLP sample adsorption in 300 object QUANTIFOIL copper mesh, after water suction 4s, by the freezing sample of liquid ethane.
4) rapid being transferred in liquid nitrogen by sample is preserved.
5), when collecting freezing photo, electron dose is 20 e-/2.Data are by the Gatan UltraScan 4000 CCD record of the 300 kV Titan Krios transmission electron microscopes of 300 KV.Acceleration voltage is 300 kV.
Result shows, in HPV11 L1 pentamer protein example group, and the pentamer albumen of about the 10nm that visible a large amount of diameter conforms to theoretical size in the visual field; In HPV11 L1-VLP protein example group, a large amount of diameters that visible particle size conforms to theory are the virus-like particle (VLP) of about 50nm, uniformity.After wherein GST-SUMO set of tags (sample sets 2) enzyme cuts purifying, the transmission electron microscope photo of HPV11 L1 pentamer gained sample is shown in accompanying drawingthe transmission electron microscope photo of the VLP albumen that 8, Mbp set of tags (sample sets 3) enzyme is assembled after cutting purifying is again shown in accompanying drawing9.
Embodiment 16:HPV11 L1 protein stoste purity detecting
Size Exclusion High Performance liquid chromatogram measuring: chromatographic column Agilent Bio SEC-5um, 2000,7.8 × 300mm, column volume about 15 m1, molecular weight ranges >=lO, OOOkDa; With the 0.1mol/L phosphate buffered saline buffer of pH6.8 (take Sodium phosphate dibasic 25.8g, SODIUM PHOSPHATE, MONOBASIC 4.37g, add ultrapure water and make dissolving, with phosphoric acid adjust pH to 6.8, ultrapure water constant volume becomes 1000ml) be moving phase; Flow velocity is 1ml/min; Determined wavelength 280nm; Column temperature 25 DEG C, applied sample amount must not be less than 20ug, and sample main peak theoretical plate number is not less than 1000, and tailing factor is less than 2.0, continuous sample introduction 5 pin, and the relative standard deviation of peak area must not be greater than 3%.
Get the HPV11 L1 that 2 groups, the sample after purifying finally obtains pentamerwith assembling after vLPprotein stoste, weaker concn is 1mg/ml respectively, and applied sample amount 20ul injects high pressure liquid chromatograph, detects according to the method described above, and by area normalization method calculated purity, all process lipidated proteins are all greater than 98%, the results are shown in accompanying drawing10 and table 4, accompanying drawing11 and table 5.
The HPLC lipidated protein of table 4 HPV11 L1 pentamer detects
After table 5 HPV11 L1 assembles vLPhPLC lipidated protein detect
Peak Retention time Area Area %
1 13.767 2537207 100.00
Amount to 2537207 100.00
Embodiment 17:HPV VLP stability experiment
The HPV11 VLP protein each sample sets finally obtained, under the buffer conditions of following table, is placed 14 days to 28 days at 25 DEG C, is carried out droplet measurement, the results are shown in following table, prove that HPV11 VLP is at pH 5.0 to 5.9, deposits stable under salt concn 500 ~ 2000mM.Sample sets 3 gained HPV11 VLP is at pH 5.0 to 5.9, and after placing 14-28 days under salt concn 500 ~ 2000mM, detected result refers to as following table.
Table 6 HPV11 L1 VLP places 14-28 days droplet measurement results at 25 DEG C
Embodiment 18: preparation contains the univalent vaccine of HPV L1 pentamer or VLP
HPV11 L1 pentamer containing each sample sets or VLP albumen stoste are carried out absorption preparation with aluminum hydroxide adjuvant normal saline solution according to albumen and aluminium content 1:10 ratio respectively and can obtain recombinate HPV L1 protein pentamer or VLP vaccine, stand-by 4 DEG C of preservations.
The immunogenicity determining of embodiment 19:HPV L1 pentamer and VLP
Get above-mentioned L1 pentamer or VLP vaccine respectively, the physiological saline adding sterilizing is diluted to pentamer or the VLP protein vaccine of 20 μ g/ml concentration respectively, with every 0.1ml intramuscular injection BALB/c mouse, often organizes 10.Mouse every 4 weeks booster immunizations once, are total to immunity 2 times.Booster immunization is after 4 weeks, and for the NAT of homotype HPV in the mice serum after adopting pseudovirus cell Neutralizing test method to measure each immunity respectively, result is as attached figure12, shown in 13.
Result shows, HPV L1 pentamer and VLP protein vaccination mouse, after second immunisation, 4 weeks neutralizing antibodies can reach very high level.The results show, the VLP vaccine of HPV L1 pentamer and assembling all can produce neutralizing antibody in animal body, illustrate that HPV L1 pentamer and VLP protein vaccine all have immunogenicity in human clinical trial, the disease that HPV homologous virus causes can be prevented.
SEQUENCE LISTING
 
<110> Beijing Health Guard Biotechnology Co., Ltd.
 
<120> 11 type recombinant human papilloma virus virus-like particle and preparation method thereof
 
