CN106701796B - 52 type recombinant human papilloma virus-like particle and preparation method thereof - Google Patents

Abstract

The invention relates to a 52-type recombinant human papilloma virus-like particle and a preparation method thereof, and particularly provides a novel polynucleotide gene segment for coding recombinant HPV 52L 1 protein, a vector containing the gene segment, a host cell comprising the vector, HPV 52L 1 fusion protein and a pentamer which are translated and expressed by the gene segment, and VLP consisting of the pentamer, and also discloses application of the pentamer, the VLP protein and a vaccine composition consisting of the pentamer and the VLP protein in preparation of a medicament for preventing HPV52 infection.

Description

52 type recombinant human papilloma virus-like particle and preparation method thereof

Technical Field

The invention relates to a virus-like particle of human papilloma virus and a preparation method thereof. More particularly, the invention relates to a pentamer of recombinant human papilloma Virus L1 protein and Virus-like particles (VLPs), a preparation method thereof, and application of a vaccine composition containing the VLPs in prevention of human papilloma Virus infection.

Background

Human Papillomaviruses (HPV) are known to cause numerous proliferative epithelial lesions in humans, including papillomas (warts) and neoplasias, mainly by close contact with the Human body, such as sexually transmitted viruses. In particular, HPV-induced diseases mainly include 3 major groups, 1 st group: cancers of the cervix, vagina, female vulva, penis and anus, and certain types of head and neck tumors. 100% of cervical cancer patients are caused by HPV infection, 90% of anal cancer, 40% of vulva, vagina and penis, 12% of oropharynx and 3% of oral cancer are due to HPV infection. Class 2: benign lesions, such as genital warts, including flat warts and condyloma acuminata, are sexually transmitted diseases and are common in people with active sexual behaviors. Although genital warts do not have as serious consequences as cancer, the lesions often cause painful clinical symptoms such as burning, bleeding and pain for the patient, and also cause embarrassment, anxiety and negative psychological reactions such as self-mutism, and the repeated treatment process wastes a great deal of medical resources. It is estimated that there are 3000 tens of thousands of genital warts worldwide caused by non-oncogenic HPV (mainly types 6 and 11), with 20-50% of lesions also containing mixed infections with high-risk HPV types. Class 3: HPV infection can also cause Recurrent Respiratory Papillomas (RRPs), a rare, potentially fatal disease that occurs primarily in adolescents, and sometimes, a large number of papillomas can cause dyspnea and death in younger children. Therefore, the prevention or treatment of HPV infection is of great significance to human health.

HPV is a membrane-free double-stranded DNA virus, consisting mainly of viral coat and genomic DNA (Bernard, Burk et al 2011). The HPV virus coat is an icosahedral structure consisting of 360L 1 proteins (forming 72 pentamers) and at most 72L 2 proteins, and has a diameter of 55-60 nm (Howley and Lowy 2007). The viral coat protein has self-assembly properties, and L1 protein alone or together with L2 protein self-assembles in vitro to form Virus-like particles (VLPs) (Chen, Garce et al 2000, Finnen, Erickson et al 2003, Buck, Cheng et al 2008, Wang and Roden 2013).

Since HPV cannot be cultured in vitro, the specific antigen of the virus can be obtained only by using the method of recombinant DNA technology to prepare the genetic engineering vaccine. The virus-like particles VLPs formed by assembling the recombinant Ll or L1/L2 have no virus DNA, good safety and antigen epitope similar to natural virus particles, and can generate neutralizing antibodies IgG and IgA after stimulating an organism, so the HPV VLPs can be used as a preventive vaccine, thereby greatly reducing the possibility of generating related tumors caused by infecting HPV (Howley and Lowy 2007).

The key to developing HPV vaccine is the ability to prepare high purity, stable HPV antigens in large quantities. In the aspect of HPV vaccine antigen preparation technology, the expression systems for producing HPV antigens that are currently used can be classified into eukaryotic expression systems and prokaryotic expression systems. Examples of eukaryotic expression systems that are commonly used include poxvirus expression systems, insect baculovirus expression systems, and yeast expression systems. HPV L1 expressed in eukaryotic expression systems spontaneously forms VLPs, which are often obtained by simple purification. However, the expression level of the eukaryotic expression system is low, the culture cost is high, and great difficulty is brought to large-scale industrial production. The expression of HPV L1 protein in prokaryotic expression system by means of E.coli expression system has been reported. However, since the HPV L1 protein expressed by escherichia coli is low in solubility, the HPV VLPs are finally purified from the cell sap with the complicated protein types by the currently known purification methods, such as salt-free precipitation or denaturation and renaturation. For example: in patent CN02129070.9, a method for expressing and preparing HPV L1 multimer by prokaryotic cell is disclosed, wherein the purification process comprises treatment by 3.3M urea and dialysis renaturation process; the purification of the L1-GST fusion protein in WO-0204007 patent was also carried out by urea denaturation and dialytic renaturation; it is also disclosed in the prior art that the purification method of L1 protein comprises the steps of ultrafiltration dialysis with phosphate buffer and centrifugation to precipitate the target protein for reconstitution. However, in these purification processes, the amount of protein lost is large, the yield is low, and it is difficult to apply the method to mass production.

In the aspect of uniformity of HPV vaccine antigen protein VLP, the particle size dispersion of HPV L1VLP assembled in the prior art is expressed by using poly d value, wherein the poly d value is less than 15% to indicate that the particles have good uniformity, between 15% and 30% to indicate that the particles have large heterogeneity, and more than 30% to indicate that the particles are not uniform enough. The HPV L1VLP prepared in the prior art is more than 15%. Another indication that the particle size is uniform is the PdI value, which is the particle size distribution coefficient, less than 0.05 being a highly uniform sample; 0.05 to 0.1, 0.1 to 0.3, and more than 0.3. The PdI of a mixed protein solution of two type HPV L1 VLPs is disclosed in US7205125B2 patent to be 0.07.

Therefore, there is still a need in the art for a low-cost, high-purity, high-yield, quality-stable HPV L1 protein production technology and a new method for large-scale industrial production of recombinant HPV L1 VLPs.

Disclosure of Invention

The invention aims to disclose an optimized nucleotide sequence for coding HPV 52L 1 protein, a vector comprising the nucleotide sequence, a host cell comprising the vector, HPV L1 protein which is translated and expressed by the polynucleotide sequence, Tag-HPV-L1 recombinant protein, pentamer and VLP formed by the L1 protein, and a vaccine for preventing HPV infection by taking the pentamer and VLP as antigens.

In a first aspect, the invention provides a codon optimized HPV 52L 1 gene, the nucleotide sequence of which is SEQ NO: 2.

in a second aspect, the present invention provides a constructed expression vector comprising the gene of codon-optimized HPV 52L 1 of the first aspect of the invention. The vector is suitable for driving heterologous DNA to express HPV L1 protein translationally in bacteria. In one embodiment, the expression vector is preferably pGEX-6p-1, pGEX-4T-2, pMAL, or pET28 a.

In a third aspect, the invention provides a constructed engineered bacterial cell comprising the gene of the first aspect of the invention, or the expression vector of the second aspect. The engineered host cell is E.coli, and in one embodiment, the host cell is preferably BL21 cell strain.

The fourth aspect of the invention provides a Tag-HPV 52L 1 fusion protein, wherein the Tag is 6 His Tag, GST Tag, sumo Tag, mbp Tag, 6 His-sumo Tag or GST-sumo Tag; l1 is HPV 52L 1 full length protein and/or L1 protein truncated 5, 10, 15 or no more than 30 amino acids at the C-terminus and/or 2, 4, 6 or no more than 10 amino acids at the N-terminus.

The nucleotide sequence of the fusion protein GST-HPV 52L 1 of the coding Tag-HPVL1 is SEQ NO: 3. the amino acid sequence of SEQ NO: 11, the nucleotide sequence of GST-SUMO-HPV 52L 1 is SEQ NO: 4. the amino acid sequence of SEQ NO: 12, nucleotide sequence of MBP SEQ NO: 5. the amino acid sequence of SEQ NO: 13, 6 His-HPV 52L 1 has the nucleotide sequence of SEQ NO: 6, 6 His-SUMO-HPV 52L 1 nucleotide sequence of SEQ NO: 7.

the amino acid sequence of the fusion protein GST-HPV 52L 1 of the coding Tag-HPVL1 is SEQ NO: 8, the amino acid sequence of GST-SUMO-HPV 52L 1 is SEQ NO: 9, amino acid sequence of MBP SEQ NO: 10.

the fifth aspect of the present invention provides a pentamer of HPV L1 obtained by purifying a Tag-HPVL1 fusion protein, and a VLP assembled from the pentamer. In a preferred embodiment, the average particle size of the HPV 52L 1 pentamer protein is 10-15 nm PdI < 0.1. In a preferred embodiment, the HPV 52L 1VLP has an average particle size of 52-65 nm PdI < 0.1.

In a sixth aspect, the present invention provides a vaccine composition comprising a pentamer of HPV L1 or a VLP of HPV L1 of the invention, said composition further comprising a pharmaceutically acceptable excipient and a pharmaceutically acceptable adjuvant.

In one embodiment, a protein stock solution containing HPV 52L 1 pentamer or VLP (prepared according to the above method) is mixed with an aluminum hydroxide adjuvant physiological saline solution according to the ratio of protein to aluminum content 1: adsorbing at a ratio of 10 to prepare the recombinant HPV L1 protein pentamer or VLP vaccine, and storing at 4 ℃ for later use.

In another aspect, the present invention also provides a method for obtaining a Tag-HPVL1 fusion protein, comprising the steps of:

A. replacing codons of the translation homologous protein of the HPV 52L 1 gene sequence by codons preferred by escherichia coli to obtain a codon-optimized HPV 52L 1 gene preferred by an escherichia coli expression system;

B. constructing an Escherichia coli expression vector of the HPV 52L 1 gene;

C. constructing an escherichia coli expression engineering strain of Tag-HPV 52L 1;

D. inducing expression and purifying to obtain fusion protein Tag-HPV 52L 1.

The prokaryotic host cell in the above method for preparing the fusion protein Tag-HPV 52L 1 is selected from but not limited to GI698, ER2566, BL21(DE3), XA90, B834(DE3), BLR (DE 3).

The expression conditions in the method for preparing the fusion protein Tag-HPV 52L 1 are as follows: under the temperature condition of 20-37 ℃, the induction expression is carried out for 3-20 hours. In one embodiment, preferably at 28 ℃ temperature, induced expression for 16 hours.

The invention also provides a method for obtaining the HPV 52L 1 pentamer, which comprises the following steps:

a) adsorbing the fusion protein Tag-HPV 52L 1 by an affinity chromatography method;

b) adding a proteolytic enzyme to excise the Tag label to obtain HPV 52L 1 pentamer protein;

c) purifying the HPVL1 pentamer protein to obtain the L1 pentamer protein with the purity of more than 98% and the average particle size of 10-15 nm PdI of less than 0.1.

The protease used in the above method for preparing HPV 52L 1 pentamer is a site-specific proteolytic enzyme that cleaves the Tag: recombinant 3C protease, thrombin, SUMO protease, SENP1 or TEV protease.

The purification method in the method for preparing HPV 52L 1 pentamer is selected from, but not limited to, ion exchange chromatography, hydrophobic chromatography, molecular sieve (or gel filtration or molecular exclusion) chromatography; preferably the purification comprises ion exchange chromatography and molecular sieve chromatography.

The purification method in the method for preparing HPV 52L 1 pentamer further comprises using a reducing agent, such as DTT.