<130> 2014
 
<160> 13
 
<170> PatentIn version 3.3
 
<210> 1
<211> 1506
<212> DNA
<213> artificial sequence
 
<400> 1
atgtggcggc ctagcgacag cacagtatat gtgcctcctc ccaaccctgt atccaaggtt 60
 
gttgccacgg atgcgtatgt taaacgcacc aacatatttt atcatgccag cagttctaga 120
 
ctccttgctg tgggacatcc atattactct atcaaaaaag ttaacaaaac agttgtacca 180
 
aaggtgtctg gatatcaata tagagtgttt aaggtagtgt tgccagatcc taacaagttt 240
 
gcattacctg attcatccct gtttgacccc actacacagc gtttagtatg ggcgtgcaca 300
 
gggttggagg taggcagggg tcaaccttta ggcgttggtg ttagtgggca tccattgcta 360
 
aacaaatatg atgatgtaga aaatagtggt gggtatggtg gtaatcctgg tcaggataat 420
 
agggttaatg taggtatgga ttataaacaa acccagctat gtatggtggg ctgtgctcca 480
 
ccgttaggtg aacattgggg taagggtaca caatgttcaa atacctctgt acaaaatggt 540
 
gactgccccc cgttggaact tattaccagt gttatacagg atggggacat ggttgataca 600
 
ggctttggtg ctatgaattt tgcagactta caaaccaata aatcggatgt tccccttgat 660
 
atttgtggaa ctgtctgcaa atatcctgat tatttgcaaa tggctgcaga cccttatggt 720
 
gataggttgt ttttttattt gcgaaaggaa caaatgtttg ctagacactt ttttaatagg 780
 
gccggtactg tgggggaacc tgtgcctgat gacctgttgg taaaaggggg taataacaga 840
 
tcatctgtag ctagtagtat ttatgtacat acacctagtg gctcattggt gtcttcagag 900
 
gctcaattat ttaataaacc atattggctt caaaaggctc agggacataa caatggtatt 960
 
tgctggggaa accacttgtt tgttactgtg gtagatacca cacgcagtac aaatatgaca 1020
 
ctatgtgcat ctgtgtctaa atctgctaca tacactaatt cagattataa ggaatacatg 1080
 
cgccatgtgg aggagtttga tttacagttt atttttcaat tgtgtagcat tacattatct 1140
 
gcagaagtca tggcctatat acacacaatg aatccttctg ttttggagga ctggaacttt 1200
 
ggtttatcgc ctccaccaaa tggtacactg gaggatactt atagatatgt acagtcacag 1260
 
gccattacct gtcagaaacc cacacctgaa aaagaaaaac aggatcccta taaggatatg 1320
 
agtttttggg aggttaactt aaaagaaaag ttttcaagtg aattagatca gtttcccctt 1380
 
ggacgtaagt ttttattgca aagtggatat cgaggacgga cgtctgctcg tacaggtata 1440
 
aagcgcccag ctgtgtctaa gccctctaca gcccccaaac gaaaacgtac caaaaccaaa 1500
 
aagtaa 1506
 
 
<210> 2
<211> 1503
<212> DNA
<213> artificial sequence
 
<400> 2
atgtggcgtc cgtctgactc taccgtttac gttccgccgc cgaacccggt ttctaaagtt 60
 
gttgctaccg acgcttacgt taaacgtacc aacatcttct accacgcttc ttcttctcgt 120
 
ctgctggctg ttggtcaccc gtactactct atcaaaaaag ttaacaaaac cgttgttccg 180
 
aaagtttctg gttaccagta ccgtgttttc aaagttgttc tgccggaccc gaacaaattc 240
 
gctctgccgg actcttctct gttcgacccg accacccagc gtctggtttg ggcttgcacc 300
 
ggtctggaag ttggtcgtgg tcagccgctg ggtgttggtg tttctggtca cccgctgctg 360
 
aacaaatacg acgacgttga aaactctggt ggttacggtg gtaacccggg tcaggacaac 420
 
cgtgttaacg ttggtatgga ctacaaacag acccagctgt gcatggttgg ttgcgctccg 480
 
ccgctgggtg aacactgggg taaaggtacc cagtgctcta acacctctgt tcagaacggt 540
 
gactgcccgc cgctggaact gatcacctct gttatccagg acggtgacat ggttgacacc 600
 
ggtttcggtg ctatgaactt cgctgacctg cagaccaaca aatctgacgt tccgctggac 660
 
atctgcggta ccgtttgcaa atacccggac tacctgcaga tggctgctga cccgtacggt 720
 
gaccgtctgt tcttctacct gcgtaaagaa cagatgttcg ctcgtcactt cttcaaccgt 780
 
gctggtaccg ttggtgaacc ggttccggac gacctgctgg ttaaaggtgg taacaaccgt 840
 
tcttctgttg cttcttctat ctacgttcac accccgtctg gttctctggt ttcttctgaa 900
 
gctcagctgt tcaacaaacc gtactggctg cagaaagctc agggtcacaa caacggtatc 960
 
tgctggggta accacctgtt cgttaccgtt gttgacacca cccgttctac caacatgacc 1020
 
ctgtgcgctt ctgtttctaa atctgctacc tacaccaact ctgactacaa agaatacatg 1080
 
cgtcacgttg aagaattcga cctgcagttc atcttccagc tgtgctctat caccctgtct 1140
 
gctgaagtta tggcttacat ccacaccatg aacccgtctg ttctggaaga ctggaacttc 1200
 
ggtctgtctc cgccgccgaa cggtaccctg gaagacacct accgttacgt tcagtctcag 1260
 
gctatcacct gccagaaacc gaccccggaa aaagaaaaac aggacccgta caaagacatg 1320
 
tctttctggg aagttaacct gaaagaaaaa ttctcttctg aactggacca gttcccgctg 1380
 
ggtcgtaaat tcctgctgca gtctggttac cgtggtcgta cctctgctcg taccggtatc 1440
 
aaacgtccgg ctgtttctaa accgtctacc gctccgaaac gtaaacgtac caaaaccaaa 1500
 
aaa 1503
 
 
<210> 3
<211> 2196
<212> DNA
<213> artificial sequence
 
<400> 3
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
 
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
 
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
 
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
 
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
 
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
 
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
 
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
 
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
 
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
 
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
 
ctggaagttc tgttccaggg gcccctggga tccatgtggc gtccgtctga ctctaccgtt 720
 
tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttaaacgt 780
 
accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtactac 840
 
tctatcaaaa aagttaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 900
 
ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 960
 
ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1020
 
ctgggtgttg gtgtttctgg tcacccgctg ctgaacaaat acgacgacgt tgaaaactct 1080
 
ggtggttacg gtggtaaccc gggtcaggac aaccgtgtta acgttggtat ggactacaaa 1140
 
cagacccagc tgtgcatggt tggttgcgct ccgccgctgg gtgaacactg gggtaaaggt 1200
 
acccagtgct ctaacacctc tgttcagaac ggtgactgcc cgccgctgga actgatcacc 1260
 
tctgttatcc aggacggtga catggttgac accggtttcg gtgctatgaa cttcgctgac 1320
 
ctgcagacca acaaatctga cgttccgctg gacatctgcg gtaccgtttg caaatacccg 1380
 
gactacctgc agatggctgc tgacccgtac ggtgaccgtc tgttcttcta cctgcgtaaa 1440
 
gaacagatgt tcgctcgtca cttcttcaac cgtgctggta ccgttggtga accggttccg 1500
 
gacgacctgc tggttaaagg tggtaacaac cgttcttctg ttgcttcttc tatctacgtt 1560
 
cacaccccgt ctggttctct ggtttcttct gaagctcagc tgttcaacaa accgtactgg 1620
 
ctgcagaaag ctcagggtca caacaacggt atctgctggg gtaaccacct gttcgttacc 1680
 
gttgttgaca ccacccgttc taccaacatg accctgtgcg cttctgtttc taaatctgct 1740
 
acctacacca actctgacta caaagaatac atgcgtcacg ttgaagaatt cgacctgcag 1800
 
ttcatcttcc agctgtgctc tatcaccctg tctgctgaag ttatggctta catccacacc 1860
 
atgaacccgt ctgttctgga agactggaac ttcggtctgt ctccgccgcc gaacggtacc 1920
 
ctggaagaca cctaccgtta cgttcagtct caggctatca cctgccagaa accgaccccg 1980
 
gaaaaagaaa aacaggaccc gtacaaagac atgtctttct gggaagttaa cctgaaagaa 2040
 
aaattctctt ctgaactgga ccagttcccg ctgggtcgta aattcctgct gcagtctggt 2100
 
taccgtggtc gtacctctgc tcgtaccggt atcaaacgtc cggctgtttc taaaccgtct 2160
 
accgctccga aacgtaaacg taccaaaacc aaaaaa 2196
 
 
<210> 4
<211> 2478
<212> DNA
<213> artificial sequence
 
<400> 4
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
 
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
 
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
 
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
 
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
 
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
 
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
 
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
 
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
 
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
 
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
 
ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720
 
ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780
 
atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840
 
cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900
 
aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960
 
cagaccggtg gatccatgtg gcgtccgtct gactctaccg tttacgttcc gccgccgaac 1020
 
ccggtttcta aagttgttgc taccgacgct tacgttaaac gtaccaacat cttctaccac 1080
 
gcttcttctt ctcgtctgct ggctgttggt cacccgtact actctatcaa aaaagttaac 1140
 
aaaaccgttg ttccgaaagt ttctggttac cagtaccgtg ttttcaaagt tgttctgccg 1200
 
gacccgaaca aattcgctct gccggactct tctctgttcg acccgaccac ccagcgtctg 1260
 
gtttgggctt gcaccggtct ggaagttggt cgtggtcagc cgctgggtgt tggtgtttct 1320
 
ggtcacccgc tgctgaacaa atacgacgac gttgaaaact ctggtggtta cggtggtaac 1380
 
ccgggtcagg acaaccgtgt taacgttggt atggactaca aacagaccca gctgtgcatg 1440
 
gttggttgcg ctccgccgct gggtgaacac tggggtaaag gtacccagtg ctctaacacc 1500
 
tctgttcaga acggtgactg cccgccgctg gaactgatca cctctgttat ccaggacggt 1560
 
gacatggttg acaccggttt cggtgctatg aacttcgctg acctgcagac caacaaatct 1620
 
gacgttccgc tggacatctg cggtaccgtt tgcaaatacc cggactacct gcagatggct 1680
 
gctgacccgt acggtgaccg tctgttcttc tacctgcgta aagaacagat gttcgctcgt 1740
 
cacttcttca accgtgctgg taccgttggt gaaccggttc cggacgacct gctggttaaa 1800
 
ggtggtaaca accgttcttc tgttgcttct tctatctacg ttcacacccc gtctggttct 1860
 
ctggtttctt ctgaagctca gctgttcaac aaaccgtact ggctgcagaa agctcagggt 1920
 
cacaacaacg gtatctgctg gggtaaccac ctgttcgtta ccgttgttga caccacccgt 1980
 
tctaccaaca tgaccctgtg cgcttctgtt tctaaatctg ctacctacac caactctgac 2040
 
tacaaagaat acatgcgtca cgttgaagaa ttcgacctgc agttcatctt ccagctgtgc 2100
 
tctatcaccc tgtctgctga agttatggct tacatccaca ccatgaaccc gtctgttctg 2160
 
gaagactgga acttcggtct gtctccgccg ccgaacggta ccctggaaga cacctaccgt 2220
 
tacgttcagt ctcaggctat cacctgccag aaaccgaccc cggaaaaaga aaaacaggac 2280
 
ccgtacaaag acatgtcttt ctgggaagtt aacctgaaag aaaaattctc ttctgaactg 2340
 
gaccagttcc cgctgggtcg taaattcctg ctgcagtctg gttaccgtgg tcgtacctct 2400
 
gctcgtaccg gtatcaaacg tccggctgtt tctaaaccgt ctaccgctcc gaaacgtaaa 2460
 
cgtaccaaaa ccaaaaaa 2478
 
 
<210> 5
<211> 2676
<212> DNA
<213> artificial sequence
 
<400> 5
atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60
 
ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120
 
ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180
 
atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240
 
accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300
 
aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360
 
gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420
 
aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480
 
ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540
 
gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600
 
aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660
 
ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720
 
gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780
 
ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840
 
ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900
 
ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960
 
actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020
 
tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080
 
gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140
 
aacctcggga tcgagggaag gatttcagaa ttcatgtggc gtccgtctga ctctaccgtt 1200
 
tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttaaacgt 1260
 
accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtactac 1320
 
tctatcaaaa aagttaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 1380
 
ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 1440
 
ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1500
 
ctgggtgttg gtgtttctgg tcacccgctg ctgaacaaat acgacgacgt tgaaaactct 1560
 
ggtggttacg gtggtaaccc gggtcaggac aaccgtgtta acgttggtat ggactacaaa 1620
 
cagacccagc tgtgcatggt tggttgcgct ccgccgctgg gtgaacactg gggtaaaggt 1680
 
acccagtgct ctaacacctc tgttcagaac ggtgactgcc cgccgctgga actgatcacc 1740
 
tctgttatcc aggacggtga catggttgac accggtttcg gtgctatgaa cttcgctgac 1800
 
ctgcagacca acaaatctga cgttccgctg gacatctgcg gtaccgtttg caaatacccg 1860
 
gactacctgc agatggctgc tgacccgtac ggtgaccgtc tgttcttcta cctgcgtaaa 1920
 
gaacagatgt tcgctcgtca cttcttcaac cgtgctggta ccgttggtga accggttccg 1980
 
gacgacctgc tggttaaagg tggtaacaac cgttcttctg ttgcttcttc tatctacgtt 2040
 
cacaccccgt ctggttctct ggtttcttct gaagctcagc tgttcaacaa accgtactgg 2100
 
ctgcagaaag ctcagggtca caacaacggt atctgctggg gtaaccacct gttcgttacc 2160
 
gttgttgaca ccacccgttc taccaacatg accctgtgcg cttctgtttc taaatctgct 2220
 
acctacacca actctgacta caaagaatac atgcgtcacg ttgaagaatt cgacctgcag 2280
 
ttcatcttcc agctgtgctc tatcaccctg tctgctgaag ttatggctta catccacacc 2340
 
atgaacccgt ctgttctgga agactggaac ttcggtctgt ctccgccgcc gaacggtacc 2400
 
ctggaagaca cctaccgtta cgttcagtct caggctatca cctgccagaa accgaccccg 2460
 
gaaaaagaaa aacaggaccc gtacaaagac atgtctttct gggaagttaa cctgaaagaa 2520
 
aaattctctt ctgaactgga ccagttcccg ctgggtcgta aattcctgct gcagtctggt 2580
 
taccgtggtc gtacctctgc tcgtaccggt atcaaacgtc cggctgtttc taaaccgtct 2640
 
accgctccga aacgtaaacg taccaaaacc aaaaaa 2676
 
 
<210> 6
<211> 1566
<212> DNA
<213> artificial sequence
 
<400> 6
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
 
atgatgtggc gtccgtctga ctctaccgtt tacgttccgc cgccgaaccc ggtttctaaa 120
 
gttgttgcta ccgacgctta cgttaaacgt accaacatct tctaccacgc ttcttcttct 180
 
cgtctgctgg ctgttggtca cccgtactac tctatcaaaa aagttaacaa aaccgttgtt 240
 
ccgaaagttt ctggttacca gtaccgtgtt ttcaaagttg ttctgccgga cccgaacaaa 300
 
ttcgctctgc cggactcttc tctgttcgac ccgaccaccc agcgtctggt ttgggcttgc 360
 
accggtctgg aagttggtcg tggtcagccg ctgggtgttg gtgtttctgg tcacccgctg 420
 
ctgaacaaat acgacgacgt tgaaaactct ggtggttacg gtggtaaccc gggtcaggac 480
 
aaccgtgtta acgttggtat ggactacaaa cagacccagc tgtgcatggt tggttgcgct 540
 
ccgccgctgg gtgaacactg gggtaaaggt acccagtgct ctaacacctc tgttcagaac 600
 
ggtgactgcc cgccgctgga actgatcacc tctgttatcc aggacggtga catggttgac 660
 
accggtttcg gtgctatgaa cttcgctgac ctgcagacca acaaatctga cgttccgctg 720
 
gacatctgcg gtaccgtttg caaatacccg gactacctgc agatggctgc tgacccgtac 780
 
ggtgaccgtc tgttcttcta cctgcgtaaa gaacagatgt tcgctcgtca cttcttcaac 840
 
cgtgctggta ccgttggtga accggttccg gacgacctgc tggttaaagg tggtaacaac 900
 
cgttcttctg ttgcttcttc tatctacgtt cacaccccgt ctggttctct ggtttcttct 960
 
gaagctcagc tgttcaacaa accgtactgg ctgcagaaag ctcagggtca caacaacggt 1020
 
atctgctggg gtaaccacct gttcgttacc gttgttgaca ccacccgttc taccaacatg 1080
 
accctgtgcg cttctgtttc taaatctgct acctacacca actctgacta caaagaatac 1140
 
atgcgtcacg ttgaagaatt cgacctgcag ttcatcttcc agctgtgctc tatcaccctg 1200
 
tctgctgaag ttatggctta catccacacc atgaacccgt ctgttctgga agactggaac 1260
 
ttcggtctgt ctccgccgcc gaacggtacc ctggaagaca cctaccgtta cgttcagtct 1320
 
caggctatca cctgccagaa accgaccccg gaaaaagaaa aacaggaccc gtacaaagac 1380
 
atgtctttct gggaagttaa cctgaaagaa aaattctctt ctgaactgga ccagttcccg 1440
 
ctgggtcgta aattcctgct gcagtctggt taccgtggtc gtacctctgc tcgtaccggt 1500
 
atcaaacgtc cggctgtttc taaaccgtct accgctccga aacgtaaacg taccaaaacc 1560
 
aaaaaa 1566
 
 
<210> 7
<211> 1857
<212> DNA
<213> artificial sequence
 
<400> 7
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
 
atgtctgacc aggaagctaa accgtctacc gaagacctgg gtgacaaaaa agaaggtgaa 120
 
tacatcaaac tgaaagttat cggtcaggac tcttctgaaa tccacttcaa agttaaaatg 180
 
accacccacc tgaaaaaact gaaagaatct tactgccagc gtcagggtgt tccgatgaac 240
 