The HPV 52L 1 pentamer protein obtained after final purification in the method for preparing the HPV 52L 1 pentamer has an average particle size of 10-15 nm PdI < 0.1.

The invention also provides a method for assembling the HPV 52L 1 pentamer into VLPs, which comprises the following steps:

mixing the L1 pentamer protein solution with the average particle size of 10-15 nm PdI <0.1 with an assembly buffer solution to finally obtain the HPV 52L 1VLP protein solution with the pH value of 5.0-5.9, the salt concentration of 500-2000 mM and the average particle size of 52-65 nm PdI <0.1, preferably obtain the HPV 52L 1VLP protein solution with the pH value of 5.7 and the salt concentration of 1300 mM.

The assembly buffer includes, but is not limited to, Tris buffer, phosphate buffer, acetate buffer, HEPES buffer, MOPS buffer, citric acid buffer, histidine buffer, boric acid buffer, and the like.

In the method for assembling the HPV 52L 1 pentamer into VLPs, protective agents can be added into the protein liquid of the HPV 52L 1-VLP, such as: 0.01-0.1 polysorbate 80.

In another aspect, the invention also provides the use of pentamers of HPV L1, VLPs and vaccine compositions comprising the pentamers or VLPs in the preparation of a medicament for the prevention of HPV infection.

According to the present invention, the vaccine of the present invention may take a form acceptable to patients, including but not limited to injection or nasal or buccal inhalation or vaginal administration, preferably injection and intramuscular injection.

Description and explanation of related terms in the present invention

According to the present invention, the term "E.coli expression system" means a system consisting of E.coli (strain) derived from commercially available sources, exemplified herein but not limited thereto: GI698, ER2566, BL21(DE3), XA90, DH (5a), B834(DE3), BLR (DE 3).

According to the present invention, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide encoding a protein can be inserted and the protein expressed. The vector may be transformed, transduced or transfected into a host cell to obtain expression of the genetic material element carried by the vector in the host cell. By way of example, the carrier includes: a plasmid; bacteriophage; cosmids, and the like.

According to the present invention, the term "vaccine excipient or carrier" refers to a substance selected from one or more of, including but not limited to: pH regulator, surfactant, adjuvant, and ionic strength enhancer. For example, pH adjusting agents such as, but not limited to, phosphate buffers, surfactants include cationic, anionic or nonionic surfactants. By way of example but not limitation: polysorbate 80. Adjuvants are exemplified by, but not limited to, aluminum hydroxide, aluminum phosphate, freund's complete adjuvant, freund's incomplete adjuvant, and the like. Ionic strength enhancers are exemplified by, but not limited to, sodium chloride.

According to the present invention, the term "chromatography" includes, but is not limited to: ion exchange chromatography (e.g., cation exchange chromatography, anion exchange chromatography), hydrophobic interaction chromatography, adsorption chromatography (e.g., hydroxyapatite chromatography), molecular sieve chromatography (gel filtration or size exclusion chromatography), affinity chromatography.

According to the present invention, in the method for obtaining recombinant HPV L1 protein according to the present invention, the buffer refers to a solution capable of greatly reducing the pH fluctuation range upon addition of a small amount of acid or alkali and water, and includes, but is not limited to, Tris buffer, phosphate buffer, acetate buffer, HEPES buffer, MOPS buffer, citrate buffer, histidine buffer, boric acid buffer, and the like.

According to the present invention, the cell disruption includes, but is not limited to, one or more of disruption by a homogenizer, sonication, milling, high pressure extrusion, lysozyme treatment;

according to the present invention, in the method of obtaining recombinant HPV L1 protein according to the present invention, the salt used includes, but is not limited to, neutral salt, especially one or more of alkali metal salt, ammonium salt, hydrochloride, sulfate, bicarbonate, phosphate or hydrogen phosphate, especially NaCl, KCl, CaCl2, NH4Cl, KCl, NH4Cl, MgSO4, (NH4)2SO 4. NaCl is preferred. Reducing agents used include, but are not limited to, DTT, 2-mercaptoethanol. The amount used includes, but is not limited to, 2mM to l00mM, preferably 10 to 15 mM.

Advantageous effects

The invention provides a synthetic gene, the gene sequence is a nucleotide sequence which is subjected to codon optimization according to the codon preference of escherichia coli, and the sequence encodes an HPV L1 protein amino acid sequence. The research finds that the expression amount of the L1 protein of the nucleic acid sequence subjected to codon optimization is obviously improved compared with that of the nucleic acid sequence not subjected to codon optimization.

The escherichia coli expression system disclosed by the invention has the advantages of high expression level, easiness in culture and operation, low production cost and the like. However, it is still difficult to directly obtain a large amount of soluble HPV L1 protein using only this expression system because L1 protein is very easy to form inclusion bodies, i.e., insoluble polymers having no biological activity. In addition, even if a large amount of inclusion bodies are obtained, in order to obtain biologically active proteins, the inclusion bodies must be denatured and renatured, and a large amount of protein is often lost in this process. In order to solve the problem, the invention adopts a fusion technology to perform fusion expression on the L1 gene and a protein which assists the correct folding of the protein, such as glutathione-S-transferase (GST), SUMO, MBP, 6 His-SUMO or GST-SUMO, and the like, so that the solubility and the yield of the protein are improved, and GST-SUMO-HPVL1, 6 His-SUMO-HPVL1 ensure that no exogenous amino acid residue is left at the N end of the HPV L1 protein, and the GST-SUMO is found as a fusion tag and a molecular chaperone expressed by the recombinant protein HPV L1 and has the functions of resisting proteolysis, remarkably increasing the expression amount of the recombinant protein, promoting the correct folding of the target protein, improving the solubility and the like. Therefore, the technical route adopted by the invention is to adopt a tag protein fusion technology when constructing an HPV L1 protein expression vector, on one hand, the solubility of the target protein is improved and the yield is improved through the fusion protein formed by the tag protein and the L1 protein, on the other hand, the purification characteristic of the target protein can be carried out through the GST fusion tag by utilizing the methods of affinity chromatography and proteolytic enzyme excision fusion substance tag, thereby realizing the one-step purification of the various cell lysates to obtain the HPV L1 protein with the purity of more than 70 percent, greatly improving the purification efficiency and further improving the yield of the final product HPV L1 protein.

The technical route of the invention, which is firstly used for obtaining the high-purity HPV L1 pentamer protein through expression, separation and purification and then manually controlling and assembling to form the VLP, can solve the problems of low purity, high degradation ratio and low yield of VLP directly purified from cell disruption solutions with various proteins in the prior art, and obtains the high-purity pentamer in-vitro assembled VLP and the VLP storage condition.

The HPV L1VLP protein obtained by recombination has good immunogenicity, can induce high-titer neutralizing antibodies aiming at homotype HPV, prevents HPV infection to human body, and is a good vaccine form.

These and other aspects of the invention will be apparent upon reference to the following detailed description and attached drawings. All references disclosed herein are incorporated by reference in their entirety.

Drawings

FIG. l: and (3) an SDS-PAGE gel electrophoresis picture of GST-HPV 52L 1 protein affinity and enzymolysis. The M lane is a protein mass standard lane and comprises the following components from top to bottom: 94kDa, 66kDa, 52kDa, 52kDa, 26kDa, 20 kdat; lane 1 is a medium for affinity adsorption of GST-L1, having a molecular weight of approximately 80 kDa; lane 2 is the medium of GST and L1 after enzymatic hydrolysis.

FIG. 2: SDS-PAGE gel electrophoresis picture of GST-SUMO-HPV 52L 1 protein after affinity and enzymolysis. Lane M is the protein mass standard (94 kDa, 66kDa, 52kDa, 52kDa, 26kDa, 20kDa from top to bottom), lane 1 is the medium for affinity adsorption of GST-SUMO-L1, and lane 2 is the medium for GST-SUMO and L1 after enzymolysis.

FIG. 3: SDS-PAGE gel electrophoresis picture of MBP-HPV 52L 1 protein after affinity and enzymolysis. Lane M is the protein mass standard (94 kDa, 66kDa, 52kDa, 52kDa, 26kDa, 20kDa from top to bottom), lane 1 is the medium for affinity adsorption of MBP-L1, and lane 2 is the medium for binding of MBP to L1 after enzymolysis.

FIG. 4: 6H HIS-SUMO-HPV 52L 1 protein after affinity and enzymolysis, SDS-PAGE gel electrophoresis picture. Lane M is the protein mass standard (from top to bottom: 94kDa, 66kDa, 52kDa, 52kDa, 26kDa, 20 kDa), lane 1 is the medium for affinity adsorption of 6 HIS-SUMO-L1, and lane 2 is the medium for 6 HIS-SUMO and L1 after enzymolysis. The proteolytic cleavage of the lyso-protein with the 6 th HIS-SUMO tag was shown by gel electrophoresis.

FIG. 5: the SDS-PAGE gel electrophoresis picture of the recombinant HPV 52L 1 pentamer protein purified by molecular sieve chromatography is shown. The M lane is the protein mass standard (94 kDa, 66kDa, 52kDa, 52kDa, 26kDa, 20kDa from top to bottom), and the other lane is the HPV L1 protein.

FIG. 6: dynamic light scattering observations of HPV 52L 1 pentamer. The results show a particle size diameter of the pentamer of 12.32 nM and a particle size distribution PdI of 0.083.

FIG. 7: dynamic light scattering observations of HPV 52L 1 VLPs. The results showed that the particle size diameter of the VLP was 60.44 nM and the particle size distribution PdI was 0.029.

FIG. 8: transmission electron micrograph of HPV 52L 1 pentameric protein.

FIG. 9: transmission electron micrograph of HPV 52L 1VLP protein.

FIG. 10: high pressure liquid phase molecular sieve chromatogram of HPV 52L 1 pentamer protein showing that highly purified L1 pentamer protein is more than 98% pure.

FIG. 11: high pressure liquid phase molecular sieve chromatograms of HPV 52L 1VLP proteins showing that highly purified VLP proteins are greater than 98% pure.

FIG. 12: the mean titer levels of neutralizing antibodies were measured 4 weeks after the second booster immunization of mice vaccinated with each experimental group of HPV 52L 1 pentamer.

FIG. 13: the mean titer level of neutralizing antibodies was measured 4 weeks after the second booster immunization of mice after vaccination of each experimental group of HPV 52L 1 VLPs.

The invention is further illustrated by the following examples. These examples are not limiting.

Example i: design and synthesis of codon-optimized HPV L1 gene

The gene sequence is derived from various HPV sequences disclosed on PUBMED. All HPV DNA sequences were synthesized after codon optimization of selected HPV DNA sequences with reference to E.coli bias towards gene transcription codons. Primers were designed based on the synthetic DNA sequence and PCR amplification was performed using the synthetic gene as a template. The resulting codon optimized sequence was verified by DNA sequencing.

DNA sequences of HPV types before and after optimization:

1, SEQ No. 1: DNA sequence of HPV52 type L1 before optimization

SEQ NO. 2: optimized HPV52 type L1 DNA sequence

Example 2: construction and identification of recombinant vector pGEX-6P-1-GST-HPV 52L 1:

DNA fragment primers for amplification of HPV 52L 1: (cleavage sites are BamHI and XhoI, respectively)

Forward-HPV52 L1-ApaI：5’ACTTCAGGATCC ATGTCTGTTTGGCGTCCGTCTG

Reverse-HPV52 L1-XhoI：5’ATCTCACTCGAGCTA ACGTTTAACTTTTTTTTTTTT

PCR amplification reaction System: 10 Xpfu buffer 20. mu.L, Pfu enzyme 4. mu.L, 10 mM dNTP 2.5. mu.L, 5' Primer (5. mu.L)M) 10. mu.L, 10. mu.L of 3' Primer (5. mu.M), 50 ng of template DNA, plus d₂H₂O to 200. mu.L.

The gene PCR amplification conditions are as follows: 3 min at 95 ℃; 30 sec at 95 ℃, 30 sec at 58 ℃ and 4 min at 72 ℃; circulating for 32 times; 10 min at 72 ℃.

Carrying out BamH I/XhoI double enzyme digestion treatment on an L1 gene fragment containing BamH I and XhoI enzyme digestion sites and a vector pGEX-6P-1, and then carrying out ligation reaction on the recovered gene fragment and pGEX-6P-1 containing a corresponding cohesive end by using T4 DNA ligase at 16 ℃ for 10-15 h.

After the ligation reaction, the ligation product is transformed into host strain DH5 alpha for recombinant screening. The screened monoclonal colony is subjected to amplification culture and plasmid extraction, and then sequencing is carried out by Shanghai bio-engineering company, so that the nucleotide sequence of the fusion recombinant GST-HPV52-L1 protein is SEQ NO.3, and the amino acid sequence is SEQ NO. 8.

With reference to this example, a fusion recombinant vector GST-HPV-L1 with GST-tag was prepared, the gene sequence of which is SEQ NO. 11.

Example 3: construction of recombinant vector pGEX-6P-1 m-GST-SUMO-HPV 52L 1 vector

Construction of pGEX-6p-1m vector: in order to ensure that ApaI enzyme cutting sites (GGGCCC) near the multi-enzyme cutting sites are the only ApaI enzyme cutting sites of the vector, the Gly codon GGC in another ApaI recognition sequence GGGCCC of a commercial pGEX-6p-1 vector is changed into the same sense codon GGT by a point mutation technology on the premise of not changing the protein expression sequence of the lacL gene, and the ApaI can be eliminated (3890). ApaI is made available to insert a site for expression of a gene by such a modification.

DNA fragment primers for amplification of SUMO: (cleavage sites were ApaI and BamHI, respectively)

Forward -SUMO-ApaI： ACTTCAGGGCCCTCTGACCAGGAAGCTAAACCGTC

Reverse-SUMO-BamHI： CGCGGATCCACCGGTCTGTTCCTGGTAAAC

DNA fragment primers for amplification of HPV 52L 1: (cleavage sites are BamHI and XhoI, respectively)

Forward-HPV52 L1-ApaI：5’ACTTCAGGATCC ATGTCTGTTTGGCGTCCGTCTG

Reverse-HPV52 L1-XhoI：5’ATCTCACTCGAGCTA ACGTTTAACTTTTTTTTTTTT

PCR amplification reaction System: 10 Xpfu buffer 20. mu.L, Pfu enzyme 4. mu.L, 10 mM dNTP 2.5. mu.L, 5 'Primer 10. mu.L, 3' Primer 10. mu.L, template DNA 50 ng, plus d₂H₂O to 200. mu.L.

The gene PCR amplification conditions are as follows: 1.5 min at 95 ℃; 30 sec at 95 ℃, 30 sec at 58 ℃ and 1 min at 72 ℃; circulating for 32 times; 10 min at 72 ℃.

The gene PCR amplification conditions were the same as in the above examples.

Enzyme digestion connection: carrying out Apa I/BamHI double enzyme digestion treatment on the SUMO gene fragment containing ApaI and BamHI enzyme digestion sites and the vector pGEX-6P-1m, and then carrying out a ligation reaction on the recovered gene fragment and pGEX-6P-1m containing the corresponding cohesive end by using T4 DNA ligase at 16 ℃ for 10-15 h.

Transformation and identification: after the ligation reaction, the ligation product is transformed into host strain DH5 alpha for recombinant screening. The screened monoclonal colonies are subjected to amplification culture and plasmid extraction, and then sequencing is performed by Suzhou Jinzhi Biotechnology Limited to obtain a fusion recombinant vector pGSTSMO-6 p-1 m.

And (3) secondary enzyme digestion and connection: the L1 gene fragment containing BamHI and Xho1 enzyme cutting sites and the recombinant vector pGSTSMMO-6 p-1m are subjected to BamHI/Xho1 double enzyme cutting treatment, and then the recovered gene fragment is subjected to ligation reaction with pGST-SUMO-6p1m containing corresponding cohesive ends by using T4 DNA ligase at 16 ℃ for 10-15 h.

And (3) secondary transformation and identification: after the ligation reaction, the ligation product is transformed into host strain DH5 alpha for recombinant screening. The screened monoclonal colony is subjected to amplification culture and plasmid extraction, and then sequencing is carried out by Suzhou Jinzhi Biotechnology Limited to obtain a fusion recombinant vector GST-SUMO-L1 with a GST-SUMO label, wherein the gene sequence is SEQ NO.4, and the amino acid sequence is SEQ NO. 9.

The fusion recombinant vector GST-SUMO-L1 with GST-SUMO tag was prepared according to the method of this example, and its gene sequence SEQ NO. 12.

Example 4: construction of recombinant vector pMAL-MBP-HPV 52L 1

DNA fragment primers for amplification of HPV 52L 1: (restriction sites were EcoRI and HindIII, respectively)

Forward-HPV52 L1-EcoRI：5’ ACTTCA GAATTC ATGTCTGTTTGGCGTCCGTCTG

Reverse-HPV52 L1-HindIII：5’ ATCTCA AAGCTTCTA ACGTTTAACTTTTTTTTTTTT

Carrying out EcoRI/HindIII double enzyme digestion treatment on an L1 gene fragment containing EcoRI and HindIII enzyme digestion sites and a vector pMAL, then carrying out ligation reaction on the recovered gene fragment and pMAL containing a corresponding cohesive end by using T4 DNA ligase, and carrying out 10-15 h at 16 ℃.

After the ligation reaction, the ligation product is transformed into host strain DH5 alpha for recombinant screening. The screened monoclonal colony is subjected to amplification culture and plasmid extraction, and then sequencing is carried out by Shanghai bio-engineering company to obtain a gene sequence SEQ NO.5 and an amino acid sequence SEQ NO.10 of the fusion recombinant MBP-HPV52-L1 protein.

A fusion recombinant vector MBP-HPV-L1 with MBP tag is prepared according to the method of the embodiment, and the gene sequence is SEQ NO. 13.

Example 5: construction of recombinant vector pET28a-6 His-HPV 52L 1

DNA fragment primers for amplification of HPV 52L 1: (the cleavage sites were NdeI and XhoI, respectively, pET28 a)

Forward-HPV52 L1-NdeI：5’ GACTTCA CATATGATGTCTGTTTGGCGTCCGTCTG

Reverse-HPV52 L1-XhoI：5’ CATCTCACTCGAGCTA ACGTTTAACTTTTTTTTTTTT

The L1 gene fragment containing NdeI and XhoI enzyme cutting sites and the vector pMAL are subjected to NdeI/XhoI double enzyme cutting treatment, and then the recovered gene fragment and pET28a containing the corresponding cohesive end are subjected to ligation reaction by utilizing T4 DNA ligase at 16 ℃ for 10-15 h.

After the ligation reaction, the ligation product is transformed into host strain DH5 alpha for recombinant screening. And carrying out amplification culture on the screened monoclonal colonies, extracting plasmids, and sequencing by Shanghai bio-engineering company to obtain a gene sequence SEQ NO.6 of the fusion recombinant 6 His-HPV52-L1 protein.

Example 6: recombinant vector 6 His-SUMO-HPV 52L 1 vector construction

DNA fragment primers for amplification of SUMO: (the cleavage sites were NdeI and BamHI, respectively)

Forward -SUMO-NdeI： GGAATTCCATATGTCTGACCAGGAAGCTAAACCGTC

Reverse-SUMO-BamHI： CGC GGATCCACCGGTCTGTTCCTGGTAAAC

DNA fragment primers for amplification of HPV 52L 1: (cleavage sites are BamHI and XhoI, respectively)

Forward-HPV52 L1-ApaI：5’ACTTCAGGATCC ATGTCTGTTTGGCGTCCGTCTG

Reverse-HPV52 L1-XhoI：5’ATCTCACTCGAGCTA ACGTTTAACTTTTTTTTTTTT

The conditions and reaction system for PCR amplification of the SUMO gene and the L1 gene were as described in the above examples.

Enzyme digestion connection: the SUMO gene fragment containing NdeI and BamHI enzyme cutting sites and a vector pET-28a are subjected to NdeI/BamHI double enzyme cutting treatment, and then the recovered gene fragment and pET28a containing corresponding cohesive ends are subjected to ligation reaction by using T4 DNA ligase at 16 ℃ for 10-15 h.

Transformation and identification: after the ligation reaction, the ligation product is transformed into host strain DH5 alpha for recombinant screening. The selected monoclonal colonies were subjected to amplification culture and plasmid extraction, followed by sequencing by Soujin Weizhi Biotechnology, Inc. to obtain a fusion recombinant vector pETSUMO-28 a.

And (3) secondary enzyme digestion and connection: carrying out BamHI/Xho1 double enzyme digestion treatment on an L1 gene fragment containing BamHI and Xho1 enzyme digestion sites and a recombinant vector pETSUMO-28a, and then carrying out a ligation reaction on the recovered gene fragment and pETSUMO-28a containing a corresponding cohesive end by using T4 DNA ligase at 16 ℃ for 10-15 h.

And (3) secondary transformation and identification: after the ligation reaction, the ligation product is transformed into host strain DH5 alpha for recombinant screening. And carrying out amplification culture on the screened monoclonal colonies, extracting plasmids, and sequencing by Shanghai bio-engineering company to obtain a gene sequence SEQ NO.7 of the fusion recombinant 6 His-SUMO-HPV52-L1 protein.

Example 7: expression of recombinant HPV L1 pentamer protein

The recombinant vectors of the correct sequencing results of the examples 2, 3, 4, 5 and 6 are transformed into an Escherichia coli BL21 host cell, and used as an engineering bacterium for expressing recombinant proteins to express HPV L1 proteins. The engineering bacteria culture medium is 2YT culture medium (10 g/L tryptone, 5 g/L yeast powder, 10 g/L NaCl). Single spots of the cells containing the recombinant plasmid were picked up in 10ml of 2YT medium (containing 100. mu.g/ml ampicillin), and cultured at 230 revolutions per minute (rpm) overnight at 37 ℃ with shaking. Transferring 5ml of overnight bacteria into 500 ml (containing 100 mu g/ml ampicillin) 2YT liquid culture medium, shaking and culturing at 37 ℃ until the recombinant engineering bacteria grow to OD600nm which is approximately equal to 0.4-1, adding IPTG with the final concentration of 0.2mM for induction and expression of recombinant protein for more than 6h at 28 ℃.

Cell collection and disruption: centrifuging the fermentation culture, discarding the supernatant, harvesting thallus precipitate, and weighing; the pellet was washed with buffer L (pH 8.0, 50mM Tris, 200 mM NaCl, 5mM DTT), then resuspended in buffer L for ultrasonication, followed by centrifugation of the lysate by a high speed centrifuge (16000 rpm, 30 min, 4 ℃) and the supernatant was collected.

Example 8: detection of expression quantity of recombinant HPV L1 pentamer protein in Escherichia coli

Detecting the expression quantity of the Tag-HPV L1 pentamer protein in escherichia coli before loading by adopting an ELISA sandwich method, and detecting a sample and a test sample:

coating antibody: self-made anti-HPV 52L 1 mouse monoclonal antibody.

Comparison products: high-purity HPV 52L 1 protein is prepared.