tctctgcgtt tcctgttcga aggtcagcgt atcgctgaca accacacccc gaaagaactg 300
 
ggtatggaag aagaagacgt tatcgaagtt taccaggaac agaccggtgg atccatgtgg 360
 
cgtccgtctg actctaccgt ttacgttccg ccgccgaacc cggtttctaa agttgttgct 420
 
accgacgctt acgttaaacg taccaacatc ttctaccacg cttcttcttc tcgtctgctg 480
 
gctgttggtc acccgtacta ctctatcaaa aaagttaaca aaaccgttgt tccgaaagtt 540
 
tctggttacc agtaccgtgt tttcaaagtt gttctgccgg acccgaacaa attcgctctg 600
 
ccggactctt ctctgttcga cccgaccacc cagcgtctgg tttgggcttg caccggtctg 660
 
gaagttggtc gtggtcagcc gctgggtgtt ggtgtttctg gtcacccgct gctgaacaaa 720
 
tacgacgacg ttgaaaactc tggtggttac ggtggtaacc cgggtcagga caaccgtgtt 780
 
aacgttggta tggactacaa acagacccag ctgtgcatgg ttggttgcgc tccgccgctg 840
 
ggtgaacact ggggtaaagg tacccagtgc tctaacacct ctgttcagaa cggtgactgc 900
 
ccgccgctgg aactgatcac ctctgttatc caggacggtg acatggttga caccggtttc 960
 
ggtgctatga acttcgctga cctgcagacc aacaaatctg acgttccgct ggacatctgc 1020
 
ggtaccgttt gcaaataccc ggactacctg cagatggctg ctgacccgta cggtgaccgt 1080
 
ctgttcttct acctgcgtaa agaacagatg ttcgctcgtc acttcttcaa ccgtgctggt 1140
 
accgttggtg aaccggttcc ggacgacctg ctggttaaag gtggtaacaa ccgttcttct 1200
 
gttgcttctt ctatctacgt tcacaccccg tctggttctc tggtttcttc tgaagctcag 1260
 
ctgttcaaca aaccgtactg gctgcagaaa gctcagggtc acaacaacgg tatctgctgg 1320
 
ggtaaccacc tgttcgttac cgttgttgac accacccgtt ctaccaacat gaccctgtgc 1380
 
gcttctgttt ctaaatctgc tacctacacc aactctgact acaaagaata catgcgtcac 1440
 
gttgaagaat tcgacctgca gttcatcttc cagctgtgct ctatcaccct gtctgctgaa 1500
 
gttatggctt acatccacac catgaacccg tctgttctgg aagactggaa cttcggtctg 1560
 
tctccgccgc cgaacggtac cctggaagac acctaccgtt acgttcagtc tcaggctatc 1620
 
acctgccaga aaccgacccc ggaaaaagaa aaacaggacc cgtacaaaga catgtctttc 1680
 
tgggaagtta acctgaaaga aaaattctct tctgaactgg accagttccc gctgggtcgt 1740
 
aaattcctgc tgcagtctgg ttaccgtggt cgtacctctg ctcgtaccgg tatcaaacgt 1800
 
ccggctgttt ctaaaccgtc taccgctccg aaacgtaaac gtaccaaaac caaaaaa 1857
 
 
<210> 8
<211> 732
<212> PRT
<213> artificial sequence
 
<400> 8
 
Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro
1 5 10 15
 
 
Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu
20 25 30
 
 
Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu
35 40 45
 
 
Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys
50 55 60
 
 
Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn
65 70 75 80
 
 
Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu
85 90 95
 
 
Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser
100 105 110
 
 
Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu
115 120 125
 
 
Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn
130 135 140
 
 
Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp
145 150 155 160
 
 
Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu
165 170 175
 
 
Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr
180 185 190
 
 
Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala
195 200 205
 
 
Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu
210 215 220
 
 
Phe Gln Gly Pro Leu Gly Ser Met Trp Arg Pro Ser Asp Ser Thr Val
225 230 235 240
 
 
Tyr Val Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala
245 250 255
 
 
Tyr Val Lys Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu
260 265 270
 
 
Leu Ala Val Gly His Pro Tyr Tyr Ser Ile Lys Lys Val Asn Lys Thr
275 280 285
 
 
Val Val Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val
290 295 300
 
 
Leu Pro Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp
305 310 315 320
 
 
Pro Thr Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly
325 330 335
 
 
Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Leu Leu Asn
340 345 350
 
 
Lys Tyr Asp Asp Val Glu Asn Ser Gly Gly Tyr Gly Gly Asn Pro Gly
355 360 365
 
 
Gln Asp Asn Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu
370 375 380
 
 
Cys Met Val Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly
385 390 395 400
 
 
Thr Gln Cys Ser Asn Thr Ser Val Gln Asn Gly Asp Cys Pro Pro Leu
405 410 415
 
 
Glu Leu Ile Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly
420 425 430
 
 
Phe Gly Ala Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val
435 440 445
 
 
Pro Leu Asp Ile Cys Gly Thr Val Cys Lys Tyr Pro Asp Tyr Leu Gln
450 455 460
 
 
Met Ala Ala Asp Pro Tyr Gly Asp Arg Leu Phe Phe Tyr Leu Arg Lys
465 470 475 480
 
 
Glu Gln Met Phe Ala Arg His Phe Phe Asn Arg Ala Gly Thr Val Gly
485 490 495
 
 
Glu Pro Val Pro Asp Asp Leu Leu Val Lys Gly Gly Asn Asn Arg Ser
500 505 510
 
 
Ser Val Ala Ser Ser Ile Tyr Val His Thr Pro Ser Gly Ser Leu Val
515 520 525
 
 
Ser Ser Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala
530 535 540
 
 
Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn His Leu Phe Val Thr
545 550 555 560
 
 
Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val
565 570 575
 
 
Ser Lys Ser Ala Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg
580 585 590
 
 
His Val Glu Glu Phe Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile
595 600 605
 
 
Thr Leu Ser Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser
610 615 620
 
 
Val Leu Glu Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr
625 630 635 640
 
 
Leu Glu Asp Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln
645 650 655
 
 
Lys Pro Thr Pro Glu Lys Glu Lys Gln Asp Pro Tyr Lys Asp Met Ser
660 665 670
 
 
Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln
675 680 685
 
 
Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg
690 695 700
 
 
Thr Ser Ala Arg Thr Gly Ile Lys Arg Pro Ala Val Ser Lys Pro Ser
705 710 715 720
 
 
Thr Ala Pro Lys Arg Lys Arg Thr Lys Thr Lys Lys
725 730
 
 
<210> 9
<211> 826
<212> PRT
<213> artificial sequence
 
<400> 9
 
Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro
1 5 10 15
 
 
Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu
20 25 30
 
 
Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu
35 40 45
 
 
Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys
50 55 60
 
 
Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn
65 70 75 80
 
 
Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu
85 90 95
 
 
Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser
100 105 110
 
 
Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu
115 120 125
 
 
Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn
130 135 140
 
 
Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp
145 150 155 160
 
 
Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu
165 170 175
 
 
Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr
180 185 190
 
 
Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala
195 200 205
 
 
Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu
210 215 220
 
 
Phe Gln Gly Pro Ser Asp Gln Glu Ala Lys Pro Ser Thr Glu Asp Leu
225 230 235 240
 
 
Gly Asp Lys Lys Glu Gly Glu Tyr Ile Lys Leu Lys Val Ile Gly Gln
245 250 255
 
 
Asp Ser Ser Glu Ile His Phe Lys Val Lys Met Thr Thr His Leu Lys
260 265 270
 
 
Lys Leu Lys Glu Ser Tyr Cys Gln Arg Gln Gly Val Pro Met Asn Ser
275 280 285
 
 
Leu Arg Phe Leu Phe Glu Gly Gln Arg Ile Ala Asp Asn His Thr Pro
290 295 300
 
 
Lys Glu Leu Gly Met Glu Glu Glu Asp Val Ile Glu Val Tyr Gln Glu
305 310 315 320
 
 
Gln Thr Gly Gly Ser Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Val
325 330 335
 
 
Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala Tyr Val
340 345 350
 
 
Lys Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Ala
355 360 365
 
 
Val Gly His Pro Tyr Tyr Ser Ile Lys Lys Val Asn Lys Thr Val Val
370 375 380
 
 
Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val Leu Pro
385 390 395 400
 
 
Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Thr
405 410 415
 
 
Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gly
420 425 430
 
 
Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Leu Leu Asn Lys Tyr
435 440 445
 
 
Asp Asp Val Glu Asn Ser Gly Gly Tyr Gly Gly Asn Pro Gly Gln Asp
450 455 460
 
 
Asn Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys Met
465 470 475 480
 
 
Val Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly Thr Gln
485 490 495
 
 
Cys Ser Asn Thr Ser Val Gln Asn Gly Asp Cys Pro Pro Leu Glu Leu
500 505 510
 
 
Ile Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly
515 520 525
 
 
Ala Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val Pro Leu
530 535 540
 
 
Asp Ile Cys Gly Thr Val Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ala
545 550 555 560
 
 
Ala Asp Pro Tyr Gly Asp Arg Leu Phe Phe Tyr Leu Arg Lys Glu Gln
565 570 575
 
 
Met Phe Ala Arg His Phe Phe Asn Arg Ala Gly Thr Val Gly Glu Pro
580 585 590
 
 
Val Pro Asp Asp Leu Leu Val Lys Gly Gly Asn Asn Arg Ser Ser Val
595 600 605
 
 
Ala Ser Ser Ile Tyr Val His Thr Pro Ser Gly Ser Leu Val Ser Ser
610 615 620
 
 
Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln Gly
625 630 635 640
 
 
His Asn Asn Gly Ile Cys Trp Gly Asn His Leu Phe Val Thr Val Val
645 650 655
 
 
Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val Ser Lys
660 665 670
 
 
Ser Ala Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg His Val
675 680 685
 
 
Glu Glu Phe Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr Leu
690 695 700
 
 
Ser Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser Val Leu
705 710 715 720
 
 
Glu Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu
725 730 735
 
 
Asp Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln Lys Pro
740 745 750
 
 
Thr Pro Glu Lys Glu Lys Gln Asp Pro Tyr Lys Asp Met Ser Phe Trp
755 760 765
 
 
Glu Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln Phe Pro
770 775 780
 
 
Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg Thr Ser
785 790 795 800
 
 
Ala Arg Thr Gly Ile Lys Arg Pro Ala Val Ser Lys Pro Ser Thr Ala
805 810 815
 
 
Pro Lys Arg Lys Arg Thr Lys Thr Lys Lys
820 825
 
 
<210> 10
<211> 892
<212> PRT
<213> artificial sequence
 
<400> 10
 
Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys
1 5 10 15
 
 
Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr
20 25 30
 
 
Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe
35 40 45
 
 
Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala
50 55 60
 
 
His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile
65 70 75 80
 
 
Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp
85 90 95
 
 
Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu
100 105 110
 
 
Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys
115 120 125
 
 
Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly
130 135 140
 
 
Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro
145 150 155 160
 
 
Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys
165 170 175
 
 
Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly
180 185 190
 
 
Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp
195 200 205
 
 
Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala
210 215 220
 
 
Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys
225 230 235 240
 
 
Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser
245 250 255
 
 
Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro
260 265 270
 
 
Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp
275 280 285
 
 
Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala
290 295 300
 
 
Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala
305 310 315 320
 
 
Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln
325 330 335
 
 
Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala
340 345 350
 
 
Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn
355 360 365
 
 
Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile
370 375 380
 
 
Glu Gly Arg Ile Ser Glu Phe Met Trp Arg Pro Ser Asp Ser Thr Val
385 390 395 400
 
 
Tyr Val Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala
405 410 415
 
 
Tyr Val Lys Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu
420 425 430
 
 
Leu Ala Val Gly His Pro Tyr Tyr Ser Ile Lys Lys Val Asn Lys Thr
435 440 445
 
 
Val Val Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val
450 455 460
 
 
Leu Pro Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp
465 470 475 480
 
 
Pro Thr Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly
485 490 495
 
 
Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Leu Leu Asn
500 505 510
 
 
Lys Tyr Asp Asp Val Glu Asn Ser Gly Gly Tyr Gly Gly Asn Pro Gly
515 520 525
 
 
Gln Asp Asn Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu
530 535 540
 
 
Cys Met Val Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly
545 550 555 560
 
 
Thr Gln Cys Ser Asn Thr Ser Val Gln Asn Gly Asp Cys Pro Pro Leu
565 570 575
 
 
Glu Leu Ile Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly
580 585 590
 
 
Phe Gly Ala Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val
595 600 605
 
 
Pro Leu Asp Ile Cys Gly Thr Val Cys Lys Tyr Pro Asp Tyr Leu Gln
610 615 620
 
 
Met Ala Ala Asp Pro Tyr Gly Asp Arg Leu Phe Phe Tyr Leu Arg Lys
625 630 635 640
 
 
Glu Gln Met Phe Ala Arg His Phe Phe Asn Arg Ala Gly Thr Val Gly
645 650 655
 
 
Glu Pro Val Pro Asp Asp Leu Leu Val Lys Gly Gly Asn Asn Arg Ser
660 665 670
 
 
Ser Val Ala Ser Ser Ile Tyr Val His Thr Pro Ser Gly Ser Leu Val
675 680 685
 
 
Ser Ser Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala
690 695 700
 
 
Gln Gly His Asn Asn Gly Ile Cys Trp Gly Asn His Leu Phe Val Thr
705 710 715 720
 
 
Val Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val
725 730 735
 
 
Ser Lys Ser Ala Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg
740 745 750
 
 
His Val Glu Glu Phe Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile
755 760 765
 
 
Thr Leu Ser Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser
770 775 780
 
 
Val Leu Glu Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr
785 790 795 800
 