And (3) testing the sample: the test product Tag-HPV 52L 1 was diluted with the sample diluent to a concentration within the control gradient dilution range.

Enzyme-labeled antibody: the self-made horseradish peroxidase-labeled rabbit anti-HPV 52L 1 protein polyclonal antibody.

And (4) calculating a result: calculate the average of the parallel wells to control line concentration OD₅₂₀The absorption value is corresponding to L1 eggThe white antigen is used as a linear equation, the variation coefficient among parallel sample holes is not more than 10 percent, and a linear regression equation R²Not less than 0.980, OD of the sample₅₂₀The absorption value is substituted into an equation to calculate the content of the L1 protein antigen in the test sample after dilution, and the content of the L1 protein antigen in the test sample is obtained by multiplying the content by the corresponding dilution times, which is shown in Table 1.

Table 1 detection of antigen content of Tag-HPV L1 protein after expression

Example 9: recombinant HPV L1 pentamer protein affinity chromatography

Affinity chromatography of recombinant proteins with GST tag: the affinity column was filled with 5ml of GST agarose affinity chromatography medium, equilibrated with Buffer L (pH 8.0, 50mM Tris, 200 mM NaCl, 5mM DTT), and loaded with the protein solution of example 8 with GST or GST-SUMO tag, and washed with Buffer L until no protein was eluted, and the affinity was complete. The affinity medium was suspended in 5mL Buffer L and samples were taken for detection and calculation of the total amount of bound L1 protein in the medium.

Affinity chromatography of MBP-tagged recombinant proteins: the affinity column was loaded with 5ml of an Amylose-Resin affinity chromatography medium, equilibrated with Buffer L (pH 8.0, 50mM Tris, 200 mM NaCl, 5mM DTT), and loaded with the MBP-tagged protein solution of example 8, and washed with Buffer L until no protein eluted, and the affinity was complete. The affinity medium was suspended in 5mL Buffer L and samples were taken for detection and calculation of the total amount of bound L1 protein in the medium.

Affinity chromatography of recombinant proteins with 6 × HIS tag: 5ml of Ni-NTA gel was loaded on a column, and 10 column volumes of an equilibration solution (50 mmol/L NaH2PO4, 300mmol/L NaCl, 20mmol/L imidazole, pH adjusted to 8 with NaOH) were slowly added to the column to sufficiently equilibrate the Ni-NTA gel at a flow rate of 1 ml/min. The supernatant from example 8, which was filtered and labeled with 6 × His or 6 × His-SUMO, was taken and, after complete gel entry, the gel was washed with 10 column volumes of equilibration solution and stored at a flow rate of 1 ml/min. Eluting with the balance solution until no protein flows out, and finishing the affinity. Sampling was performed to detect and calculate the total amount of bound L1 protein in the medium.

Example 10: enzyme digestion purification of recombinant Tag-HPV L1 protein

According to the mass ratio of the target protein to the protease of 100: 1, adding enzyme amount, wherein the protein with GST-HPV-L1 is cut by 3C protein, the protein with GST-SUMO-HPV-L1 and 6 His-SUMO-HPV-L1 is cut by SENP1 protein, the protein with Mbp-HPV-L1 is cut by Factor Xa protein, the protein with 6 His-HPV-L1 is cut by Thrombin protein, and after 2h of mixed digestion, respectively eluting and collecting HPV 52L 1 pentamer protein solution obtained after each protease digestion.

The L1 protein solution after the 3C enzyme cuts the GST tag is detected by SDS-PAGE gel electrophoresis, the result is shown in figure 1 affinity chromatography electrophoresis result, and the experiment shows that 90% of the target protein can be cut off. FIG. 2 shows that SENP1 protease cleaves the protein with GST-SUMO-HPV-L1, which is detected by SDS-PAGE gel electrophoresis. FIG. 3 shows that Factor Xa protease cleaves proteins with Mbp-HPV-L1, as detected by SDS-PAGE gel electrophoresis. FIGS. 1-3 illustrate that the HPV 52L 1 protein of 55kDa is obtained.

The thrombobin protease did not cleave the 6 His-HPV-L1 protein; the protein solution from 6 His-SUMO-L1 digested with SENP1 was examined by SDS-PAGE gel electrophoresis, and the results are shown in FIG. 4, which shows that SENP1 protease cleaves the 6 His-SUMO-tagged fusion protein.

Example 11: purification of recombinant HPV L1 pentamer protein

And (3) purifying by molecular sieve chromatography: the HPV 52L 1 pentamer protein collected in the previous example after enzyme digestion and purification is respectively purified, the HPV 52L 1 pentamer protein collected by ion exchange chromatography can be firstly subjected to further molecular sieve chromatography by using gel filtration medium of Superdex200 (manufactured by GE company) without ion exchange step, the mobile phase of the molecular sieve is pH8.0, 10 mM Tris and 100 mM NaCl, and the fraction of the ultraviolet absorption peak of the HPV 52L 1 pentamer protein is collected.

Determination of sample purity after purification: and (3) sampling the collected protein solution, and detecting by SDS-PAGE gel electrophoresis, wherein the final purities of the pentamer of the target protein HPV 52L 1 are all more than 98% after molecular sieve chromatography, and the detailed picture is shown in FIG. 5, and the SDS-PAGE gel electrophoresis picture of the protein of the pentamer of the recombinant HPV 52L 1 after molecular sieve chromatography.

Determination of the protein concentration of the sample: protein concentration detection is carried out by a Bradford method, a standard sample of 2mg/ml BAS is used for preparing a BSA working solution which is diluted from 100 ug/mul to 500 ug/mul, and 10 mul of diluted BSA +200 mul Bradford working solution is taken in a sample reaction system: standard curve y = 0.0013 x-0.0294, R = 0.9986, OD of determination sample₅₉₅Substituting the standard curve to calculate the protein concentration of the sample, and the result is shown in Table 2.

TABLE 2 Bradford method for detecting recombinant HPV 52L 1 pentamer protein concentration

Note: the sample group 1 is an HPV L1 pentamer protein solution obtained by purifying GST-HPV L1 by a molecular sieve; the sample group 2 is an HPV L1 pentameric protein solution obtained by purifying GST-SUMO-HPV L1 through a molecular sieve; and the sample group 3 is an HPV L1 pentamer protein solution obtained by purifying the Mbp-HPV L1 by a molecular sieve.

Example 12: assembly of recombinant HPV 52L 1 pentamer proteins into VLPs

After being placed and stabilized in the following salt concentration (NaCl) and pH value conditions, HPV L1 pentamer solution sample groups 1, 2 and 3 are subjected to particle size and particle size distribution measurement (the particle size distribution coefficient PdI is an index of particle size dispersion degree, less than 0.05 is a highly uniform sample, 0.05-0.1 is a quasi-uniform sample, 0.1-0.3 is a sample with poor uniformity, and more than 0.3 is a non-uniform sample) by using a dynamic light scattering particle sizer of Malvern Zetasizer NanoZS, and the HPV 52L 1 pentamer protein is assembled to obtain VLPs with uniform particle sizes (PdI is less than 0.05).

Table 3 particle size detection of assembled HPV 52L 1 VLPs at different pH and salt concentrations

Note: the sample group 1 is a HPV L1VLP protein solution obtained by purifying GST-HPV L1 by a molecular sieve; the sample group 2 is an HPV L1VLP protein solution obtained by purifying GST-SUMO-HPV L1 through a molecular sieve; sample group 3 is an HPV L1VLP protein solution obtained by purifying Mbp-HPV L1 with a molecular sieve.

Example 13: dynamic Light Scattering (DLS) particle size determination of L1 pentamer and VLP proteins

The instrument is a dynamic light scattering particle size analyzer of a Malvern Zetasizer NanoZS, HPV 52L 1 pentamer and HPV 52L 1VLP protein finally prepared by each sample group are taken for detection, and the average particle size and the dispersity index PdI (indicating the uniformity of the protein) are measured, so that the uniformity of the L1 pentamer and the VLP protein finally prepared by each group of samples is indicated. The particle size distribution of the pentameric protein finally prepared in sample set 2 and the HPV 52L 1VLP protein obtained by the assembly thereof is shown in FIGS. 6 and 7.

Example 14: preparation of HPV 52L 1 pentamer and VLP

According to the technology adopted in the above embodiments 1-13, the HPV 52L 1 protein with the sequences 11, 12 and 13 is prepared, and the protein can be purified to obtain the protein with the purity of more than 98%, and the HPV 52L 1 pentamer protein with the average particle size of 10-15 nm and the PdI of less than 0.1 is obtained. Further assembling to obtain HPV 52L 1VLP protein with the average particle size of 52-65 nm and PdI < 0.1.

Example 15: morphological examination of HPV 52L 1 pentamer and VLP

And (3) observing by a transmission electron microscope: the HPV 52L 1 pentamer protein obtained by purification and the HPV 52L 1-VLP protein obtained by assembly in each example were observed by a transmission electron microscope platform used in the biophysics of the Chinese academy of sciences. Preparation of frozen sample and photographing process:

1) the liquid nitrogen box is filled with liquid nitrogen, and when the liquid level is not boiling, ethane is slowly injected into the cooled copper bowl to be cooled into liquid.

2) The copper mesh was hydrophilically treated in a PDC-32 type plasma cleaner.

3) In a Vitrobot TM Mark IV frozen sample preparation apparatus, 3.5. mu.L of a pentamer and VLP sample was adsorbed on a 300 mesh QUANTIFOIL copper mesh, and after absorbing water for 4s, the sample was frozen by liquid ethane.

4) The samples were quickly transferred to liquid nitrogen for storage.

5) When the frozen photographs were collected, the electron dose was 20 e-/A2. Data were recorded by a 300 kV Titan Krios transmission electron microscope Gatan [ mu ] ltraScan 4000 CCD. The acceleration voltage was 300 kV.

The results show that in the HPV 52L 1 pentameric protein sample group, a large number of pentameric proteins with the diameter of about 10nm, which is consistent with the theoretical size, are visible in the visual field; in the HPV 52L 1-VLP protein sample group, a large number of virus-like particles (VLPs) with a diameter of around 50nm, which are consistent in particle size with theory, were found, and were uniform. Wherein the transmission electron micrograph of the sample obtained by enzyme-cutting purified HPV 52L 1 pentamer of GST-SUMO label group (sample group 2) is shown in figure 8, and the transmission electron micrograph of the VLP protein assembled after enzyme-cutting purification of Mbp label group (sample group 3) is shown in figure 9.

Example 16: purity detection of HPV 52L 1 protein stock solution

Molecular exclusion high performance liquid chromatography assay: a chromatographic column Agilent Bio SEC-5um, 2000A, 7.8 multiplied by 300mm, the column volume is about 15m 1, and the molecular weight range is more than or equal to l0,000kDa; taking 0.1mol/L phosphate buffer solution (25.8 g of disodium hydrogen phosphate and 4.37g of sodium dihydrogen phosphate are weighed and dissolved by adding ultrapure water, adjusting the pH to 6.8 by using phosphoric acid, and fixing the volume to 1000ml by using the ultrapure water) with the pH of 6.8 as a mobile phase; the flow rate is 1 ml/min; the detection wavelength is 280 nm; the column temperature is 25 ℃, the sample loading amount is not less than 20ug, the theoretical plate number of the main peak of the sample is not less than 1000, the tailing factor is less than 2.0, 5 needles are continuously injected, and the relative standard deviation of the peak area is not more than 3%.