 
Leu Glu Asp Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln
805 810 815
 
 
Lys Pro Thr Pro Glu Lys Glu Lys Gln Asp Pro Tyr Lys Asp Met Ser
820 825 830
 
 
Phe Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln
835 840 845
 
 
Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg
850 855 860
 
 
Thr Ser Ala Arg Thr Gly Ile Lys Arg Pro Ala Val Ser Lys Pro Ser
865 870 875 880
 
 
Thr Ala Pro Lys Arg Lys Arg Thr Lys Thr Lys Lys
885 890
 
 
<210> 11
<211> 2091
<212> DNA
<213> artificial sequence
 
<400> 11
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
 
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
 
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
 
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
 
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
 
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
 
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
 
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
 
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
 
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
 
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
 
ctggaagttc tgttccaggg gccctctgac tctaccgttt acgttccgcc gccgaacccg 720
 
gtttctaaag ttgttgctac cgacgcttac gttaaacgta ccaacatctt ctaccacgct 780
 
tcttcttctc gtctgctggc tgttggtcac ccgtactact ctatcaaaaa agttaacaaa 840
 
accgttgttc cgaaagtttc tggttaccag taccgtgttt tcaaagttgt tctgccggac 900
 
ccgaacaaat tcgctctgcc ggactcttct ctgttcgacc cgaccaccca gcgtctggtt 960
 
tgggcttgca ccggtctgga agttggtcgt ggtcagccgc tgggtgttgg tgtttctggt 1020
 
cacccgctgc tgaacaaata cgacgacgtt gaaaactctg gtggttacgg tggtaacccg 1080
 
ggtcaggaca accgtgttaa cgttggtatg gactacaaac agacccagct gtgcatggtt 1140
 
ggttgcgctc cgccgctggg tgaacactgg ggtaaaggta cccagtgctc taacacctct 1200
 
gttcagaacg gtgactgccc gccgctggaa ctgatcacct ctgttatcca ggacggtgac 1260
 
atggttgaca ccggtttcgg tgctatgaac ttcgctgacc tgcagaccaa caaatctgac 1320
 
gttccgctgg acatctgcgg taccgtttgc aaatacccgg actacctgca gatggctgct 1380
 
gacccgtacg gtgaccgtct gttcttctac ctgcgtaaag aacagatgtt cgctcgtcac 1440
 
ttcttcaacc gtgctggtac cgttggtgaa ccggttccgg acgacctgct ggttaaaggt 1500
 
ggtaacaacc gttcttctgt tgcttcttct atctacgttc acaccccgtc tggttctctg 1560
 
gtttcttctg aagctcagct gttcaacaaa ccgtactggc tgcagaaagc tcagggtcac 1620
 
aacaacggta tctgctgggg taaccacctg ttcgttaccg ttgttgacac cacccgttct 1680
 
accaacatga ccctgtgcgc ttctgtttct aaatctgcta cctacaccaa ctctgactac 1740
 
aaagaataca tgcgtcacgt tgaagaattc gacctgcagt tcatcttcca gctgtgctct 1800
 
atcaccctgt ctgctgaagt tatggcttac atccacacca tgaacccgtc tgttctggaa 1860
 
gactggaact tcggtctgtc tccgccgccg aacggtaccc tggaagacac ctaccgttac 1920
 
gttcagtctc aggctatcac ctgccagaaa ccgaccccgg aaaaagaaaa acaggacccg 1980
 
tacaaagaca tgtctttctg ggaagttaac ctgaaagaaa aattctcttc tgaactggac 2040
 
cagttcccgc tgggtcgtaa attcctgctg cagtctggtt accgtggtta g 2091
 
 
<210> 12
<211> 2460
<212> DNA
<213> artificial sequence
 
<400> 12
atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60
 
ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120
 
tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180
 
ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240
 
atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300
 
gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360
 
gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420
 
acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480
 
gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540
 
aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600
 
tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660
 
ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720
 
ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780
 
atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840
 
cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900
 
aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960
 
cagaccggtg gatcctctac cgtttacgtt ccgccgccga acccggtttc taaagttgtt 1020
 
gctaccgacg cttacgttaa acgtaccaac atcttctacc acgcttcttc ttctcgtctg 1080
 
ctggctgttg gtcacccgta ctactctatc aaaaaagtta acaaaaccgt tgttccgaaa 1140
 
gtttctggtt accagtaccg tgttttcaaa gttgttctgc cggacccgaa caaattcgct 1200
 
ctgccggact cttctctgtt cgacccgacc acccagcgtc tggtttgggc ttgcaccggt 1260
 
ctggaagttg gtcgtggtca gccgctgggt gttggtgttt ctggtcaccc gctgctgaac 1320
 
aaatacgacg acgttgaaaa ctctggtggt tacggtggta acccgggtca ggacaaccgt 1380
 
gttaacgttg gtatggacta caaacagacc cagctgtgca tggttggttg cgctccgccg 1440
 
ctgggtgaac actggggtaa aggtacccag tgctctaaca cctctgttca gaacggtgac 1500
 
tgcccgccgc tggaactgat cacctctgtt atccaggacg gtgacatggt tgacaccggt 1560
 
ttcggtgcta tgaacttcgc tgacctgcag accaacaaat ctgacgttcc gctggacatc 1620
 
tgcggtaccg tttgcaaata cccggactac ctgcagatgg ctgctgaccc gtacggtgac 1680
 
cgtctgttct tctacctgcg taaagaacag atgttcgctc gtcacttctt caaccgtgct 1740
 
ggtaccgttg gtgaaccggt tccggacgac ctgctggtta aaggtggtaa caaccgttct 1800
 
tctgttgctt cttctatcta cgttcacacc ccgtctggtt ctctggtttc ttctgaagct 1860
 
cagctgttca acaaaccgta ctggctgcag aaagctcagg gtcacaacaa cggtatctgc 1920
 
tggggtaacc acctgttcgt taccgttgtt gacaccaccc gttctaccaa catgaccctg 1980
 
tgcgcttctg tttctaaatc tgctacctac accaactctg actacaaaga atacatgcgt 2040
 
cacgttgaag aattcgacct gcagttcatc ttccagctgt gctctatcac cctgtctgct 2100
 
gaagttatgg cttacatcca caccatgaac ccgtctgttc tggaagactg gaacttcggt 2160
 
ctgtctccgc cgccgaacgg taccctggaa gacacctacc gttacgttca gtctcaggct 2220
 
atcacctgcc agaaaccgac cccggaaaaa gaaaaacagg acccgtacaa agacatgtct 2280
 
ttctgggaag ttaacctgaa agaaaaattc tcttctgaac tggaccagtt cccgctgggt 2340
 
cgtaaattcc tgctgcagtc tggttaccgt ggtcgtacct ctgctcgtac cggtatcaaa 2400
 
cgtccggctg tttctaaacc gtctaccgct ccgaaacgta aacgtaccaa aaccaaaaaa 2460
 
 
<210> 13
<211> 2631
<212> DNA
<213> artificial sequence
 
<400> 13
atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60
 
ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120
 
ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180
 
atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240
 
accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300
 
aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360
 
gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420
 
aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480
 
ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540
 
gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600
 
aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660
 
ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720
 
gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780
 
ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840
 
ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900
 
ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960
 
actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020
 
tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080
 
gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140
 
aacctcggga tcgagggaag gatttcagaa ttcatgtggc gtccgtctga ctctaccgtt 1200
 
tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttaaacgt 1260
 
accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtactac 1320
 
tctatcaaaa aagttaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 1380
 
ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 1440
 
ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1500
 
ctgggtgttg gtgtttctgg tcacccgctg ctgaacaaat acgacgacgt tgaaaactct 1560
 
ggtggttacg gtggtaaccc gggtcaggac aaccgtgtta acgttggtat ggactacaaa 1620
 
cagacccagc tgtgcatggt tggttgcgct ccgccgctgg gtgaacactg gggtaaaggt 1680
 
acccagtgct ctaacacctc tgttcagaac ggtgactgcc cgccgctgga actgatcacc 1740
 
tctgttatcc aggacggtga catggttgac accggtttcg gtgctatgaa cttcgctgac 1800
 
ctgcagacca acaaatctga cgttccgctg gacatctgcg gtaccgtttg caaatacccg 1860
 
gactacctgc agatggctgc tgacccgtac ggtgaccgtc tgttcttcta cctgcgtaaa 1920
 
gaacagatgt tcgctcgtca cttcttcaac cgtgctggta ccgttggtga accggttccg 1980
 
gacgacctgc tggttaaagg tggtaacaac cgttcttctg ttgcttcttc tatctacgtt 2040
 
cacaccccgt ctggttctct ggtttcttct gaagctcagc tgttcaacaa accgtactgg 2100
 
ctgcagaaag ctcagggtca caacaacggt atctgctggg gtaaccacct gttcgttacc 2160
 
gttgttgaca ccacccgttc taccaacatg accctgtgcg cttctgtttc taaatctgct 2220
 
acctacacca actctgacta caaagaatac atgcgtcacg ttgaagaatt cgacctgcag 2280
 
ttcatcttcc agctgtgctc tatcaccctg tctgctgaag ttatggctta catccacacc 2340
 
atgaacccgt ctgttctgga agactggaac ttcggtctgt ctccgccgcc gaacggtacc 2400
 
ctggaagaca cctaccgtta cgttcagtct caggctatca cctgccagaa accgaccccg 2460
 
gaaaaagaaa aacaggaccc gtacaaagac atgtctttct gggaagttaa cctgaaagaa 2520
 
aaattctctt ctgaactgga ccagttcccg ctgggtcgta aattcctgct gcagtctggt 2580
 
taccgtggtc gtacctctgc tcgtaccggt atcaaacgtc cggctgtttc t 2631
 
 

Claims (21)

1., through a gene of the encoding human papilloma virus HPV11 L1 of intestinal bacteria preferred codons optimization, this gene is the nucleotide sequence shown in SEQ NO.2.
2. a coli expression carrier, is characterized in that this carrier comprises the sequence with gene described in claim 1.
3. coli expression carrier as claimed in claim 2, is characterized in that this carrier is pGEX-6p-1, pGEX-4T-2, pMAL or pET28a.
4. an engineering bacteria cell, this cell comprises gene according to claim 1, or the expression vector described in claim 2,3.
5. the fusion rotein of a Tag-HPV11 L1, it is characterized in that this albumen comprises the gene of encoding human papilloma virus HPV11 L1, preferably through the gene of the encoding human papilloma virus HPV11 L1 of intestinal bacteria preferred codons optimization, more preferably genes encoding as claimed in claim 1; Label Tag is GST.Tag, MBP.Tag or GST-SUMO.Tag.
6. fusion rotein as claimed in claim 5, is characterized in that L1 protein is that full length protein or C hold no more than 30 amino acid of brachymemma and/or N to hold no more than 10 the amino acid whose L1 protein of brachymemma.
7. fusion rotein as claimed in claim 5, is characterized in that its nucleotides sequence is classified as SEQ NO.3, SEQ NO.4, SEQ NO.5, SEQ NO.11, SEQ NO.12 or SEQ NO.13.
8. fusion rotein as claimed in claim 5, is characterized in that its aminoacid sequence is SEQ NO.8, SEQ NO.9 or SEQ NO.10.
9. a HPV11 L1 pentamer protein, is characterized in that this pentamer protein is obtained after purifying by the fused protein as described in claim 5,6,7 or 8, pentamer albumen median size 10 ~ 15nm PdI<0.1.
10. a VLP of HPV11 L1, is characterized in that this VLP is formed by pentamer protein assembly according to claim 9, median size 45 ~ 65nm PdI<0.1.
11. 1 kinds of HPV L1 protein vaccine compositions, is characterized in that this vaccine composition comprises HPV L1 pentamer protein according to claim 9 and medicinal adjuvant.
12. 1 kinds of HPV L1 protein vaccine compositions, is characterized in that this vaccine composition comprises HPV L1 VLP according to claim 10 and medicinal adjuvant.
The preparation method of 13. fusion roteins as described in claim 5,6,7 or 8, is characterized in that the method comprises the steps:
By replacing the codon of HPV11 L1 gene order with the codon of intestinal bacteria preference, obtain the gene of codon optimized HPV11 L1;
Build the coli expression carrier of HPV11 L1 gene;
Build the escherichia coli expression engineering strain of Tag-HPV11 L1;
Abduction delivering purifying obtains fusion rotein Tag-HPV11 L1.
14. methods as claimed in claim 13, wherein said prokaryotic host cell is GI698, ER2566, BL21 (DE3), XA90, B834 (DE3) or BLR (DE3), preferred BL21 (DE3).
The preparation method of 15. HPV11 L1 pentamer protein as claimed in claim 9, is characterized in that the method comprises the steps:
With affinity chromatography method absorption fusion rotein Tag-HPV11 L1;
Add proteolytic enzyme excision Tag label, obtain HPV11 L1 pentamer protein;
Purifying HPVL1 pentamer protein, the L1 pentamer protein of purity >98%, median size 10 ~ 15nm PdI<0.1.
The preparation method of 16. HPV11 L1 pentamer protein as claimed in claim 15, it is characterized in that described proteolytic enzyme is the site-specific proteolytic enzyme of excision Tag label: restructuring HRV 3CP, zymoplasm, SUMO proteolytic enzyme, SENP1 or TEV protease.
The preparation method of 17. HPV11 L1 VLP as claimed in claim 10, is characterized in that the method comprises the steps:
The L1 pentamer protein liquid of median size 10 ~ 15nm PdI<0.1 is mixed with assembling damping fluid, final acquisition pH value is 5.0 ~ 5.9, salt concn is 500 ~ 2000 mM, the HPV11 L1 VLP protein liquid of median size 45 ~ 65nm PdI<0.1.
18. a preparation method of HPV11 L1-VLP as claimed in claim 10 is assembled in cryogenic freezing process, it is characterized in that the method comprises the steps:
The L1 pentamer protein liquid of median size 10 ~ 15nm PdI<0.1 is placed in pH value is 5.5 ~ 8.0 salt concn is damping fluid under 150 ~ 1000 mM conditions, completely freezing under-20 ~-80 DEG C of conditions, place room temperature again to melt to protein stoste, obtain the HPV11 L1VLP protein liquid of median size 45 ~ 65nm PdI<0.1.
19. the application of HPV11 L1 pentamer protein as claimed in claim 9 in the medicine of preparation prevention HPV11 infection.
20. the application of HPV11 L1VLP protein as claimed in claim 10 in the medicine of preparation prevention HPV11 infection.
Application in the medicine that 21. vaccine compositions as described in claim 11 or 12 infect at preparation prevention HPV11.
CN201410672159.8A 2013-12-03 2014-11-22 11 type recombinant human papilloma virus-like particle and preparation method thereof Active CN105002190B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410672159.8A CN105002190B (en) 2013-12-03 2014-11-22 11 type recombinant human papilloma virus-like particle and preparation method thereof

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN201310635249 2013-12-03
CN2013106352495 2013-12-03
CN201410672159.8A CN105002190B (en) 2013-12-03 2014-11-22 11 type recombinant human papilloma virus-like particle and preparation method thereof

Publications (2)

Publication Number Publication Date
CN105002190A true CN105002190A (en) 2015-10-28
CN105002190B CN105002190B (en) 2022-11-08

Family

ID=54216657

Family Applications (5)

Application Number Title Priority Date Filing Date
CN201410672159.8A Active CN105002190B (en) 2013-12-03 2014-11-22 11 type recombinant human papilloma virus-like particle and preparation method thereof
CN201410672158.3A Active CN105177025B (en) 2013-12-03 2014-11-22 18 type recombinant human papilloma virus-like particle and preparation method thereof
CN201410672161.5A Active CN105039358B (en) 2013-12-03 2014-11-22 58 type recombinant human papilloma virus-like particle and preparation method thereof
CN201410685769.1A Active CN104962567B (en) 2013-12-03 2014-11-25 6 type recombinant human papilloma virus-like particle and preparation method thereof
CN201410683185.0A Active CN105039359B (en) 2013-12-03 2014-11-25 16 type recombinant human papilloma virus-like particle and preparation method thereof

Family Applications After (4)

Application Number Title Priority Date Filing Date
CN201410672158.3A Active CN105177025B (en) 2013-12-03 2014-11-22 18 type recombinant human papilloma virus-like particle and preparation method thereof
CN201410672161.5A Active CN105039358B (en) 2013-12-03 2014-11-22 58 type recombinant human papilloma virus-like particle and preparation method thereof
CN201410685769.1A Active CN104962567B (en) 2013-12-03 2014-11-25 6 type recombinant human papilloma virus-like particle and preparation method thereof
CN201410683185.0A Active CN105039359B (en) 2013-12-03 2014-11-25 16 type recombinant human papilloma virus-like particle and preparation method thereof

Country Status (1)

Country Link
CN (5) CN105002190B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107488747A (en) * 2017-09-14 2017-12-19 温州美众医学检验所 Quantitative fluorescent PCR primer and probe combinations and its reaction system
CN109952372A (en) * 2016-09-16 2019-06-28 白血球保健股份有限公司 Obtain the new method of the composition based on viral vectors effective for vaccine inoculation or gene therapy
CN114539363A (en) * 2020-11-26 2022-05-27 中国医学科学院基础医学研究所 C-terminal modified human papilloma virus 11 type L1 protein and application thereof