And (3) taking the protein stock solutions of the finally prepared HPV 52L 1 pentamer and the assembled VLP of the purified sample 2 group, respectively diluting the protein stock solutions to the concentration of 1mg/ml, injecting the protein stock solutions into a high pressure liquid chromatograph in the sample loading amount of 20 mu L, detecting according to the method, calculating the purity according to an area normalization method, wherein the purity of all the processed proteins is more than 98%, and the result is shown in an attached figure 10, a table 4, an attached figure 11 and a table 5.

TABLE 4 HPLC PROTEIN PURITY TESTING OF HPV 52L 1 PENTAMER

TABLE 5 HPLC PROTEIN PURITY TESTING OF HPV 52L 1 ASSEMBLED VLPs

Example 17: HPV VLP stability assay

The HPV52 VLP protein finally prepared from each sample group is placed at 25 ℃ for 14 days to 28 days under the buffer conditions of the following table for particle size detection, and the results are shown in the following table, which proves that the HPV52 VLP is stable in storage at pH 5.0 to 5.9 and salt concentration of 500-2000 mM. The detection results of HPV52 VLPs obtained in sample group 3 after 14-28 days at pH 5.0 to 5.9 and at a salt concentration of 500-2000 mM are shown in the following table.

TABLE 6 detection results of particle size of HPV 52L 1VLP after standing at 25 ℃ for 14-28 days

Example 18: preparation of monovalent vaccines comprising HPV L1 pentamer or VLP

The HPV 52L 1 pentamer or VLP protein stock containing each sample set was mixed with an aluminum hydroxide adjuvant physiological saline solution according to the protein and aluminum content 1: adsorbing at a ratio of 10 to prepare the recombinant HPV L1 protein pentamer or VLP vaccine, and storing at 4 ℃ for later use.

Example 19: immunogenicity assays for HPV L1 pentamers and VLPs

The L1 pentamer or VLP vaccine was taken, and sterilized saline was added to dilute the vaccine into a 20. mu.g/ml concentration of the pentamer or VLP protein vaccine, respectively, and BALB/c mice were injected intramuscularly at 0.1ml per one mouse, 10 per group. Mice were boosted every 4 weeks for 2 total immunizations. After 4 weeks of boosting, neutralizing antibody titers against homotype HPV were determined in the sera of mice after each immunization using a pseudovirus cell neutralization assay, respectively, and the results are shown in fig. 12 and 13.

The results show that the neutralizing antibody can reach a high level 4 weeks after the secondary immunization when the HPV L1 pentamer and VLP protein vaccine is used for inoculating the mice. The experimental result proves that the HPV L1 pentamer and the assembled VLP vaccine can generate neutralizing antibodies in animals, which indicates that the HPV L1 pentamer and the VLP protein vaccine have immunogenicity in human clinical tests, namely, the diseases caused by HPV homotype viruses can be prevented.

SEQUENCE LISTING

<110> Beijing Kangle guard Biotechnology Ltd

<120> 52 type recombinant human papilloma virus-like particle and preparation method thereof

<130> 2015

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 1512

<212> DNA

<213> Artificial sequence

<400> 1

atgtccgtgt ggcggcctag tgaggccact gtgtacctgc ctcctgtacc tgtctctaag 60

gttgtaagca ctgatgagta tgtgtctcgc acaagcatct attattatgc aggcagttct 120

cgattactaa cagtaggaca tccctatttt tctattaaaa acaccagtag tggtaatggt 180

aaaaaagttt tagttcccaa ggtgtctggc ctgcaataca gggtatttag aattaaattg 240

ccggacccta ataaatttgg ttttccagat acatcttttt ataacccaga aacccaaagg 300

ttggtgtggg cctgtacagg cttggaaatt ggtaggggac agcctttagg tgtgggtatt 360

agtgggcatc ctttattaaa caagtttgat gatactgaaa ccagtaacaa atatgctggt 420

aaacctggta tagataatag ggaatgttta tctatggatt ataagcagac tcagttatgc 480

attttaggat gcaaacctcc tataggtgaa cattggggta agggaacccc ttgtaataat 540

aattcaggaa atcctgggga ttgtcctccc ctacagctca ttaacagtgt aatacaggat 600

ggggacatgg tagatacagg atttggttgc atggatttta ataccttgca agctagtaaa 660

agtgatgtgc ccattgatat atgtagcagt gtatgtaagt atccagatta tttgcaaatg 720

gctagcgagc catatggtga cagtttgttc ttttttctta gacgtgagca aatgtttgtt 780

agacactttt ttaatagggc cggtacctta ggtgaccctg tgccaggtga tttatatata 840

caagggtcta actctggcaa tactgccact gtacaaagca gtgctttttt tcctactcct 900

agtggttcta tggtaacctc agaatcccaa ttatttaata aaccgtactg gttacaacgt 960

gcgcagggcc acaataatgg catatgttgg ggcaatcagt tgtttgtcac agttgtggat 1020

accactcgta gcactaacat gactttatgt gctgaggtta aaaaggaaag cacatataaa 1080

aatgaaaatt ttaaggaata ccttcgtcat ggcgaggaat ttgatttaca atttattttt 1140

caattgtgca aaattacatt aacagctgat gttatgacat acattcataa gatggatgcc 1200

actattttag aggactggca atttggcctt accccaccac cgtctgcatc tttggaggac 1260

acatacagat ttgtcacttc tactgctata acttgtcaaa aaaacacacc acctaaagga 1320

aaggaagatc ctttaaagga ctatatgttt tgggaggtgg atttaaaaga aaagttttct 1380

gcagatttag atcagtttcc tttaggtagg aagtttttgt tacaggcagg gctacaggct 1440

aggcccaaac taaaacgccc tgcatcatcg gccccacgta cctccacaaa gaagaaaaag 1500

gttaaaaggt aa 1512

<210> 2

<211> 1512

<212> DNA

<213> Artificial sequence

<400> 2

atgtctgttt ggcgtccgtc tgaagctacc gtttacctgc cgccggttcc ggtttctaaa 60

gttgtttcta ccgacgaata cgtttctcgt acctctatct actactacgc tggttcttct 120

cgtctgctga ccgttggtca cccgtacttc tctatcaaaa acacctcttc tggtaacggt 180

aaaaaagttc tggttccgaa agtttctggt ctgcagtacc gtgttttccg tatcaaactg 240

ccggacccga acaaattcgg tttcccggac acctctttct acaacccgga aacccagcgt 300

ctggtttggg cttgcaccgg tctggaaatc ggtcgtggtc agccgctggg tgttggtatc 360

tctggtcacc cgctgctgaa caaattcgac gacaccgaaa cctctaacaa atacgctggt 420

aaaccgggta tcgacaaccg tgaatgcctg tctatggact acaaacagac ccagctgtgc 480

atcctgggtt gcaaaccgcc gatcggtgaa cactggggta aaggtacccc gtgcaacaac 540

aactctggta acccgggtga ctgcccgccg ctgcagctga tcaactctgt tatccaggac 600

ggtgacatgg ttgacaccgg tttcggttgc atggacttca acaccctgca ggcttctaaa 660

tctgacgttc cgatcgacat ctgctcttct gtttgcaaat acccggacta cctgcagatg 720

gcttctgaac cgtacggtga ctctctgttc ttcttcctgc gtcgtgaaca gatgttcgtt 780

cgtcacttct tcaaccgtgc tggtaccctg ggtgacccgg ttccgggtga cctgtacatc 840

cagggttcta actctggtaa caccgctacc gttcagtctt ctgctttctt cccgaccccg 900

tctggttcta tggttacctc tgaatctcag ctgttcaaca aaccgtactg gctgcagcgt 960

gctcagggtc acaacaacgg tatctgctgg ggtaaccagc tgttcgttac cgttgttgac 1020

accacccgtt ctaccaacat gaccctgtgc gctgaagtta aaaaagaatc tacctacaaa 1080

aacgaaaact tcaaagaata cctgcgtcac ggtgaagaat tcgacctgca gttcatcttc 1140

cagctgtgca aaatcaccct gaccgctgac gttatgacct acatccacaa aatggacgct 1200

accatcctgg aagactggca gttcggtctg accccgccgc cgtctgcttc tctggaagac 1260

acctaccgtt tcgttacctc taccgctatc acctgccaga aaaacacccc gccgaaaggt 1320

aaagaagacc cgctgaaaga ctacatgttc tgggaagttg acctgaaaga aaaattctct 1380

gctgacctgg accagttccc gctgggtcgt aaattcctgc tgcaggctgg tctgcaggct 1440

cgtccgaaac tgaaacgtcc ggcttcttct gctccgcgta cctctaccaa aaaaaaaaaa 1500

gttaaacgtt ag 1512

<210> 3

<211> 2205

<212> DNA

<213> Artificial sequence

<400> 3

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gcccctggga tccatgtctg tttggcgtcc gtctgaagct 720

accgtttacc tgccgccggt tccggtttct aaagttgttt ctaccgacga atacgtttct 780

cgtacctcta tctactacta cgctggttct tctcgtctgc tgaccgttgg tcacccgtac 840

ttctctatca aaaacacctc ttctggtaac ggtaaaaaag ttctggttcc gaaagtttct 900

ggtctgcagt accgtgtttt ccgtatcaaa ctgccggacc cgaacaaatt cggtttcccg 960

gacacctctt tctacaaccc ggaaacccag cgtctggttt gggcttgcac cggtctggaa 1020

atcggtcgtg gtcagccgct gggtgttggt atctctggtc acccgctgct gaacaaattc 1080

gacgacaccg aaacctctaa caaatacgct ggtaaaccgg gtatcgacaa ccgtgaatgc 1140

ctgtctatgg actacaaaca gacccagctg tgcatcctgg gttgcaaacc gccgatcggt 1200

gaacactggg gtaaaggtac cccgtgcaac aacaactctg gtaacccggg tgactgcccg 1260

ccgctgcagc tgatcaactc tgttatccag gacggtgaca tggttgacac cggtttcggt 1320

tgcatggact tcaacaccct gcaggcttct aaatctgacg ttccgatcga catctgctct 1380

tctgtttgca aatacccgga ctacctgcag atggcttctg aaccgtacgg tgactctctg 1440

ttcttcttcc tgcgtcgtga acagatgttc gttcgtcact tcttcaaccg tgctggtacc 1500

ctgggtgacc cggttccggg tgacctgtac atccagggtt ctaactctgg taacaccgct 1560

accgttcagt cttctgcttt cttcccgacc ccgtctggtt ctatggttac ctctgaatct 1620

cagctgttca acaaaccgta ctggctgcag cgtgctcagg gtcacaacaa cggtatctgc 1680

tggggtaacc agctgttcgt taccgttgtt gacaccaccc gttctaccaa catgaccctg 1740

tgcgctgaag ttaaaaaaga atctacctac aaaaacgaaa acttcaaaga atacctgcgt 1800

cacggtgaag aattcgacct gcagttcatc ttccagctgt gcaaaatcac cctgaccgct 1860

gacgttatga cctacatcca caaaatggac gctaccatcc tggaagactg gcagttcggt 1920

ctgaccccgc cgccgtctgc ttctctggaa gacacctacc gtttcgttac ctctaccgct 1980

atcacctgcc agaaaaacac cccgccgaaa ggtaaagaag acccgctgaa agactacatg 2040

ttctgggaag ttgacctgaa agaaaaattc tctgctgacc tggaccagtt cccgctgggt 2100

cgtaaattcc tgctgcaggc tggtctgcag gctcgtccga aactgaaacg tccggcttct 2160

tctgctccgc gtacctctac caaaaaaaaa aaagttaaac gttag 2205

<210> 4

<211> 2487

<212> DNA

<213> Artificial sequence

<400> 4

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720

ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780

atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840

cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900

aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960

cagaccggtg gatccatgtc tgtttggcgt ccgtctgaag ctaccgttta cctgccgccg 1020

gttccggttt ctaaagttgt ttctaccgac gaatacgttt ctcgtacctc tatctactac 1080

tacgctggtt cttctcgtct gctgaccgtt ggtcacccgt acttctctat caaaaacacc 1140

tcttctggta acggtaaaaa agttctggtt ccgaaagttt ctggtctgca gtaccgtgtt 1200

ttccgtatca aactgccgga cccgaacaaa ttcggtttcc cggacacctc tttctacaac 1260

ccggaaaccc agcgtctggt ttgggcttgc accggtctgg aaatcggtcg tggtcagccg 1320

ctgggtgttg gtatctctgg tcacccgctg ctgaacaaat tcgacgacac cgaaacctct 1380

aacaaatacg ctggtaaacc gggtatcgac aaccgtgaat gcctgtctat ggactacaaa 1440

cagacccagc tgtgcatcct gggttgcaaa ccgccgatcg gtgaacactg gggtaaaggt 1500

accccgtgca acaacaactc tggtaacccg ggtgactgcc cgccgctgca gctgatcaac 1560

tctgttatcc aggacggtga catggttgac accggtttcg gttgcatgga cttcaacacc 1620

ctgcaggctt ctaaatctga cgttccgatc gacatctgct cttctgtttg caaatacccg 1680

gactacctgc agatggcttc tgaaccgtac ggtgactctc tgttcttctt cctgcgtcgt 1740

gaacagatgt tcgttcgtca cttcttcaac cgtgctggta ccctgggtga cccggttccg 1800

ggtgacctgt acatccaggg ttctaactct ggtaacaccg ctaccgttca gtcttctgct 1860

ttcttcccga ccccgtctgg ttctatggtt acctctgaat ctcagctgtt caacaaaccg 1920

tactggctgc agcgtgctca gggtcacaac aacggtatct gctggggtaa ccagctgttc 1980

gttaccgttg ttgacaccac ccgttctacc aacatgaccc tgtgcgctga agttaaaaaa 2040

gaatctacct acaaaaacga aaacttcaaa gaatacctgc gtcacggtga agaattcgac 2100

ctgcagttca tcttccagct gtgcaaaatc accctgaccg ctgacgttat gacctacatc 2160

cacaaaatgg acgctaccat cctggaagac tggcagttcg gtctgacccc gccgccgtct 2220

gcttctctgg aagacaccta ccgtttcgtt acctctaccg ctatcacctg ccagaaaaac 2280

accccgccga aaggtaaaga agacccgctg aaagactaca tgttctggga agttgacctg 2340

aaagaaaaat tctctgctga cctggaccag ttcccgctgg gtcgtaaatt cctgctgcag 2400

gctggtctgc aggctcgtcc gaaactgaaa cgtccggctt cttctgctcc gcgtacctct 2460

accaaaaaaa aaaaagttaa acgttag 2487

<210> 5

<211> 2685

<212> DNA

<213> Artificial sequence

<400> 5

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcagaa ttcatgtctg tttggcgtcc gtctgaagct 1200

accgtttacc tgccgccggt tccggtttct aaagttgttt ctaccgacga atacgtttct 1260

cgtacctcta tctactacta cgctggttct tctcgtctgc tgaccgttgg tcacccgtac 1320

ttctctatca aaaacacctc ttctggtaac ggtaaaaaag ttctggttcc gaaagtttct 1380

ggtctgcagt accgtgtttt ccgtatcaaa ctgccggacc cgaacaaatt cggtttcccg 1440

gacacctctt tctacaaccc ggaaacccag cgtctggttt gggcttgcac cggtctggaa 1500

atcggtcgtg gtcagccgct gggtgttggt atctctggtc acccgctgct gaacaaattc 1560

gacgacaccg aaacctctaa caaatacgct ggtaaaccgg gtatcgacaa ccgtgaatgc 1620

ctgtctatgg actacaaaca gacccagctg tgcatcctgg gttgcaaacc gccgatcggt 1680

gaacactggg gtaaaggtac cccgtgcaac aacaactctg gtaacccggg tgactgcccg 1740

ccgctgcagc tgatcaactc tgttatccag gacggtgaca tggttgacac cggtttcggt 1800

tgcatggact tcaacaccct gcaggcttct aaatctgacg ttccgatcga catctgctct 1860

tctgtttgca aatacccgga ctacctgcag atggcttctg aaccgtacgg tgactctctg 1920

ttcttcttcc tgcgtcgtga acagatgttc gttcgtcact tcttcaaccg tgctggtacc 1980

ctgggtgacc cggttccggg tgacctgtac atccagggtt ctaactctgg taacaccgct 2040

accgttcagt cttctgcttt cttcccgacc ccgtctggtt ctatggttac ctctgaatct 2100

cagctgttca acaaaccgta ctggctgcag cgtgctcagg gtcacaacaa cggtatctgc 2160

tggggtaacc agctgttcgt taccgttgtt gacaccaccc gttctaccaa catgaccctg 2220

tgcgctgaag ttaaaaaaga atctacctac aaaaacgaaa acttcaaaga atacctgcgt 2280

cacggtgaag aattcgacct gcagttcatc ttccagctgt gcaaaatcac cctgaccgct 2340

gacgttatga cctacatcca caaaatggac gctaccatcc tggaagactg gcagttcggt 2400

ctgaccccgc cgccgtctgc ttctctggaa gacacctacc gtttcgttac ctctaccgct 2460

atcacctgcc agaaaaacac cccgccgaaa ggtaaagaag acccgctgaa agactacatg 2520

ttctgggaag ttgacctgaa agaaaaattc tctgctgacc tggaccagtt cccgctgggt 2580

cgtaaattcc tgctgcaggc tggtctgcag gctcgtccga aactgaaacg tccggcttct 2640

tctgctccgc gtacctctac caaaaaaaaa aaagttaaac gttag 2685

<210> 6

<211> 1575

<212> DNA

<213> Artificial sequence

<400> 6

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atgatgtctg tttggcgtcc gtctgaagct accgtttacc tgccgccggt tccggtttct 120

aaagttgttt ctaccgacga atacgtttct cgtacctcta tctactacta cgctggttct 180

tctcgtctgc tgaccgttgg tcacccgtac ttctctatca aaaacacctc ttctggtaac 240

ggtaaaaaag ttctggttcc gaaagtttct ggtctgcagt accgtgtttt ccgtatcaaa 300

ctgccggacc cgaacaaatt cggtttcccg gacacctctt tctacaaccc ggaaacccag 360

cgtctggttt gggcttgcac cggtctggaa atcggtcgtg gtcagccgct gggtgttggt 420

atctctggtc acccgctgct gaacaaattc gacgacaccg aaacctctaa caaatacgct 480

ggtaaaccgg gtatcgacaa ccgtgaatgc ctgtctatgg actacaaaca gacccagctg 540

tgcatcctgg gttgcaaacc gccgatcggt gaacactggg gtaaaggtac cccgtgcaac 600

aacaactctg gtaacccggg tgactgcccg ccgctgcagc tgatcaactc tgttatccag 660

gacggtgaca tggttgacac cggtttcggt tgcatggact tcaacaccct gcaggcttct 720

aaatctgacg ttccgatcga catctgctct tctgtttgca aatacccgga ctacctgcag 780

atggcttctg aaccgtacgg tgactctctg ttcttcttcc tgcgtcgtga acagatgttc 840

gttcgtcact tcttcaaccg tgctggtacc ctgggtgacc cggttccggg tgacctgtac 900

atccagggtt ctaactctgg taacaccgct accgttcagt cttctgcttt cttcccgacc 960

ccgtctggtt ctatggttac ctctgaatct cagctgttca acaaaccgta ctggctgcag 1020

cgtgctcagg gtcacaacaa cggtatctgc tggggtaacc agctgttcgt taccgttgtt 1080

gacaccaccc gttctaccaa catgaccctg tgcgctgaag ttaaaaaaga atctacctac 1140

aaaaacgaaa acttcaaaga atacctgcgt cacggtgaag aattcgacct gcagttcatc 1200

ttccagctgt gcaaaatcac cctgaccgct gacgttatga cctacatcca caaaatggac 1260

gctaccatcc tggaagactg gcagttcggt ctgaccccgc cgccgtctgc ttctctggaa 1320

gacacctacc gtttcgttac ctctaccgct atcacctgcc agaaaaacac cccgccgaaa 1380

ggtaaagaag acccgctgaa agactacatg ttctgggaag ttgacctgaa agaaaaattc 1440

tctgctgacc tggaccagtt cccgctgggt cgtaaattcc tgctgcaggc tggtctgcag 1500

gctcgtccga aactgaaacg tccggcttct tctgctccgc gtacctctac caaaaaaaaa 1560

aaagttaaac gttag 1575

<210> 7

<211> 1866

<212> DNA

<213> Artificial sequence

<400> 7

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atgtctgacc aggaagctaa accgtctacc gaagacctgg gtgacaaaaa agaaggtgaa 120

tacatcaaac tgaaagttat cggtcaggac tcttctgaaa tccacttcaa agttaaaatg 180

accacccacc tgaaaaaact gaaagaatct tactgccagc gtcagggtgt tccgatgaac 240

tctctgcgtt tcctgttcga aggtcagcgt atcgctgaca accacacccc gaaagaactg 300

ggtatggaag aagaagacgt tatcgaagtt taccaggaac agaccggtgg atccatgtct 360

gtttggcgtc cgtctgaagc taccgtttac ctgccgccgg ttccggtttc taaagttgtt 420

tctaccgacg aatacgtttc tcgtacctct atctactact acgctggttc ttctcgtctg 480

ctgaccgttg gtcacccgta cttctctatc aaaaacacct cttctggtaa cggtaaaaaa 540

gttctggttc cgaaagtttc tggtctgcag taccgtgttt tccgtatcaa actgccggac 600

ccgaacaaat tcggtttccc ggacacctct ttctacaacc cggaaaccca gcgtctggtt 660

tgggcttgca ccggtctgga aatcggtcgt ggtcagccgc tgggtgttgg tatctctggt 720

cacccgctgc tgaacaaatt cgacgacacc gaaacctcta acaaatacgc tggtaaaccg 780

ggtatcgaca accgtgaatg cctgtctatg gactacaaac agacccagct gtgcatcctg 840

ggttgcaaac cgccgatcgg tgaacactgg ggtaaaggta ccccgtgcaa caacaactct 900

ggtaacccgg gtgactgccc gccgctgcag ctgatcaact ctgttatcca ggacggtgac 960

atggttgaca ccggtttcgg ttgcatggac ttcaacaccc tgcaggcttc taaatctgac 1020

gttccgatcg acatctgctc ttctgtttgc aaatacccgg actacctgca gatggcttct 1080

gaaccgtacg gtgactctct gttcttcttc ctgcgtcgtg aacagatgtt cgttcgtcac 1140

ttcttcaacc gtgctggtac cctgggtgac ccggttccgg gtgacctgta catccagggt 1200

tctaactctg gtaacaccgc taccgttcag tcttctgctt tcttcccgac cccgtctggt 1260

tctatggtta cctctgaatc tcagctgttc aacaaaccgt actggctgca gcgtgctcag 1320

ggtcacaaca acggtatctg ctggggtaac cagctgttcg ttaccgttgt tgacaccacc 1380

cgttctacca acatgaccct gtgcgctgaa gttaaaaaag aatctaccta caaaaacgaa 1440

aacttcaaag aatacctgcg tcacggtgaa gaattcgacc tgcagttcat cttccagctg 1500

tgcaaaatca ccctgaccgc tgacgttatg acctacatcc acaaaatgga cgctaccatc 1560

ctggaagact ggcagttcgg tctgaccccg ccgccgtctg cttctctgga agacacctac 1620

cgtttcgtta cctctaccgc tatcacctgc cagaaaaaca ccccgccgaa aggtaaagaa 1680

gacccgctga aagactacat gttctgggaa gttgacctga aagaaaaatt ctctgctgac 1740

ctggaccagt tcccgctggg tcgtaaattc ctgctgcagg ctggtctgca ggctcgtccg 1800

aaactgaaac gtccggcttc ttctgctccg cgtacctcta ccaaaaaaaa aaaagttaaa 1860

cgttag 1866

<210> 8

<211> 734

<212> PRT

<213> Artificial sequence

<400> 8

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro

1 5 10 15

Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu

20 25 30

Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu

35 40 45

Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys

50 55 60

Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn

65 70 75 80

Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu

85 90 95

Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser

100 105 110

Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu

115 120 125

Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn

130 135 140

Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp

145 150 155 160

Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu

165 170 175

Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr

180 185 190

Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala

195 200 205

Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu

210 215 220

Phe Gln Gly Pro Leu Gly Ser Met Ser Val Trp Arg Pro Ser Glu Ala

225 230 235 240

Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp

245 250 255

Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg

260 265 270

Leu Leu Thr Val Gly His Pro Tyr Phe Ser Ile Lys Asn Thr Ser Ser

275 280 285

Gly Asn Gly Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr

290 295 300

Arg Val Phe Arg Ile Lys Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro

305 310 315 320

Asp Thr Ser Phe Tyr Asn Pro Glu Thr Gln Arg Leu Val Trp Ala Cys

325 330 335

Thr Gly Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser

340 345 350

Gly His Pro Leu Leu Asn Lys Phe Asp Asp Thr Glu Thr Ser Asn Lys

355 360 365

Tyr Ala Gly Lys Pro Gly Ile Asp Asn Arg Glu Cys Leu Ser Met Asp

370 375 380

Tyr Lys Gln Thr Gln Leu Cys Ile Leu Gly Cys Lys Pro Pro Ile Gly

385 390 395 400

Glu His Trp Gly Lys Gly Thr Pro Cys Asn Asn Asn Ser Gly Asn Pro

405 410 415

Gly Asp Cys Pro Pro Leu Gln Leu Ile Asn Ser Val Ile Gln Asp Gly

420 425 430

Asp Met Val Asp Thr Gly Phe Gly Cys Met Asp Phe Asn Thr Leu Gln

435 440 445

Ala Ser Lys Ser Asp Val Pro Ile Asp Ile Cys Ser Ser Val Cys Lys

450 455 460

Tyr Pro Asp Tyr Leu Gln Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu

465 470 475 480

Phe Phe Phe Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn

485 490 495

Arg Ala Gly Thr Leu Gly Asp Pro Val Pro Gly Asp Leu Tyr Ile Gln

500 505 510

Gly Ser Asn Ser Gly Asn Thr Ala Thr Val Gln Ser Ser Ala Phe Phe

515 520 525

Pro Thr Pro Ser Gly Ser Met Val Thr Ser Glu Ser Gln Leu Phe Asn

530 535 540

Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys

545 550 555 560

Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr

565 570 575

Asn Met Thr Leu Cys Ala Glu Val Lys Lys Glu Ser Thr Tyr Lys Asn

580 585 590

Glu Asn Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Phe Asp Leu Gln

595 600 605

Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val Met Thr

610 615 620

Tyr Ile His Lys Met Asp Ala Thr Ile Leu Glu Asp Trp Gln Phe Gly

625 630 635 640

Leu Thr Pro Pro Pro Ser Ala Ser Leu Glu Asp Thr Tyr Arg Phe Val

645 650 655

Thr Ser Thr Ala Ile Thr Cys Gln Lys Asn Thr Pro Pro Lys Gly Lys

660 665 670

Glu Asp Pro Leu Lys Asp Tyr Met Phe Trp Glu Val Asp Leu Lys Glu

675 680 685

Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu

690 695 700

Leu Gln Ala Gly Leu Gln Ala Arg Pro Lys Leu Lys Arg Pro Ala Ser

705 710 715 720

Ser Ala Pro Arg Thr Ser Thr Lys Lys Lys Lys Val Lys Arg

725 730

<210> 9

<211> 828

<212> PRT

<213> Artificial sequence

<400> 9

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro

1 5 10 15

Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu

20 25 30

Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu

35 40 45

Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys

50 55 60

Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn

65 70 75 80

Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu

85 90 95

Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser

100 105 110

Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu

115 120 125

Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn

130 135 140

Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp

145 150 155 160

Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu

165 170 175

Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr

180 185 190

Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala

195 200 205

Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu

210 215 220

Phe Gln Gly Pro Ser Asp Gln Glu Ala Lys Pro Ser Thr Glu Asp Leu

225 230 235 240

Gly Asp Lys Lys Glu Gly Glu Tyr Ile Lys Leu Lys Val Ile Gly Gln

245 250 255

Asp Ser Ser Glu Ile His Phe Lys Val Lys Met Thr Thr His Leu Lys

260 265 270

Lys Leu Lys Glu Ser Tyr Cys Gln Arg Gln Gly Val Pro Met Asn Ser

275 280 285

Leu Arg Phe Leu Phe Glu Gly Gln Arg Ile Ala Asp Asn His Thr Pro

290 295 300

Lys Glu Leu Gly Met Glu Glu Glu Asp Val Ile Glu Val Tyr Gln Glu

305 310 315 320

Gln Thr Gly Gly Ser Met Ser Val Trp Arg Pro Ser Glu Ala Thr Val

325 330 335

Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr

340 345 350

Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg Leu Leu

355 360 365

Thr Val Gly His Pro Tyr Phe Ser Ile Lys Asn Thr Ser Ser Gly Asn

370 375 380

Gly Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr Arg Val

385 390 395 400

Phe Arg Ile Lys Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro Asp Thr

405 410 415

Ser Phe Tyr Asn Pro Glu Thr Gln Arg Leu Val Trp Ala Cys Thr Gly

420 425 430

Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser Gly His

435 440 445

Pro Leu Leu Asn Lys Phe Asp Asp Thr Glu Thr Ser Asn Lys Tyr Ala

450 455 460

Gly Lys Pro Gly Ile Asp Asn Arg Glu Cys Leu Ser Met Asp Tyr Lys

465 470 475 480

Gln Thr Gln Leu Cys Ile Leu Gly Cys Lys Pro Pro Ile Gly Glu His

485 490 495

Trp Gly Lys Gly Thr Pro Cys Asn Asn Asn Ser Gly Asn Pro Gly Asp

500 505 510

Cys Pro Pro Leu Gln Leu Ile Asn Ser Val Ile Gln Asp Gly Asp Met

515 520 525

Val Asp Thr Gly Phe Gly Cys Met Asp Phe Asn Thr Leu Gln Ala Ser

530 535 540

Lys Ser Asp Val Pro Ile Asp Ile Cys Ser Ser Val Cys Lys Tyr Pro

545 550 555 560

Asp Tyr Leu Gln Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu Phe Phe

565 570 575

Phe Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn Arg Ala

580 585 590

Gly Thr Leu Gly Asp Pro Val Pro Gly Asp Leu Tyr Ile Gln Gly Ser

595 600 605

Asn Ser Gly Asn Thr Ala Thr Val Gln Ser Ser Ala Phe Phe Pro Thr

610 615 620

Pro Ser Gly Ser Met Val Thr Ser Glu Ser Gln Leu Phe Asn Lys Pro

625 630 635 640

Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly

645 650 655

Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met

660 665 670

Thr Leu Cys Ala Glu Val Lys Lys Glu Ser Thr Tyr Lys Asn Glu Asn

675 680 685

Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Phe Asp Leu Gln Phe Ile

690 695 700

Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val Met Thr Tyr Ile

705 710 715 720

His Lys Met Asp Ala Thr Ile Leu Glu Asp Trp Gln Phe Gly Leu Thr

725 730 735

Pro Pro Pro Ser Ala Ser Leu Glu Asp Thr Tyr Arg Phe Val Thr Ser

740 745 750

Thr Ala Ile Thr Cys Gln Lys Asn Thr Pro Pro Lys Gly Lys Glu Asp

755 760 765

Pro Leu Lys Asp Tyr Met Phe Trp Glu Val Asp Leu Lys Glu Lys Phe

770 775 780

Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu Gln

785 790 795 800

Ala Gly Leu Gln Ala Arg Pro Lys Leu Lys Arg Pro Ala Ser Ser Ala

805 810 815

Pro Arg Thr Ser Thr Lys Lys Lys Lys Val Lys Arg

820 825

<210> 10

<211> 894

<212> PRT

<213> Artificial sequence

<400> 10

Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys

1 5 10 15

Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr

20 25 30

Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe

35 40 45

Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala

50 55 60

His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile

65 70 75 80

Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp

85 90 95

Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu

100 105 110

Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys

115 120 125

Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly

130 135 140

Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro

145 150 155 160

Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys

165 170 175

Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly

180 185 190

Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp

195 200 205

Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala

210 215 220

Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys

225 230 235 240

Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser

245 250 255

Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro

260 265 270

Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp

275 280 285

Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala

290 295 300

Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala

305 310 315 320

Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln

325 330 335

Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala

340 345 350

Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn

355 360 365

Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile

370 375 380

Glu Gly Arg Ile Ser Glu Phe Met Ser Val Trp Arg Pro Ser Glu Ala

385 390 395 400

Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val Ser Thr Asp

405 410 415

Glu Tyr Val Ser Arg Thr Ser Ile Tyr Tyr Tyr Ala Gly Ser Ser Arg

420 425 430

Leu Leu Thr Val Gly His Pro Tyr Phe Ser Ile Lys Asn Thr Ser Ser

435 440 445

Gly Asn Gly Lys Lys Val Leu Val Pro Lys Val Ser Gly Leu Gln Tyr

450 455 460

Arg Val Phe Arg Ile Lys Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro

465 470 475 480

Asp Thr Ser Phe Tyr Asn Pro Glu Thr Gln Arg Leu Val Trp Ala Cys

485 490 495

Thr Gly Leu Glu Ile Gly Arg Gly Gln Pro Leu Gly Val Gly Ile Ser

500 505 510

Gly His Pro Leu Leu Asn Lys Phe Asp Asp Thr Glu Thr Ser Asn Lys

515 520 525

Tyr Ala Gly Lys Pro Gly Ile Asp Asn Arg Glu Cys Leu Ser Met Asp

530 535 540

Tyr Lys Gln Thr Gln Leu Cys Ile Leu Gly Cys Lys Pro Pro Ile Gly

545 550 555 560

Glu His Trp Gly Lys Gly Thr Pro Cys Asn Asn Asn Ser Gly Asn Pro

565 570 575

Gly Asp Cys Pro Pro Leu Gln Leu Ile Asn Ser Val Ile Gln Asp Gly

580 585 590

Asp Met Val Asp Thr Gly Phe Gly Cys Met Asp Phe Asn Thr Leu Gln

595 600 605

Ala Ser Lys Ser Asp Val Pro Ile Asp Ile Cys Ser Ser Val Cys Lys

610 615 620

Tyr Pro Asp Tyr Leu Gln Met Ala Ser Glu Pro Tyr Gly Asp Ser Leu

625 630 635 640

Phe Phe Phe Leu Arg Arg Glu Gln Met Phe Val Arg His Phe Phe Asn

645 650 655

Arg Ala Gly Thr Leu Gly Asp Pro Val Pro Gly Asp Leu Tyr Ile Gln

660 665 670

Gly Ser Asn Ser Gly Asn Thr Ala Thr Val Gln Ser Ser Ala Phe Phe

675 680 685

Pro Thr Pro Ser Gly Ser Met Val Thr Ser Glu Ser Gln Leu Phe Asn

690 695 700

Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys

705 710 715 720

Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr

725 730 735

Asn Met Thr Leu Cys Ala Glu Val Lys Lys Glu Ser Thr Tyr Lys Asn

740 745 750

Glu Asn Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Phe Asp Leu Gln

755 760 765

Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val Met Thr

770 775 780

Tyr Ile His Lys Met Asp Ala Thr Ile Leu Glu Asp Trp Gln Phe Gly

785 790 795 800

Leu Thr Pro Pro Pro Ser Ala Ser Leu Glu Asp Thr Tyr Arg Phe Val

805 810 815

Thr Ser Thr Ala Ile Thr Cys Gln Lys Asn Thr Pro Pro Lys Gly Lys

820 825 830

Glu Asp Pro Leu Lys Asp Tyr Met Phe Trp Glu Val Asp Leu Lys Glu

835 840 845

Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu

850 855 860

Leu Gln Ala Gly Leu Gln Ala Arg Pro Lys Leu Lys Arg Pro Ala Ser

865 870 875 880

Ser Ala Pro Arg Thr Ser Thr Lys Lys Lys Lys Val Lys Arg

885 890

<210> 11

<211> 2109

<212> DNA

<213> Artificial sequence

<400> 11

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gccctctgaa gctaccgttt acctgccgcc ggttccggtt 720

tctaaagttg tttctaccga cgaatacgtt tctcgtacct ctatctacta ctacgctggt 780

tcttctcgtc tgctgaccgt tggtcacccg tacttctcta tcaaaaacac ctcttctggt 840

aacggtaaaa aagttctggt tccgaaagtt tctggtctgc agtaccgtgt tttccgtatc 900

aaactgccgg acccgaacaa attcggtttc ccggacacct ctttctacaa cccggaaacc 960

cagcgtctgg tttgggcttg caccggtctg gaaatcggtc gtggtcagcc gctgggtgtt 1020

ggtatctctg gtcacccgct gctgaacaaa ttcgacgaca ccgaaacctc taacaaatac 1080

gctggtaaac cgggtatcga caaccgtgaa tgcctgtcta tggactacaa acagacccag 1140

ctgtgcatcc tgggttgcaa accgccgatc ggtgaacact ggggtaaagg taccccgtgc 1200

aacaacaact ctggtaaccc gggtgactgc ccgccgctgc agctgatcaa ctctgttatc 1260

caggacggtg acatggttga caccggtttc ggttgcatgg acttcaacac cctgcaggct 1320

tctaaatctg acgttccgat cgacatctgc tcttctgttt gcaaataccc ggactacctg 1380

cagatggctt ctgaaccgta cggtgactct ctgttcttct tcctgcgtcg tgaacagatg 1440

ttcgttcgtc acttcttcaa ccgtgctggt accctgggtg acccggttcc gggtgacctg 1500

tacatccagg gttctaactc tggtaacacc gctaccgttc agtcttctgc tttcttcccg 1560

accccgtctg gttctatggt tacctctgaa tctcagctgt tcaacaaacc gtactggctg 1620

cagcgtgctc agggtcacaa caacggtatc tgctggggta accagctgtt cgttaccgtt 1680

gttgacacca cccgttctac caacatgacc ctgtgcgctg aagttaaaaa agaatctacc 1740

tacaaaaacg aaaacttcaa agaatacctg cgtcacggtg aagaattcga cctgcagttc 1800

atcttccagc tgtgcaaaat caccctgacc gctgacgtta tgacctacat ccacaaaatg 1860

gacgctacca tcctggaaga ctggcagttc ggtctgaccc cgccgccgtc tgcttctctg 1920

gaagacacct accgtttcgt tacctctacc gctatcacct gccagaaaaa caccccgccg 1980

aaaggtaaag aagacccgct gaaagactac atgttctggg aagttgacct gaaagaaaaa 2040

ttctctgctg acctggacca gttcccgctg ggtcgtaaat tcctgctgca ggctggtctg 2100

caggcttag 2109

<210> 12

<211> 2469

<212> DNA

<213> Artificial sequence

<400> 12

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720

ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780

atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840

cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900

aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960

cagaccggtg gatcctctga agctaccgtt tacctgccgc cggttccggt ttctaaagtt 1020

gtttctaccg acgaatacgt ttctcgtacc tctatctact actacgctgg ttcttctcgt 1080

ctgctgaccg ttggtcaccc gtacttctct atcaaaaaca cctcttctgg taacggtaaa 1140

aaagttctgg ttccgaaagt ttctggtctg cagtaccgtg ttttccgtat caaactgccg 1200

gacccgaaca aattcggttt cccggacacc tctttctaca acccggaaac ccagcgtctg 1260

gtttgggctt gcaccggtct ggaaatcggt cgtggtcagc cgctgggtgt tggtatctct 1320

ggtcacccgc tgctgaacaa attcgacgac accgaaacct ctaacaaata cgctggtaaa 1380

ccgggtatcg acaaccgtga atgcctgtct atggactaca aacagaccca gctgtgcatc 1440

ctgggttgca aaccgccgat cggtgaacac tggggtaaag gtaccccgtg caacaacaac 1500

tctggtaacc cgggtgactg cccgccgctg cagctgatca actctgttat ccaggacggt 1560

gacatggttg acaccggttt cggttgcatg gacttcaaca ccctgcaggc ttctaaatct 1620

gacgttccga tcgacatctg ctcttctgtt tgcaaatacc cggactacct gcagatggct 1680

tctgaaccgt acggtgactc tctgttcttc ttcctgcgtc gtgaacagat gttcgttcgt 1740

cacttcttca accgtgctgg taccctgggt gacccggttc cgggtgacct gtacatccag 1800

ggttctaact ctggtaacac cgctaccgtt cagtcttctg ctttcttccc gaccccgtct 1860

ggttctatgg ttacctctga atctcagctg ttcaacaaac cgtactggct gcagcgtgct 1920

cagggtcaca acaacggtat ctgctggggt aaccagctgt tcgttaccgt tgttgacacc 1980

acccgttcta ccaacatgac cctgtgcgct gaagttaaaa aagaatctac ctacaaaaac 2040

gaaaacttca aagaatacct gcgtcacggt gaagaattcg acctgcagtt catcttccag 2100

ctgtgcaaaa tcaccctgac cgctgacgtt atgacctaca tccacaaaat ggacgctacc 2160

atcctggaag actggcagtt cggtctgacc ccgccgccgt ctgcttctct ggaagacacc 2220

taccgtttcg ttacctctac cgctatcacc tgccagaaaa acaccccgcc gaaaggtaaa 2280

gaagacccgc tgaaagacta catgttctgg gaagttgacc tgaaagaaaa attctctgct 2340

gacctggacc agttcccgct gggtcgtaaa ttcctgctgc aggctggtct gcaggctcgt 2400

ccgaaactga aacgtccggc ttcttctgct ccgcgtacct ctaccaaaaa aaaaaaagtt 2460

aaacgttag 2469

<210> 13

<211> 2640

<212> DNA

<213> Artificial sequence

<400> 13

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcagaa ttcatgtctg tttggcgtcc gtctgaagct 1200

accgtttacc tgccgccggt tccggtttct aaagttgttt ctaccgacga atacgtttct 1260

cgtacctcta tctactacta cgctggttct tctcgtctgc tgaccgttgg tcacccgtac 1320

ttctctatca aaaacacctc ttctggtaac ggtaaaaaag ttctggttcc gaaagtttct 1380

ggtctgcagt accgtgtttt ccgtatcaaa ctgccggacc cgaacaaatt cggtttcccg 1440

gacacctctt tctacaaccc ggaaacccag cgtctggttt gggcttgcac cggtctggaa 1500

atcggtcgtg gtcagccgct gggtgttggt atctctggtc acccgctgct gaacaaattc 1560

gacgacaccg aaacctctaa caaatacgct ggtaaaccgg gtatcgacaa ccgtgaatgc 1620

ctgtctatgg actacaaaca gacccagctg tgcatcctgg gttgcaaacc gccgatcggt 1680

gaacactggg gtaaaggtac cccgtgcaac aacaactctg gtaacccggg tgactgcccg 1740

ccgctgcagc tgatcaactc tgttatccag gacggtgaca tggttgacac cggtttcggt 1800

tgcatggact tcaacaccct gcaggcttct aaatctgacg ttccgatcga catctgctct 1860

tctgtttgca aatacccgga ctacctgcag atggcttctg aaccgtacgg tgactctctg 1920

ttcttcttcc tgcgtcgtga acagatgttc gttcgtcact tcttcaaccg tgctggtacc 1980

ctgggtgacc cggttccggg tgacctgtac atccagggtt ctaactctgg taacaccgct 2040

accgttcagt cttctgcttt cttcccgacc ccgtctggtt ctatggttac ctctgaatct 2100

cagctgttca acaaaccgta ctggctgcag cgtgctcagg gtcacaacaa cggtatctgc 2160

tggggtaacc agctgttcgt taccgttgtt gacaccaccc gttctaccaa catgaccctg 2220

tgcgctgaag ttaaaaaaga atctacctac aaaaacgaaa acttcaaaga atacctgcgt 2280

cacggtgaag aattcgacct gcagttcatc ttccagctgt gcaaaatcac cctgaccgct 2340

gacgttatga cctacatcca caaaatggac gctaccatcc tggaagactg gcagttcggt 2400

ctgaccccgc cgccgtctgc ttctctggaa gacacctacc gtttcgttac ctctaccgct 2460

atcacctgcc agaaaaacac cccgccgaaa ggtaaagaag acccgctgaa agactacatg 2520

ttctgggaag ttgacctgaa agaaaaattc tctgctgacc tggaccagtt cccgctgggt 2580

cgtaaattcc tgctgcaggc tggtctgcag gctcgtccga aactgaaacg tccggcttaa 2640

Claims (4)

1. A method of making HPV 52L 1 VLPs, characterized in that the method comprises the steps of:

expressing the coding gene of the Tag-HPV 52L 1 fusion protein shown as SEQ ID NO.4 in recombinant escherichia coli to obtain the fusion protein;

carrying out enzyme digestion on the obtained fusion protein by adopting protease SENP 1;

purifying the enzyme-digested protein to obtain an HPV 52L 1 pentamer protein solution with the average particle size of 10-15 nm and PdI of less than 0.1;

and mixing the HPV 52L 1 pentamer protein solution with an assembly buffer solution to finally obtain HPV 52L 1 VLPs with the pH value of 5.0-5.9, the salt concentration of 500-2000 mM, the average particle size of 52-65 nm and PdI < 0.1.

2. A method of making HPV 52L 1 VLPs of claim 1, wherein: the expression of the coding gene in the recombinant escherichia coli adopts an induction expression mode.

3. A method of making HPV 52L 1 VLPs of claim 2, wherein: the Escherichia coli is GI698, ER2566, BL21(DE3), XA90, B834(DE3) or BLR (DE 3).

4. A process for the preparation of HPV 52L 1 VLPs of claim 3, wherein: the fusion protein of the HPV 52L 1 obtained by recombinant expression is purified by an affinity chromatography method, then the protein enzyme is added for enzyme digestion, and then the purification is carried out to obtain an HPV 52L 1 pentamer protein solution with the purity of 98 percent, the average particle size of 10-15 nm and the PdI of less than 0.1.

Images