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105296521B (en) * 2015-12-07 2020-08-28 郑州大学 Recombinant plasmid for expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof
CN105548420B (en) * 2015-12-30 2019-08-02 上海泽润生物科技有限公司 The detection method of MOPS residual quantity
CN107188931B (en) * 2016-03-15 2020-02-11 中国医学科学院基础医学研究所 Truncated human papilloma virus 58 type L1 protein and application thereof
CN107184973A (en) * 2016-03-15 2017-09-22 中国医学科学院基础医学研究所 A kind of compound vaccine adjuvant and its application
CN108239652B (en) * 2016-12-27 2020-03-17 天津大学 Zika virus capsid protein rigid fusion expression vector and construction and application thereof
WO2021013063A1 (en) * 2019-07-19 2021-01-28 神州细胞工程有限公司 Chimeric human papillomavirus type 16 l1 protein
CN114681602B (en) * 2020-12-25 2023-12-01 中国食品药品检定研究院 Bivalent human papillomavirus vaccine
CN113549634B (en) * 2021-06-07 2023-03-31 郑州大学 Gene for coding soluble HPV58L1 protein and construction and application of recombinant plasmid thereof
CN116023446A (en) * 2022-10-28 2023-04-28 北京康乐卫士生物技术股份有限公司 Expression of human papilloma virus HPV68L1 protein, viroid particle and preparation method thereof
CN116200416B (en) * 2023-02-15 2024-03-12 北京康乐卫士生物技术股份有限公司 Construction and application of plasmid expression vector based on Tac promoter

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1259051A (en) * 1997-04-08 2000-07-05 麦克公司 Stabilized human papillomavirus formulations
CN101016542A (en) * 2007-02-14 2007-08-15 马润林 Method of increasing yield of human papilloma virus L1 albumen pronucleus expression
CN101343314A (en) * 2007-05-29 2009-01-14 厦门大学 Shorten human papilloma virus II type L1 protein
CN101481407A (en) * 2008-01-07 2009-07-15 马润林 Modification sequence of recombinant human mammilla tumor virus L1 capsid protein

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1386611A4 (en) * 2001-04-19 2009-05-13 Teika Pharmaceutical Co Ltd Medicines and medicinal kits
CN101153280B (en) * 2006-09-29 2015-08-19 厦门大学 The method of purifying human papilloma virus advanced protein L1 from prokaryotic organism
CN101245099A (en) * 2007-02-14 2008-08-20 马润林 Amino acid sequence of recombined human papilloma virus L1 capsid protein and uses thereof
BRPI0811016B1 (en) * 2007-04-29 2021-09-21 Xiamen Innovax Biotech Co., Ltd. LI TRUNCATE PROTEIN FROM HUMAN PAPILOMA VIRUS TYPE 16
WO2008134935A1 (en) * 2007-04-29 2008-11-13 Beijing Wantai Biological Pharmacy Enterprise Co., Ltd. Truncated human papillomavirus type 18 l1 proteins
WO2008145021A1 (en) * 2007-05-29 2008-12-04 Xiamen University A truncated l1 protein of human papillomavirus 6
CN101735310B (en) * 2008-11-20 2012-07-18 中国疾病预防控制中心病毒病预防控制所 Human papilloma virus (HPV) fusion protein, gene, carrier, strain, preparation method and application
WO2011138234A2 (en) * 2010-05-05 2011-11-10 Deutsches Krebsforschungszentrum Diagnostic transcript and splice patterns of hr-hpv in different cervical lesions
CN101857870B (en) * 2010-06-12 2012-09-05 上海泽润生物科技有限公司 HPV58 L1 gene, vector, strain and expression method
EP2594579B1 (en) * 2010-07-16 2015-04-15 Xiamen University Truncated human papillomavirus type 58 l1 protein
WO2012158639A2 (en) * 2011-05-14 2012-11-22 Sanofi Pasteur Biologics, Llc Recombinant fusion proteins and methods for use thereof for treatment or prevention of papillomavirus infection
CN103864936B (en) * 2012-12-11 2018-01-23 中国疾病预防控制中心病毒病预防控制所 HPV18 type L2NE7E6 antigen-4 fusion protein genes, expression vector, method, bacterial strain and purposes
CN104045696B (en) * 2012-12-18 2018-10-19 北京康乐卫士生物技术股份有限公司 L 1 Protein of Human Papillomavirus Type 16 of recombination and application thereof
CN104045695B (en) * 2012-12-19 2019-01-25 北京康乐卫士生物技术股份有限公司 HPV 18 L1 albumen of recombination and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1259051A (en) * 1997-04-08 2000-07-05 麦克公司 Stabilized human papillomavirus formulations
CN101016542A (en) * 2007-02-14 2007-08-15 马润林 Method of increasing yield of human papilloma virus L1 albumen pronucleus expression
CN101343314A (en) * 2007-05-29 2009-01-14 厦门大学 Shorten human papilloma virus II type L1 protein
CN101481407A (en) * 2008-01-07 2009-07-15 马润林 Modification sequence of recombinant human mammilla tumor virus L1 capsid protein

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
王晋: "人乳头瘤病毒11型L1蛋白的突变分析及其类病毒颗粒疫苗的研制", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109952372A (en) * 2016-09-16 2019-06-28 白血球保健股份有限公司 Obtain the new method of the composition based on viral vectors effective for vaccine inoculation or gene therapy
CN107488747A (en) * 2017-09-14 2017-12-19 温州美众医学检验所 Quantitative fluorescent PCR primer and probe combinations and its reaction system
CN114539363A (en) * 2020-11-26 2022-05-27 中国医学科学院基础医学研究所 C-terminal modified human papilloma virus 11 type L1 protein and application thereof
CN114539363B (en) * 2020-11-26 2023-12-01 中国医学科学院基础医学研究所 C-terminal modified human papilloma virus 11 type L1 protein and application thereof

Also Published As

Publication number Publication date
CN105177025A (en) 2015-12-23
CN104962567A (en) 2015-10-07
CN105039359A (en) 2015-11-11
CN104962567B (en) 2022-11-08
CN105039358A (en) 2015-11-11
CN105039359B (en) 2020-02-28
CN105002190B (en) 2022-11-08
CN105039358B (en) 2020-02-28
CN105177025B (en) 2022-11-01

Similar Documents

Publication Publication Date Title
CN105002190A (en) 11-type recombinant human papilloma virus virus-like particle and preparation method thereof
Finnen et al. Interactions between papillomavirus L1 and L2 capsid proteins
CN101293918B (en) Shorten human papilloma virus 16 type L1 protein
US10537629B2 (en) Truncated L1 protein of human papillomavirus type 11
CN104710515B (en) Human mammilla tumor virus L 1 protein mutant and preparation method thereof
EP1305039B1 (en) Stable (fixed) forms of viral l1 capsid proteins, fusion proteins and uses thereof
CN106831958B (en) Mutant of human papilloma virus 11 type L1 protein
CN106831961A (en) A kind of mutant of human papillomavirus type 58 L1 albumen
CN101343315B (en) Shorten human papilloma virus 6 type L1 protein
CN106831959A (en) A kind of mutant of human papillomavirus 33 type L 1 protein
CN106399329B (en) 33 type recombinant human papilloma virus-like particle and preparation method thereof
CN110551183A (en) Mutant of human papilloma virus 39 type L1 protein
CN104212818A (en) Optimized gene sequence of human papillomavirus 31 type L1 protein
CN106701797B (en) 31 type recombinant human papilloma virus-like particle and preparation method thereof
CN101570571A (en) Truncated human papilloma virus 18 type L1 protein
CN106701796B (en) 52 type recombinant human papilloma virus-like particle and preparation method thereof
CN104211782B (en) The type L1 albumen of HPV 45 of truncation
EP2183359A2 (en) Improved methods for protein production
CN106701798B (en) 45 type recombinant human papilloma virus-like particle and preparation method thereof
CN104045695A (en) Recombinant human papilloma virus 18L1 protein and its use
Garcea et al. Interactions between Papillomavirus L1 and

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant