CN104962567B - 6 type recombinant human papilloma virus-like particle and preparation method thereof - Google Patents

Abstract

The invention relates to a 6-type recombinant human papilloma virus-like particle and a preparation method thereof, and particularly discloses a novel polynucleotide gene segment for coding recombinant HPV 6L 1 protein, a vector containing the gene segment, a host cell comprising the vector, HPV 6L 1 fusion protein expressed by the translation of the gene segment, a pentamer and VLP (VLP) consisting of the pentamer, and application of the pentamer, the VLP protein and a vaccine composition consisting of the pentamer and the VLP protein in preparation of a medicament for preventing HPV6 infection.

Description

6 type recombinant human papilloma virus-like particle and preparation method thereof

Technical Field

The present invention relates to virus-like particles of human papilloma virus and a method for preparing the same. More specifically, the invention relates to a pentamer and Virus-like Particle (VLP) of a recombinant human papilloma Virus L1 protein, a preparation method thereof and application of a vaccine composition containing the VLP in prevention of human papilloma Virus infection.

Background

Human Papilloma Virus (HPV) is mainly caused by close contact of Human body, such as sexually transmitted virus, and can cause various proliferative epithelial lesions including papilloma (wart) and neoplasia. In particular, HPV-induced diseases mainly include 3 major groups, 1 st group, cancers of cervix, vagina, female vulva, penis and anus, and malignant lesions such as certain types of head and neck tumors. 100% of cervical cancer patients are caused by HPV infection, 90% of anal cancer, 40% of vulva, vagina and penis, 12% of oropharynx and 3% of oral cancer are due to HPV infection. Group 2 benign lesions, such as genital warts, including flat warts and condyloma acuminata, are sexually transmitted diseases and are common in people with active sexual activity. Although genital warts do not have as serious consequences as cancer, the lesions often cause painful clinical symptoms such as burning, bleeding and pain for the patient, while creating negative psychological reactions such as embarrassment, anxiety and self-mutism, and the process of repeated treatment wastes a great deal of medical resources. Genital warts caused by non-oncogenic HPV (mainly types 6 and 11) are estimated to be 3000 tens of thousands worldwide, with 20-50% of lesions also containing mixed infections with high-risk HPV types. Group 3 HPV infection can also cause Recurrent Respiratory Papilloma (RRP), a rare, potentially fatal disease that occurs mainly in adolescents, and sometimes, large numbers of papillomas can cause dyspnea and death in younger children. Therefore, the prevention or treatment of HPV infection is of great significance to human health.

HPV is a membrane-free double-stranded DNA virus, consisting mainly of viral coat and genomic DNA (Bernard, burk et al 2011). The HPV viral coat is an icosahedral structure consisting of 360L 1 proteins (forming 72 pentamers) and up to 72L 2 proteins, with a diameter of 55-60 nm (Howley and Lowy 2007). The viral coat protein has the property of self-assembly, with L1 protein alone or in combination with L2 protein, in vitro, to form Virus-like particles (VLPs) (Chen, garce et al 2000, finnen, erickson et al 2003, buck, cheng et al 2008, wang and Roden 2013).

Since HPV cannot be cultured in vitro, the specific antigen of the virus can be obtained only by using the method of recombinant DNA technology to prepare the genetic engineering vaccine. Virus-like particles VLPs formed by assembling the recombinant Ll or L1/L2 have no virus DNA, good safety and similar epitope with natural virus particles, and can generate neutralizing antibodies IgG and IgA after stimulating an organism, so that the HPV VLPs can be used as a preventive vaccine, thereby greatly reducing the possibility of generating related tumors caused by infecting HPV (Howley and Lowy 2007).

The key to developing HPV vaccine is the ability to prepare high purity, stable HPV antigens in large quantities. In the aspect of HPV vaccine antigen preparation technology, the expression systems commonly used at present for producing HPV antigens can be divided into eukaryotic expression systems and prokaryotic expression systems. Examples of eukaryotic expression systems that are commonly used include poxvirus expression systems, insect baculovirus expression systems, and yeast expression systems. The HPV L1 expressed in eukaryotic expression system can spontaneously form VLP, and the VLP can be obtained by simple purification. However, the expression quantity of the eukaryotic expression system is low, the culture cost is high, and great difficulty is brought to large-scale industrial production. The expression of HPV L1 protein in prokaryotic expression systems using E.coli expression systems has been reported. However, since the HPV L1 protein expressed by e.coli has low solubility, the currently known purification methods mostly finally purify HPV VLPs from the cell sap with a large protein variety by steps such as salt-free precipitation or denaturation and renaturation. For example: in patent CN02129070.9 a method for expressing and preparing HPV L1 multimers by prokaryotic cells is disclosed, wherein the purification process comprises treatment by 3.3M urea and dialysis renaturation process; the purification method of L1-GST fusion protein in WO-0204007 also involves urea denaturation and dialysis renaturation; it is also disclosed in the prior art that the purification method of L1 protein comprises the steps of ultrafiltration dialysis with phosphate buffer and centrifugation to precipitate the target protein and then redissolve it. However, the protein loss during these purification processes is large, the yield is low, and the application in large-scale production is difficult.

In the aspect of uniformity of HPV vaccine antigen protein VLP, the particle size dispersion degree of the assembled HPV L1VLP in the prior art is expressed by using a poly d value, wherein the poly d value is less than 15% to indicate that the particles have good uniformity, between 15% and 30% to indicate that the particles have large heterogeneity, and more than 30% to indicate that the particles are not uniform enough completely. The HPV L1VLP prepared in the prior art is more than 15%. Another index indicating that the particle size is uniform is a PdI value, wherein the PdI value is a particle size distribution coefficient, and a sample with uniform height is obtained when the PdI value is less than 0.05; 0.05 to 0.1, 0.1 to 0.3, and more than 0.3, the samples were quasi-uniform, less uniform, and non-uniform. The PdI of the mixed protein solution of two type HPV L1 VLPs is disclosed in US7205125B2 patent as 0.07.

Therefore, there is still a need in the art for a low-cost, high-purity, high-yield, quality-stable HPV L1 protein production technology and a new method for large-scale industrial production of recombinant HPV L1 VLPs.

Disclosure of Invention

The invention aims to disclose an optimized nucleotide sequence for coding HPV 6L 1 protein, a vector comprising the nucleotide sequence, a host cell comprising the vector, HPV L1 protein which is translated and expressed by the polynucleotide sequence, tag-HPV-L1 recombinant protein, pentamer and VLP formed by the L1 protein, and a vaccine for preventing HPV infection by taking the pentamer and VLP as antigens.

In a first aspect, the invention provides a codon-optimized HPV 6L 1 gene, the nucleotide sequence of which is SEQ NO:2.

in a second aspect, the present invention provides a constructed expression vector comprising the codon-optimized HPV 6L 1 gene of the first aspect of the present invention. The vector is suitable for driving the translation of heterologous DNA in bacteria to express HPV L1 protein. In one embodiment, the expression vector is preferably pGEX-6p-1, pGEX-4T-2, pMAL, or pET28a.

In a third aspect, the invention provides a constructed engineered bacterial cell comprising the gene of the first aspect of the invention, or the expression vector of the second aspect. The engineered host cell is escherichia coli, and in one embodiment, the host cell is preferably a BL21 cell strain.

The fourth aspect of the invention provides a Tag-HPV 6L 1 fusion protein, wherein the Tag is 6 × his.tag, gst.tag, sumo.tag, mbp.tag,6 × his-sumo.tag or GST-sumo.tag; l1 is HPV 6L 1 full-length protein and/or L1 protein which is truncated by 5, 10, 15 or no more than 30 amino acids at C terminal and/or is truncated by 2, 4, 6 or no more than 10 amino acids at N terminal.

The nucleotide sequence for coding the Tag-HPVL1 fusion protein GST-HPV 6L 1 is SEQ NO: 3. the amino acid sequence of SEQ NO:11, the nucleotide sequence of GST-SUMO-HPV 6L 1 is SEQ NO: 4. the amino acid sequence of SEQ NO:12, the nucleotide sequence of MBP SEQ NO: 5. the amino acid sequence of SEQ NO:13,6 his-HPV 6L 1 has the nucleotide sequence of SEQ NO:6, 6 His-SUMO-HPV 6L 1 nucleotide sequence is SEQ NO:7.

the amino acid sequence of the GST-HPV 6L 1 fusion protein coding Tag-HPVL1 is SEQ NO:8, the amino acid sequence of GST-SUMO-HPV 6L 1 is SEQ NO:9,mbp the amino acid sequence of SEQ NO:10.

the fifth aspect of the present invention provides a pentamer of HPV L1 obtained after purification of Tag-HPVL1 fusion protein, and VLP assembled from the pentamer. In a preferred embodiment, the HPV 6L 1 pentamer protein average particle size is 10-15nm PdI < -0.1. In a preferred embodiment, the average particle size of the HPV 6L 1 VLPs is 45-65nm PdI & lt 0.1.

In a sixth aspect, the invention provides a vaccine composition comprising a pentamer of HPV L1 of the invention or a VLP of HPV L1, said composition further comprising a pharmaceutically acceptable excipient and a pharmaceutically acceptable adjuvant.

In one embodiment, recombinant HPV L1 protein pentamer or VLP vaccines are prepared by separately subjecting a protein stock solution (prepared according to the above method) containing HPV 6L 1 pentamer or VLP to adsorption formulation with an aluminum hydroxide adjuvant physiological saline solution at a protein to aluminum content of 1.

In another aspect, the present invention also provides a method for obtaining a Tag-HPVL1 fusion protein, comprising the steps of:

A. replacing the codon of the same protein translated in the HPV 6L 1 gene sequence by the codon preferred by escherichia coli to obtain the HPV 6L 1 gene optimized by the codon preferred by an escherichia coli expression system;

B. constructing an Escherichia coli expression vector of the HPV 6L 1 gene;

C. constructing an escherichia coli expression engineering strain of Tag-HPV 6L 1;

D. inducing expression and purifying to obtain fusion protein Tag-HPV 6L 1.

The prokaryotic host cell in the method for preparing the fusion protein Tag-HPV 6L 1 is selected from but not limited to GI698, ER2566, BL21 (DE 3), XA90, B834 (DE 3) and BLR (DE 3).

The expression conditions in the method for preparing the fusion protein Tag-HPV 6L 1 are as follows: inducing expression for 3-20 hours at 20-37 deg.C. In one embodiment, preferably at 28 ℃ temperature, induced expression for 16 hours.

The invention also provides a method for obtaining the HPV 6L 1 pentamer, which comprises the following steps:

a) Adsorbing the fusion protein Tag-HPV 6L 1 by using an affinity chromatography method;

b) Adding a proteolytic enzyme to remove the Tag label to obtain HPV 6L 1 pentamer protein;

c) Purifying the HPVL1 pentamer protein to obtain the L1 pentamer protein with the purity of more than 98 percent and the average particle size of 10-15nm PdI < -0.1.

The protease used in the above method for preparing HPV 6L 1 pentamer is a site-specific proteolytic enzyme that cleaves Tag tags: recombinant 3C protease, thrombin, SUMO protease, SENP1 or TEV protease.

The purification method in the method for preparing HPV 6L 1 pentamer is selected from, but not limited to, ion exchange chromatography, hydrophobic chromatography, molecular sieve (or gel filtration or size exclusion) chromatography; preferably the purification comprises ion exchange chromatography and molecular sieve chromatography.

The purification method in the above method for preparing HPV 6L 1 pentamer further comprises using a reducing agent, such as DTT.

The average particle size of the HPV 6L 1 pentamer protein obtained after final purification in the method for preparing the HPV 6L 1 pentamer is 10-15nm PdI & lt 0.1.

The invention also provides a method for assembling the HPV 6L 1 pentamer into VLPs, which comprises the following steps:

mixing the L1 pentamer protein solution with the average particle size of 10-15nm PdI-less 0.1 with an assembly buffer solution to finally obtain the HPV 6L 1VLP protein solution with the pH value of 5.0-5.9, the salt concentration of 500-2000 mM and the average particle size of 45-65nm PdI-less 0.1, preferably obtain the HPV 6L 1VLP protein solution with the pH value of 5.7 and the salt concentration of 1300 mM.

The assembly buffer includes, but is not limited to, tris buffer, phosphate buffer, acetate buffer, HEPES buffer, MOPS buffer, citric acid buffer, histidine buffer, boric acid buffer, and the like.

In the method for assembling the HPV 6L 1 pentamer into the VLP, a protective agent can be added into the protein liquid of the HPV 6L 1-VLP, such as: 0.01-0.1 polysorbate 80.

The invention also provides another method for assembling VLP, namely a low-temperature freezing treatment assembling method, which comprises the following steps:

putting the HPV L1 pentamer protein solution into a buffer solution with the pH value of 5.5-8.0 and the salt concentration of 150-1000 mM, completely freezing at the temperature of-20 to-80 ℃, preferably freezing for 24 hours, and then placing at room temperature until the protein stock solution is thawed to obtain the HPV 6L 1VLP protein solution with the average particle size of 45-65nm PdI & lt 0.1 & gt.

In another aspect, the invention also provides the use of pentamers of HPV L1, VLPs and vaccine compositions comprising the pentamers or VLPs in the preparation of a medicament for preventing HPV infection.

According to the present invention, the vaccine of the present invention may take a form acceptable to patients, including but not limited to injection or nasal or oral inhalation or vaginal administration, preferably injection and intramuscular injection.

Description and explanation of related terms in the present invention

According to the present invention, the term "E.coli expression system" means a system consisting of E.coli (strain) derived from commercially available sources, exemplified herein but not limited thereto: GI698, ER2566, BL21 (DE 3), XA90, DH (5 a), B834 (DE 3), BLR (DE 3).

According to the invention, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide encoding a protein can be inserted and the protein expressed. The vector may be transformed, transduced or transfected into a host cell to obtain expression of the genetic material element carried by the vector in the host cell. By way of example, the carrier includes: a plasmid; bacteriophage; cosmids, and the like.

According to the present invention, the term "vaccine excipient or carrier" refers to a substance selected from one or more of, including but not limited to: pH regulator, surfactant, adjuvant, and ionic strength enhancer. For example, pH adjusting agents such as, but not limited to, phosphate buffers, surfactants include cationic, anionic or nonionic surfactants. By way of example but not limitation: polysorbate 80. Adjuvants are exemplified by, but not limited to, aluminum hydroxide, aluminum phosphate, freund's complete adjuvant, freund's incomplete adjuvant, and the like. Ionic strength enhancers are exemplified by, but not limited to, sodium chloride.

According to the present invention, the term "chromatography" includes, but is not limited to: ion exchange chromatography (e.g., cation exchange chromatography, anion exchange chromatography), hydrophobic interaction chromatography, adsorption chromatography (e.g., hydroxyapatite chromatography), molecular sieve chromatography (gel filtration or size exclusion chromatography), affinity chromatography.

According to the present invention, in the method for obtaining recombinant HPV L1 protein according to the present invention, the buffer refers to a solution capable of greatly reducing the range of pH variation when a small amount of acid or alkali and water are added, and includes, but is not limited to, tris buffer, phosphate buffer, acetate buffer, HEPES buffer, MOPS buffer, citric acid buffer, histidine buffer, boric acid buffer, and the like.

According to the present invention, the cell disruption includes, but is not limited to, one or more of disruption by a homogenizer, sonication, milling, high pressure extrusion, lysozyme treatment;

according to the present invention, in the method of obtaining recombinant HPV L1 protein according to the present invention, the salt used includes, but is not limited to, neutral salts, especially alkali metal salts, ammonium salts, hydrochloride salts, sulfate salts, bicarbonate salts, phosphate salts or hydrogen phosphate salts, especially one or more of NaCI, KCl, caCl2, NH4Cl, KCI, NH4CI, mgSO4, (NH 4) 2SO 4. NaCI is preferred. Reducing agents used include, but are not limited to, DTT, 2-mercaptoethanol. Amounts used include, but are not limited to, 2 mM-lO 0mM, preferably 10-15 mM.

Advantageous effects

The invention provides a synthetic gene, which is a nucleotide sequence subjected to codon optimization according to the codon preference of escherichia coli and encodes an HPV L1 protein amino acid sequence. Researches show that the expression quantity of the L1 protein of the nucleic acid sequence subjected to codon optimization is obviously improved compared with that of the nucleic acid sequence not subjected to codon optimization.

The Escherichia coli expression system disclosed by the invention has the advantages of high expression quantity, easiness in culture and operation, low production cost and the like. However, it is still difficult to directly obtain a large amount of soluble HPV L1 protein using only this expression system because the L1 protein is very easily formed into inclusion bodies, i.e., biologically inactive insoluble polymers. In addition, even if a large amount of inclusion bodies are obtained, in order to obtain biologically active proteins, the inclusion bodies must be denatured and renatured, and a large amount of protein is often lost in this process. In order to solve the problem, the invention adopts a fusion technology to perform fusion expression on an L1 gene and a protein which assists the correct folding of the protein, such as glutathione-S-transferase (GST), SUMO, MBP, 6 His-SUMO or GST-SUMO, and the like, so that the solubility and the yield of the protein are improved, and GST-SUMO-HPVL1,6 His-SUMO-HPVL1 causes no residue of exogenous amino acid at the N end of the HPV L1 protein, and the GST-SUMO is found to be used as a fusion tag and a molecular chaperone for the expression of the recombinant protein HPV L1 and has the functions of resisting proteolysis, remarkably increasing the expression quantity of the recombinant protein, promoting the correct folding of the target protein, improving the solubility and the like. Therefore, the technical route adopted by the invention is to adopt a tag protein fusion technology when constructing an HPV L1 protein expression vector, on one hand, the solubility of the target protein is improved and the yield is improved through the fusion protein formed by the tag protein and the L1 protein, on the other hand, the purification characteristic of the target protein can be carried out through a GST fusion tag by utilizing a method of affinity chromatography and proteolytic enzyme excision fusion substance tag, thereby realizing the one-step purification of cell lysate with various types to obtain the HPV L1 protein with the purity of more than 70 percent, greatly improving the purification efficiency and improving the yield of the final product HPV L1 protein.

The technical route of the invention, which is firstly used for expressing, separating and purifying to obtain the high-purity HPV L1 pentamer protein and then manually controlling and assembling to form VLP, can solve the problems of low purity, high degradation ratio and low yield of VLP directly purified from cell disruption solution with various proteins in the prior art, and obtain the high-purity pentamer in-vitro assembled VLP and a VLP storage condition.

In addition, the inventors have surprisingly found a new assembly condition and method: namely, a low-temperature freezing process assembly method. The VLP obtained by the method can change the protein (PdI is more than 0.1) with non-uniform particle size assembled before freeze thawing into the VLP with particle size which is expected by theory and is uniform, and the PdI is less than 0.1, is more stable compared with the VLP obtained by the prior art, can be stored in buffers with different salt concentrations and wider pH value range, and is more convenient for the dilution and preparation of final vaccine preparations.

The recombinant HPV L1VLP protein has good immunogenicity, can induce high-titer neutralizing antibodies aiming at homotypic HPV, prevents HPV infection on human bodies, and is a good vaccine form.

These and other aspects of the invention will be apparent upon reference to the following detailed description and attached drawings. All references disclosed herein are incorporated by reference in their entirety.

Drawings

FIG. l: and (3) an SDS-PAGE gel electrophoresis picture of GST-HPV 6L 1 protein affinity and enzymolysis. The M lane is a protein mass standard lane and comprises the following components from top to bottom: 94kDa,66kDa,45kDa,33kDa,26kDa,20kdat, and the left lane shows a resin for affinity adsorption of GST-L1, and the right lane shows a resin for binding GST and L1 after enzymatic hydrolysis.

FIG. 2 is a schematic diagram: SDS-PAGE gel electrophoresis picture of GST-SUMO-HPV 6L 1 protein after affinity and enzymolysis. The M lane is a protein quality standard (from top to bottom: 94kDa,66kDa,45kDa,33kDa,26kDa, 20kda), the left lane is a resin for affinity adsorption of GST-SUMO-L1, and the right lane is a resin for adsorption of GST-SUMO and L1 after enzymolysis.

FIG. 3: SDS-PAGE gel electrophoresis picture of MBP-HPV 6L 1 protein after affinity and enzymolysis. The M lane is a protein mass standard (from top to bottom: 94kDa,66kDa,45kDa,33kDa,26kDa, 20kda), the left lane is a resin for affinity adsorption of MBP-L1, and the right lane is a resin for adsorption of MBP and L1 after enzymolysis.

FIG. 4: 6H HIS-SUMO-HPV 6L 1 protein after affinity and enzymolysis SDS-PAGE gel electrophoresis picture. Lane M is a protein mass standard (from top to bottom: 94kDa,66kDa,45kDa,33kDa,26kDa, 20kda), left lane is a resin that adsorbs 6 × HIS-SUMO-L1 with affinity, and right lane is a resin that adsorbs 6 × HIS-SUMO to L1 after enzymolysis. The lysated protein with 6 × his-SUMO tag was not cleaved by the protease as shown by gel electrophoresis.

FIG. 5: the invention relates to an SDS-PAGE gel electrophoresis picture of a recombinant HPV 6L 1 pentamer protein purified by molecular sieve chromatography. The M lane is a protein mass standard (from top to bottom: 94kDa,66kDa,45kDa,33kDa,26kDa, 20kda), and the other lane is HPV L1 protein.

FIG. 6: dynamic light scattering observations of HPV 6L 1 pentamer. The result showed that the particle diameter of the pentamer was 12.89nM and the particle size distribution PdI was 0.058.

FIG. 7: dynamic light scattering observations of HPV 6L 1 VLPs. The results showed that the diameter of the particle size of the VLPs was 50.29 nM and the particle size distribution PdI was 0.040.

FIG. 8: transmission electron micrograph of HPV 6L 1 pentamer protein.

FIG. 9: transmission electron micrograph of HPV 6L 1VLP protein.

FIG. 10: high pressure liquid phase molecular sieve chromatograms of HPV 6L 1 pentamer proteins showed that the highly purified L1 pentamer protein was greater than 98% pure.

FIG. 11: high pressure liquid phase molecular sieve chromatograms of HPV 6L 1VLP proteins showing that highly purified VLP proteins are greater than 98% pure.

FIG. 12: the mean titer level of neutralizing antibodies was measured 4 weeks after the second boost immunization of mice vaccinated with each experimental group of HPV 6L 1 pentamer.

FIG. 13 is a schematic view of: the mean titer level of neutralizing antibodies was measured 4 weeks after the second booster immunization of mice vaccinated with each experimental group of HPV 6L 1 VLPs.

The invention is further illustrated by the following examples. These examples are not limiting.

Example i: design and synthesis of codon-optimized HPV L1 gene

The gene sequence is derived from various HPV sequences disclosed on PUBMED. All HPV DNA sequences were synthesized after codon optimization of selected HPV DNA sequences with reference to E.coli bias towards gene transcription codons. Primers were designed based on the synthetic DNA sequence, and PCR amplification was performed using the synthetic gene as a template. The resulting codon optimized sequence was verified by DNA sequencing.

DNA sequences of HPV types before and after optimization:

1, SEQ No.1: DNA sequence of HPV type 6L 1 before optimization

The amino acid sequence of SEQ NO.2: optimized HPV6 type L1 DNA sequence

Example 2: construction and identification of recombinant vector pGEX-6P-1-GST-HPV 6L 1:

DNA fragment primers for amplification of HPV 6L 1: (cleavage sites are BamHI and XhoI, respectively)

Forward-HPV6 L1-ApaI:5’ACTTCAGGATCC ATGTGGCGTCCGTCTGACTCTA

Reverse-HPV6 L1-XhoI:5’ATCTCACTCGAGCTA ACGTTTGGTT TTAGCACGTTT

PCR amplification reaction System: 10 x Pfu buffer 20. Mu.L, pfu enzyme 4. Mu.L, 10 mM dNTP 2.5. Mu.L, 5'Primer (5. Mu.M) 10. Mu.L, 3' Primer (5. Mu.M) 10. Mu.L, template DNA 50 ng, plus d2H2O to 200. Mu.L.

The gene PCR amplification conditions are as follows: 3 min at 95 ℃; 95 ℃ 30 sec,58 ℃ 30 sec,72 ℃ 4 min; circulating for 32 times; 10 min at 72 ℃.

Carrying out BamH I/XhoI double enzyme digestion treatment on an L1 gene fragment containing BamH I and XhoI enzyme digestion sites and a vector pGEX-6P-1, and then carrying out ligation reaction on the recovered gene fragment and pGEX-6P-1 containing a corresponding cohesive end by utilizing T4 DNA ligase at 16 ℃ for 10-15 h.

After the ligation reaction, the ligation product is transformed into host bacteria DH5 alpha for screening recombinants. The screened monoclonal colony is subjected to amplification culture and plasmid extraction, and then sequencing is carried out by Shanghai bio-corporation, so that the nucleotide sequence of the fusion recombinant GST-HPV6-L1 protein is SEQ NO.3, and the amino acid sequence is SEQ NO.8.

A fusion recombinant vector GST-HPV-L1 with a GST tag, the gene sequence of which is SEQ No.11, was prepared by referring to the method of this example.

Example 3: construction of recombinant vector pGEX-6P-1 m-GST-SUMO-HPV 6L 1 vector

Construction of pGEX-6p-1m vector: in order to ensure that ApaI enzyme cutting sites (GGGCCC) near the multi-enzyme cutting sites are the only ApaI enzyme cutting sites of the vector, the Gly codon GGC in another ApaI recognition sequence GGGCCC of a commercial pGEX-6p-1 vector is changed into the same sense codon GGT by a point mutation technology on the premise of not changing the protein expression sequence of the lacI gene, and the ApaI can be eliminated (3890). ApaI is made available to insert a site for expression of a gene by such a modification.

DNA fragment primers for amplification of SUMO: (cleavage sites were ApaI and BamHI, respectively)

Forward -SUMO-ApaI: ACTTCAGGGCCCTCTGACCAGGAAGCTAAACCGTC

Reverse-SUMO-BamHI: CGCGGATCCACCGGTCTGTTCCTGGTAAAC

DNA fragment primers for amplification of HPV 6L 1: (cleavage sites are BamHI and XhoI, respectively)

Forward-HPV6 L1-ApaI:5’ACTTCAGGATCC ATGTGGCGTCCGTCTGACTCTA

Reverse-HPV6 L1-XhoI:5’ATCTCACTCGAGCTA ACGTTTGGTT TTAGCACGTTT

PCR amplification reaction System: 10 x Pfu buffer 20. Mu.L, pfu enzyme 4. Mu.L, 10 mM dNTP 2.5. Mu.L, 5'Primer (5. Mu.M) 10. Mu.L, 3' Primer (5. Mu.M) 10. Mu.L, template DNA 50 ng, plus d2H2O to 200. Mu.L.

The gene PCR amplification conditions are as follows: 1.5 min at 95 ℃; 95 ℃ for 30 sec,58 ℃ for 30 sec,72 ℃ for 1 min; circulating for 32 times; 10 min at 72 ℃.

The conditions for gene PCR amplification were the same as in the above examples.

Enzyme digestion connection: the SUMO gene fragment containing ApaI and BamHI cleavage sites and the vector pGEX-6P-1m are subjected to Apa I/BamHI double cleavage treatment, and then the recovered gene fragment is subjected to ligation reaction with pGEX-6P-1m containing the corresponding cohesive ends by using T4 DNA ligase at 16 ℃ for 10-15 h.

Transformation and identification: after the ligation reaction, the ligation product is transformed into host bacteria DH5 alpha for screening recombinants. The screened monoclonal colonies are subjected to amplification culture and plasmid extraction, and then sequencing is performed by Suzhou Jinzhi Biotechnology Limited to obtain a fusion recombinant vector pGSTSMO-6 p-1m.

And (3) secondary enzyme digestion and connection: the L1 gene fragment containing BamHI and Xho1 cleavage sites and the recombinant vector pGSTSMO-6 p-1m were subjected to BamHI/Xho1 double cleavage treatment, and then the recovered gene fragment was subjected to ligation reaction with pGSTSMO-6 p1m containing the corresponding cohesive ends using T4 DNA ligase at 16 ℃ for 10 to 15 hours.

And (3) secondary transformation and identification: after the ligation reaction, the ligation product is transformed into host bacteria DH5 alpha for screening recombinants. And carrying out amplification culture on the screened monoclonal colonies, extracting plasmids, and sequencing by Suzhou Jinzhi Biotechnology Limited to obtain a fusion recombinant vector GST-SUMO-L1 with a GST-SUMO label, wherein the gene sequence is SEQ NO.4, and the amino acid sequence is SEQ NO.9.

The fusion recombinant vector GST-SUMO-L1 with GST-SUMO tag is prepared by referring to the method of the embodiment, and the gene sequence is SEQ NO.12.

Example 4: construction of recombinant vector pMAL-MBP-HPV 6L 1

DNA fragment primers for amplification of HPV 6L 1: (restriction sites were EcoRI and HindIII, respectively)

Forward-HPV6 L1-EcoRI:5’ ACTTCA GAATTC ATGTGGCGTCCGTCTGACTCTA

Reverse-HPV6 L1-HindIII:5’ ATCTCA AAGCTTCTA ACGTTTGGTT TTAGCACGTTT

The L1 gene fragment containing EcoRI and HindIII enzyme cutting sites and the carrier pMAL are subjected to EcoRI/HindIII double enzyme cutting treatment, and then the recovered gene fragment and pMAL containing corresponding viscous tail ends are subjected to ligation reaction by utilizing T4 DNA ligase at 16 ℃ for 10-15 h.

After the ligation reaction, the ligation product is transformed into host bacteria DH5 alpha for screening recombinants. The screened monoclonal colony is subjected to amplification culture and plasmid extraction, and then sequencing is carried out by Shanghai bio-engineering company to obtain a gene sequence SEQ NO.5 and an amino acid sequence SEQ NO.10 of the fusion recombinant MBP-HPV6-L1 protein.

A fusion recombinant vector MBP-HPV-L1 with an MBP tag is prepared by the method of the embodiment, and the gene sequence is SEQ NO.13.

Example 5: construction of recombinant vector pET28a-6 His-HPV 6L 1

DNA fragment primers for amplification of HPV 6L 1: (the cleavage sites were NdeI and XhoI, respectively, pET28 a)

Forward-HPV6 L1-NdeI:5’ GACTTCA CATATGATGTGGCGTCCGTCTGACTCTA

Reverse-HPV6 L1-XhoI:5’ CATCTCACTCGAGCTA ACGTTTGGTT TTAGCACGTTT

The L1 gene fragment containing NdeI and XhoI restriction sites and the vector pMAL are subjected to NdeI/XhoI double restriction enzyme treatment, and then the recovered gene fragment and pET28a containing corresponding viscous tail ends are subjected to ligation reaction by utilizing T4 DNA ligase, and the temperature is 16 ℃ for 10-15 h.

After the ligation reaction, the ligation product is transformed into host bacteria DH5 alpha for screening recombinants. And carrying out amplification culture on the screened monoclonal colonies, extracting plasmids, and sequencing by Shanghai bio-engineering company to obtain a gene sequence SEQ NO.6 of the fusion recombinant MBP-HPV6-L1 protein.

Example 6: construction of recombinant vector 6 His-SUMO-HPV 6L 1 vector

DNA fragment primers for amplification of SUMO: (cleavage sites are NdeI and BamHI, respectively)

Forward -SUMO-NdeI: GGAATTCCATATGTCTGACCAGGAAGCTAAACCGTC

Reverse-SUMO-BamHI: CGC GGATCCACCGGTCTGTTCCTGGTAAAC

DNA fragment primers for amplification of HPV 6L 1: (cleavage sites are BamHI and XhoI, respectively)

Forward-HPV6 L1-ApaI:5’ACTTCAGGATCC ATGTGGCGTCCGTCTGACTCTA

Reverse-HPV6 L1-XhoI:5’ATCTCACTCGAGCTA ACGTTTGGTT TTAGCACGTTT

The conditions and reaction system for PCR amplification of the SUMO gene and the L1 gene are as described in the above examples.

Enzyme digestion connection: the NdeI/BamHI double digestion treatment was performed on the SUMO gene fragment containing NdeI and BamHI cleavage sites and the vector pET-28a, and then the recovered gene fragment was ligated with pET28a containing the corresponding sticky ends using T4 DNA ligase at 16 ℃ for 10 to 15 hours.

Transformation and identification: after the ligation reaction, the ligation product is transformed into host bacteria DH5 alpha for screening recombinants. The selected monoclonal colonies were subjected to amplification culture and plasmid extraction, followed by sequencing by Souji Biotechnology, inc., to obtain a fusion recombinant vector pETSUMO-28a.

And (3) secondary enzyme digestion connection: the L1 gene fragment containing BamHI and Xho1 cleavage sites and the recombinant vector pETSUMO-28a were subjected to BamHI/Xho1 double cleavage treatment, and then the recovered gene fragment was subjected to ligation reaction with pETSUMO-28a containing the corresponding cohesive ends using T4 DNA ligase at 16 ℃ for 10 to 15 hours.

And (3) secondary transformation and identification: after the ligation reaction, the ligation product is transformed into host bacteria DH5 alpha for screening recombinants. And carrying out amplification culture on the screened monoclonal colonies, extracting plasmids, and sequencing by Shanghai bio-engineering company to obtain a gene sequence SEQ NO.7 of the fusion recombinant MBP-HPV6-L1 protein.

Example 7: expression of recombinant HPV L1 pentamer protein

The recombinant vectors of the examples 2, 3, 4, 5 and 6 with correct sequencing results are transformed into Escherichia coli BL21 host cells, and used as engineering bacteria for expressing recombinant proteins to express HPV L1 proteins. The engineering bacteria culture medium is 2YT culture medium (10 g/L tryptone, 5 g/L yeast powder, 10 g/L NaCl). Single spots of the cells containing the recombinant plasmid were picked up in 10ml of 2YT medium (containing 100. Mu.g/ml ampicillin), and cultured at 230 revolutions per minute (rpm) at 37 ℃ overnight with shaking. Transferring 5ml of overnight bacteria into 500 ml (containing 100 mu g/ml ampicillin) 2YT liquid culture medium, shaking and culturing at 37 ℃ until the recombinant engineering bacteria grow to OD600nm which is approximately equal to 0.4-1, adding IPTG with the final concentration of 0.2mM for induction and expressing the recombinant protein for more than 6 hours at 28 ℃.

Cell collection and disruption: centrifuging the fermentation culture, discarding the supernatant, harvesting thallus precipitate, and weighing; the pellet was washed with buffer L (pH 8.0, 50mM Tris,200 mM NaCl,5mM DTT), then resuspended in buffer L for ultrasonication, followed by centrifugation of the lysate by a high speed centrifuge (16000 rpm,30 min,4 ℃ C.) and the supernatant was collected.

Example 8: detection of expression quantity of recombinant HPV L1 pentamer protein in escherichia coli

Detecting the expression quantity of the Tag-HPV L1 pentamer protein in escherichia coli before sample loading by adopting an ELISA sandwich method, wherein the sample and a test sample are as follows:

coating antibody: self-made anti-HPV 6L 1 mouse monoclonal antibody.

Comparison products: high-purity HPV 6L 1 protein is prepared.

And (3) testing the sample: and diluting the test product Tag-HPV 6L 1 by using the sample diluent until the concentration is within the control product gradient dilution concentration range.

Enzyme-labeled antibody: the self-made horseradish peroxidase-labeled rabbit anti-HPV 6L 1 protein polyclonal antibody.

Results calculation the mean of the parallel wells was calculated to control line concentration OD ₄₅₀ Making a linear equation for the absorption values of the corresponding L1 protein antigens, wherein the variation coefficient between parallel sample pores is not more than 10%, and performing a linear regression equation R ² Not less than 0.980, OD of the sample ₄₅₀ Substituting the absorption value into an equation to calculate the content of the L1 protein antigen in the test sample after dilution, and multiplying the content by the corresponding dilution times to obtain the content of the L1 protein antigen in the test sample, which is shown in Table 1.

TABLE 1 detection of antigen content of Tag-HPV L1 protein after expression

Example 9: recombinant HPV L1 pentamer protein affinity chromatography

Affinity chromatography of recombinant proteins with GST tag: the affinity column was filled with 5ml of GST-Sepharose affinity chromatography medium, the column was equilibrated with Buffer L (pH 8.0, 50mM Tris,200 mM NaCl,5mM DTT), and the protein solution with GST or GST-SUMO tag of example 8 was loaded, and after completion, the column was washed with Buffer L until no protein flowed out, and the affinity was completed. The affinity medium was suspended in 5mL Buffer L, sampled for detection and the total amount of bound L1 protein in the medium was calculated.

Affinity chromatography of MBP-tagged recombinant proteins: the affinity column was loaded with 5ml of Amylose-Resin affinity chromatography medium, equilibrated with Buffer L (pH 8.0, 50mM Tris,200 mM NaCl,5mM DTT), and loaded with the protein solution with GST or GST-SUMO tag of example 8, and washed with Buffer L until no protein flowed out after completion of the affinity. The affinity medium was suspended in 5mL Buffer L, sampled for detection and the total amount of bound L1 protein in the medium was calculated.

Affinity chromatography of recombinant proteins with 6 his tag: 5ml of Ni-NTA gel was packed in a column, and 10 column volumes of an equilibration solution (50 mmol/L NaH2PO4, 300mmol/L NaCl,20mmol/L imidazole, pH8 adjusted with NaOH) were slowly added to the column to sufficiently equilibrate the Ni-NTA gel at a flow rate of 1ml/min. The supernatant from example 8, filtered and 6 × His-tagged, was taken and allowed to completely gel, and the gel was washed with 10 column volumes of equilibration solution and stored at a flow rate of 1ml/min. Eluting with the balance solution until no protein flows out, and finishing the affinity. Sampling to detect and calculate the total amount of bound L1 protein in the medium.

Example 10: enzyme digestion purification of recombinant Tag-HPV L1 protein

According to the mass ratio of the target protein to the protease of 100:1, adding enzyme amount, wherein the protein containing GST-HPV-L1 is cut by 3C protein, the protein containing GST-SUMO-HPV-L1 and 6 His-SUMO-HPV-L1 is cut by SENP1 protein, the protein containing Mbp-HPV-L1 is cut by Factor Xa protein, the protein containing 6 His-HPV-L1 is cut by Thrombin protein, and after 2h of mixed enzyme cutting, respectively eluting and collecting HPV 6L 1 pentamer protein solution obtained after each protein cutting.

The L1 protein solution after the enzyme digestion of the 3C enzyme with the GST tag is detected by SDS-PAGE gel electrophoresis, the result is shown in figure 1 affinity chromatography electrophoresis result, and the experiment shows that 90% of the target protein can be cut off. FIG. 2 shows that SENP1 protease cleaves a protein with GST-SUMO-HPV-L1 and is detected by SDS-PAGE gel electrophoresis. FIG. 3 shows that Factor Xa protease cleaves proteins with Mbp-HPV-L1, which is detected by SDS-PAGE gel electrophoresis. FIGS. 1-3 illustrate that the HPV 6L 1 protein of 55kDa is obtained.

The Thrombin protease did not cleave the 6 His-HPV-L1 protein; the protein solution of 6 His-SUMO-L1 cleaved with SENP1 was examined by SDS-PAGE gel electrophoresis, and the results are shown in FIG. 4, which shows that the SENP1 protease did not cleave the 6 His-SUMO-tagged fusion protein.

Example 11: purification of recombinant HPV L1 pentamer proteins

And (3) purifying by molecular sieve chromatography: the HPV 6L 1 pentamer protein collected in the previous example after enzyme digestion and purification is respectively purified, the HPV 6L 1 pentamer protein collected by ion exchange chromatography can be firstly subjected to further molecular sieve chromatography by using gel filtration medium of Superdex200 (produced by GE company) without ion exchange step, the mobile phase of the molecular sieve is pH8.0, 10 mM Tris,100 mM NaCl, and the fraction of the ultraviolet absorption peak of the HPV 6L 1 pentamer protein is collected.

Determination of sample purity after purification: and (3) sampling the collected protein solution, detecting by SDS-PAGE gel electrophoresis, and purifying the target protein HPV 6L 1 pentamer by molecular sieve chromatography to obtain the final purity of more than 98%, specifically shown in figure 5, and carrying out SDS-PAGE gel electrophoresis on the recombinant HPV 6L 1 pentamer protein purified by the molecular sieve chromatography.

Determination of the protein concentration of the sample: protein concentration was measured by the Bradford method using a standard sample of 2mg/ml BAS formulated from 100ug/ul to 500ug/ul and 10ul diluted BSA +200ul Bradford working solution was taken for the sample reaction: standard curve y = 0.0013 x-0.0294, R = 0.9986, OD of determination sample ₅₉₅ The results are shown in Table 2, where the protein concentration of the sample is calculated by substituting the standard curve.

TABLE 2 detection of recombinant HPV 6L 1 pentamer protein concentration by Bradford method

Note: the sample group 1 is an HPV L1 pentamer protein solution obtained by purifying GST-HPV L1 through a molecular sieve; the sample group 2 is an HPV L1 pentamer protein solution obtained by purifying GST-SUMO-HPV L1 through a molecular sieve; and the sample group 3 is an HPV L1 pentamer protein solution obtained by purifying the Mbp-HPV L1 by a molecular sieve.

Example 12: assembly of recombinant HPV 6L 1 pentameric proteins into VLPs

Under the conditions of the following salt concentration (NaCl) and pH value, HPV L1 pentamer solution sample groups 1, 2 and 3 are placed stably, a dynamic light scattering particle sizer of a Malvern Zetasizer NanoZS is used for measuring particle size and particle size distribution (the particle size distribution coefficient PdI value is an index of particle size dispersion degree, less than 0.05 is a highly uniform sample, 0.05-0.1 is a quasi-uniform sample, 0.1-0.3 is a sample with poor uniformity, more than 0.3 is a non-uniform sample), and the HPV 6L 1 pentamer proteins are assembled to obtain VLPs (PdI is less than 0.05) with uniform particle size.

Table 3 particle size detection of assembled HPV 6L 1 VLPs at different pH and salt concentrations

Note: the sample group 1 is a HPV L1VLP protein solution obtained by purifying GST-HPV L1 by a molecular sieve; the sample group 2 is a HPV L1VLP protein solution obtained by purifying GST-SUMO-HPV L1 by a molecular sieve; the sample group 3 is HPV L1VLP protein solution obtained after purifying Mbp-HPV L1 by a molecular sieve.

Example 13: dynamic Light Scattering (DLS) particle size determination of L1 pentamer and VLP proteins

The instrument is a dynamic light scattering particle size instrument of a Malvern Zetasizer NanoZS, HPV 6L 1 pentamer and HPV 6L 1VLP proteins finally prepared by each sample group are taken for detection, and the average particle size and the dispersity index PdI (indicating the uniformity of the proteins) are measured, so that the uniformity of the L1 pentamer and the VLP proteins finally prepared by each group of samples is indicated. The particle size distribution of the pentameric protein finally prepared in sample set 2 and the HPV 6L 1VLP protein obtained by assembling the same is shown in FIGS. 6 and 7.

Example 14: preparation of HPV 6L 1 pentamers and VLPs

According to the technique adopted in the above-mentioned examples 1-13 of the present invention, HPV 6L 1 proteins having sequences 11, 12, 13 were prepared, and all of the above proteins were purified to obtain proteins having a purity of 98% or more, and HPV 6L 1 pentamer proteins having an average particle size of 10-15nm PdI-straw 0.1 were obtained. Further assembling to obtain HPV 6L 1VLP protein with the average particle size of 45-65nm PdI & lt 0.1.

Example 15: morphological examination of HPV 6L 1 pentamers and VLPs

And (3) observing by a transmission electron microscope: the HPV 6L 1 pentamer proteins obtained by purification and the HPV 6L 1-VLP proteins obtained by assembly in the examples were observed by the biophysical department of Chinese academy of sciences using a transmission electron microscope platform. Frozen sample preparation and photographing process:

1) The liquid nitrogen box is filled with liquid nitrogen, and when the liquid level is not boiling, ethane is slowly injected into the cooled copper bowl to be cooled into liquid.

2) The copper mesh was treated for hydrophilicity in a PDC-32 type plasma cleaner.

3) In a Vitrobot TM Mark IV frozen sample preparation apparatus, 3.5. Mu.L of a pentamer and VLP sample was adsorbed on a 300 mesh QUANTIFOIL copper mesh, and after absorbing water for 4s, the sample was frozen by liquid ethane.

4) The samples were quickly transferred to liquid nitrogen for storage.

5) When the frozen photographs were collected, the electron dose was 20 e-/A2. Data were recorded by Gatan UltraScan 4000 CCD at 300 kV Titan Krios transmission electron microscope. The acceleration voltage was 300 kV.

The results show that in the HPV 6L 1 pentamer protein sample group, a large number of pentamer proteins with the diameter of about 10nm which is consistent with the theoretical size can be seen in the visual field; in the HPV 6L 1-VLP protein sample group, a large number of virus-like particles (VLPs) with diameters around 50nm, which are consistent with the theory, are found to be uniform in particle size. Wherein, the transmission electron micrograph of the sample obtained by the HPV 6L 1 pentamer after the GST-SUMO tag group (sample group 2) is enzyme-digested and purified is shown in figure 8, and the transmission electron micrograph of the VLP protein which is assembled after the Mbp tag group (sample group 3) is enzyme-digested and purified is shown in figure 9.

Example 16: HPV 6L 1 protein stock purity detection

Molecular exclusion high performance liquid chromatography assay: a chromatographic column Agilent Bio SEC-5um,2000 Ang, 7.8X 300mm, the column volume is about 15 m1, and the molecular weight range is more than or equal to lO and OOOkDa; taking 0.1mol/L phosphate buffer solution (25.8 g of disodium hydrogen phosphate and 4.37g of sodium dihydrogen phosphate are weighed and dissolved by adding ultrapure water, adjusting the pH to 6.8 by using phosphoric acid, and making the volume of the ultrapure water into 1000 ml) with the pH of 6.8 as a mobile phase; the flow rate is 1ml/min; the detection wavelength is 280nm; the column temperature is 25 ℃, the sample loading amount is not less than 20ug, the theoretical plate number of the main peak of the sample is not less than 1000, the tailing factor is less than 2.0, 5 needles are continuously injected, and the relative standard deviation of the peak area is not more than 3%.

The protein stock solutions of the HPV 6L 1 pentamer finally prepared and the assembled VLP of the purified sample 2 group are respectively diluted to the concentration of 1mg/ml, the sample loading amount is 20ul, the diluted protein stock solutions are injected into a high pressure liquid chromatograph, the purity is calculated according to the area normalization method according to the detection method, the purity of all the processed proteins is more than 98 percent, and the results are shown in an attached figure 10, a table 4, an attached figure 11 and a table 5.

TABLE 4 HPLC PROTEIN PURITY TESTING OF HPV6 L1 PENTAMERS

TABLE 5 HPLC PROTEIN PURITY TESTING OF VLPs AFTER HPV6 L1 ASSEMBLY

Peak(s)	Retention time	Area of	Area%
				1	13.995	2615610	100.00
In total		2615610	100.00

Example 17: HPV VLP stability experiments

The HPV6 VLP proteins finally prepared for each sample group were subjected to particle size detection under the buffer conditions shown in the following table at 25 ℃ for 14 to 28 days, and the results shown in the following table demonstrate that the HPV6 VLP is stable to storage at pH 5.0 to 5.9 and a salt concentration of 500 to 2000 mM. The detection results of the HPV6 VLPs obtained in sample group 3 after they were left for 14-28 days at pH 5.0 to 5.9 and at a salt concentration of 500-2000 mM are shown in the following table.

TABLE 6 particle size test results of HPV6 L1 VLPs left at 25 ℃ for 14-28 days

Example 18: preparation of monovalent vaccines comprising HPV L1 pentamers or VLPs

And adsorbing the HPV 6L 1 pentamer or VLP protein stock solution containing each sample group with an aluminum hydroxide adjuvant physiological saline solution according to the ratio of protein to aluminum content of 1.

Example 19: immunogenicity assays for HPV L1 pentamers and VLPs

The L1 pentamer or VLP vaccine is taken respectively, and is added with sterilized normal saline to be diluted into the pentamer or VLP protein vaccine with the concentration of 20 mu g/ml respectively, and BALB/c mice are injected into each 0.1ml of muscle, and 10 mice are injected into each group. Mice were boosted every 4 weeks for 2 total immunizations. After 4 weeks of boosting, neutralizing antibody titers against homotype HPV were determined in the sera of mice after each immunization using a pseudovirus cell neutralization assay, respectively, and the results are shown in fig. 12 and 13.

The results show that the neutralizing antibody can reach a high level 4 weeks after secondary immunization when the HPV L1 pentamer and VLP protein vaccine are used for vaccinating a mouse. The experimental result proves that the HPV L1 pentamer and the assembled VLP vaccine can generate neutralizing antibodies in animals, which indicates that the HPV L1 pentamer and the VLP protein vaccine have immunogenicity in human clinical tests, namely, the HPV homotype virus-caused diseases can be prevented.

SEQUENCE LISTING

<110> Beijing Kangle guard Biotechnology Ltd

<120> 6 type recombinant human papilloma virus-like particle and preparation method thereof

<130> 2014

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 1503

<212> DNA

<213> Artificial sequence

<400> 1

atgtggcggc ctagcgacag cacagtatat gtgcctcctc ctaaccctgt atccaaagtt 60

gttgccacgg atgcttatgt tactcgcacc aacatatttt atcatgccag cagttctaga 120

cttcttgcag tgggacatcc ttatttttcc ataaaacggg ctaacaaaac tgttgtgcca 180

aaggtgtcag gatatcaata cagggtattt aaggtggtgt taccagatcc taacaaattt 240

gcattgcctg actcgtctct tttcgatccc acaacacaac gtttagtatg ggcatgcaca 300

ggcctagagg tgggcagggg acagccatta ggtgtgggtg taagtggaca tcctttccta 360

aataaatatg atgatgttga aaattcaggg agtggtggta accctggaca ggataacagg 420

gttaatgtag gtatggatta taaacaaaca caattatgca tggttggatg tgccccccct 480

ttgggcgagc attggggtaa aggtaaacag tgtactaata cacctgtaca ggctggtgac 540

tgcccgccct tagaacttat taccagtgtt atacaggatg gcgatatggt tgacacaggc 600

tttggtgcta tgaattttgc tgatttgcag accaataaat cagatgttcc tattgacata 660

tgtggcacta catgtaaata tccagattat ttacaaatgg ctgcagaccc atatggtgat 720

agattatttt tttttctacg gaaggaacaa atgtttgcca gacatttttt taacagggct 780

ggcgaggtgg gggaacctgt gcctgataca cttataatta agggtagtgg aaatcgcacg 840

tctgtaggga gtagtatata tgttaacacc ccgagcggct ctttggtgtc ctctgaggca 900

caattgttta ataagccata ttggctacaa aaagcccagg gacataacaa tggtatttgt 960

tggggtaatc aactgtttgt tactgtggta gataccacac gcagtaccaa catgacatta 1020

tgtgcatccg taactacatc ttccacatac accaattctg attataaaga gtacatgcgt 1080

catgtggaag agtatgattt acaatttatt tttcaattat gtagcattac attgtctgct 1140

gaagtaatgg cctatattca cacaatgaat ccctctgttt tggaagactg gaactttggg 1200

ttatcgcctc ccccaaatgg tacattagaa gatacctata ggtatgtgca gtcacaggcc 1260

attacctgtc aaaagcccac tcctgaaaag gaaaagccag atccctataa gaaccttagt 1320

ttttgggagg ttaatttaaa agaaaagttt tctagtgaat tggatcagta tcctttggga 1380

cgcaagtttt tgttacaaag tggatatagg ggacggtcct ctattcgtac aggtgttaag 1440

cgccctgctg tttccaaagc ctctgctgcc cctaaacgta agcgcgccaa aactaaaagg 1500

taa 1503

<210> 2

<211> 1500

<212> DNA

<213> Artificial sequence

<400> 2

atgtggcgtc cgtctgactc taccgtttac gttccgccgc cgaacccggt ttctaaagtt 60

gttgctaccg acgcttacgt tacccgtacc aacatcttct accacgcttc ttcttctcgt 120

ctgctggctg ttggtcaccc gtacttctct atcaaacgtg ctaacaaaac cgttgttccg 180

aaagtttctg gttaccagta ccgtgttttc aaagttgttc tgccggaccc gaacaaattc 240

gctctgccgg actcttctct gttcgacccg accacccagc gtctggtttg ggcttgcacc 300

ggtctggaag ttggtcgtgg tcagccgctg ggtgttggtg tttctggtca cccgttcctg 360

aacaaatacg acgacgttga aaactctggt tctggtggta acccgggtca ggacaaccgt 420

gttaacgttg gtatggacta caaacagacc cagctgtgca tggttggttg cgctccgccg 480

ctgggtgaac actggggtaa aggtaaacag tgcaccaaca ccccggttca ggctggtgac 540

tgcccgccgc tggaactgat cacctctgtt atccaggacg gtgacatggt tgacaccggt 600

ttcggtgcta tgaacttcgc tgacctgcag accaacaaat ctgacgttcc gatcgacatc 660

tgcggtacca cctgcaaata cccggactac ctgcagatgg ctgctgaccc gtacggtgac 720

cgtctgttct tcttcctgcg taaagaacag atgttcgctc gtcacttctt caaccgtgct 780

ggtgaagttg gtgaaccggt tccggacacc ctgatcatca aaggttctgg taaccgtacc 840

tctgttggtt cttctatcta cgttaacacc ccgtctggtt ctctggtttc ttctgaagct 900

cagctgttca acaaaccgta ctggctgcag aaagctcagg gtcacaacaa cggtatctgc 960

tggggtaacc agctgttcgt taccgttgtt gacaccaccc gttctaccaa catgaccctg 1020

tgcgcttctg ttaccacctc ttctacctac accaactctg actacaaaga atacatgcgt 1080

cacgttgaag aatacgacct gcagttcatc ttccagctgt gctctatcac cctgtctgct 1140

gaagttatgg cttacatcca caccatgaac ccgtctgttc tggaagactg gaacttcggt 1200

ctgtctccgc cgccgaacgg taccctggaa gacacctacc gttacgttca gtctcaggct 1260

atcacctgcc agaaaccgac cccggaaaaa gaaaaaccgg acccgtacaa aaacctgtct 1320

ttctgggaag ttaacctgaa agaaaaattc tcttctgaac tggaccagta cccgctgggt 1380

cgtaaattcc tgctgcagtc tggttaccgt ggtcgttctt ctatccgtac cggtgttaaa 1440

cgtccggctg tttctaaagc ttctgctgct ccgaaacgta aacgtgctaa aaccaaacgt 1500

<210> 3

<211> 2193

<212> DNA

<213> Artificial sequence

<400> 3

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gcccctggga tccatgtggc gtccgtctga ctctaccgtt 720

tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttacccgt 780

accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtacttc 840

tctatcaaac gtgctaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 900

ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 960

ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1020

ctgggtgttg gtgtttctgg tcacccgttc ctgaacaaat acgacgacgt tgaaaactct 1080

ggttctggtg gtaacccggg tcaggacaac cgtgttaacg ttggtatgga ctacaaacag 1140

acccagctgt gcatggttgg ttgcgctccg ccgctgggtg aacactgggg taaaggtaaa 1200

cagtgcacca acaccccggt tcaggctggt gactgcccgc cgctggaact gatcacctct 1260

gttatccagg acggtgacat ggttgacacc ggtttcggtg ctatgaactt cgctgacctg 1320

cagaccaaca aatctgacgt tccgatcgac atctgcggta ccacctgcaa atacccggac 1380

tacctgcaga tggctgctga cccgtacggt gaccgtctgt tcttcttcct gcgtaaagaa 1440

cagatgttcg ctcgtcactt cttcaaccgt gctggtgaag ttggtgaacc ggttccggac 1500

accctgatca tcaaaggttc tggtaaccgt acctctgttg gttcttctat ctacgttaac 1560

accccgtctg gttctctggt ttcttctgaa gctcagctgt tcaacaaacc gtactggctg 1620

cagaaagctc agggtcacaa caacggtatc tgctggggta accagctgtt cgttaccgtt 1680

gttgacacca cccgttctac caacatgacc ctgtgcgctt ctgttaccac ctcttctacc 1740

tacaccaact ctgactacaa agaatacatg cgtcacgttg aagaatacga cctgcagttc 1800

atcttccagc tgtgctctat caccctgtct gctgaagtta tggcttacat ccacaccatg 1860

aacccgtctg ttctggaaga ctggaacttc ggtctgtctc cgccgccgaa cggtaccctg 1920

gaagacacct accgttacgt tcagtctcag gctatcacct gccagaaacc gaccccggaa 1980

aaagaaaaac cggacccgta caaaaacctg tctttctggg aagttaacct gaaagaaaaa 2040

ttctcttctg aactggacca gtacccgctg ggtcgtaaat tcctgctgca gtctggttac 2100

cgtggtcgtt cttctatccg taccggtgtt aaacgtccgg ctgtttctaa agcttctgct 2160

gctccgaaac gtaaacgtgc taaaaccaaa cgt 2193

<210> 4

<211> 2475

<212> DNA

<213> Artificial sequence

<400> 4

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720

ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780

atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840

cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900

aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960

cagaccggtg gatccatgtg gcgtccgtct gactctaccg tttacgttcc gccgccgaac 1020

ccggtttcta aagttgttgc taccgacgct tacgttaccc gtaccaacat cttctaccac 1080

gcttcttctt ctcgtctgct ggctgttggt cacccgtact tctctatcaa acgtgctaac 1140

aaaaccgttg ttccgaaagt ttctggttac cagtaccgtg ttttcaaagt tgttctgccg 1200

gacccgaaca aattcgctct gccggactct tctctgttcg acccgaccac ccagcgtctg 1260

gtttgggctt gcaccggtct ggaagttggt cgtggtcagc cgctgggtgt tggtgtttct 1320

ggtcacccgt tcctgaacaa atacgacgac gttgaaaact ctggttctgg tggtaacccg 1380

ggtcaggaca accgtgttaa cgttggtatg gactacaaac agacccagct gtgcatggtt 1440

ggttgcgctc cgccgctggg tgaacactgg ggtaaaggta aacagtgcac caacaccccg 1500

gttcaggctg gtgactgccc gccgctggaa ctgatcacct ctgttatcca ggacggtgac 1560

atggttgaca ccggtttcgg tgctatgaac ttcgctgacc tgcagaccaa caaatctgac 1620

gttccgatcg acatctgcgg taccacctgc aaatacccgg actacctgca gatggctgct 1680

gacccgtacg gtgaccgtct gttcttcttc ctgcgtaaag aacagatgtt cgctcgtcac 1740

ttcttcaacc gtgctggtga agttggtgaa ccggttccgg acaccctgat catcaaaggt 1800

tctggtaacc gtacctctgt tggttcttct atctacgtta acaccccgtc tggttctctg 1860

gtttcttctg aagctcagct gttcaacaaa ccgtactggc tgcagaaagc tcagggtcac 1920

aacaacggta tctgctgggg taaccagctg ttcgttaccg ttgttgacac cacccgttct 1980

accaacatga ccctgtgcgc ttctgttacc acctcttcta cctacaccaa ctctgactac 2040

aaagaataca tgcgtcacgt tgaagaatac gacctgcagt tcatcttcca gctgtgctct 2100

atcaccctgt ctgctgaagt tatggcttac atccacacca tgaacccgtc tgttctggaa 2160

gactggaact tcggtctgtc tccgccgccg aacggtaccc tggaagacac ctaccgttac 2220

gttcagtctc aggctatcac ctgccagaaa ccgaccccgg aaaaagaaaa accggacccg 2280

tacaaaaacc tgtctttctg ggaagttaac ctgaaagaaa aattctcttc tgaactggac 2340

cagtacccgc tgggtcgtaa attcctgctg cagtctggtt accgtggtcg ttcttctatc 2400

cgtaccggtg ttaaacgtcc ggctgtttct aaagcttctg ctgctccgaa acgtaaacgt 2460

gctaaaacca aacgt 2475

<210> 5

<211> 2673

<212> DNA

<213> Artificial sequence

<400> 5

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcagaa ttcatgtggc gtccgtctga ctctaccgtt 1200

tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttacccgt 1260

accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtacttc 1320

tctatcaaac gtgctaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 1380

ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 1440

ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1500

ctgggtgttg gtgtttctgg tcacccgttc ctgaacaaat acgacgacgt tgaaaactct 1560

ggttctggtg gtaacccggg tcaggacaac cgtgttaacg ttggtatgga ctacaaacag 1620

acccagctgt gcatggttgg ttgcgctccg ccgctgggtg aacactgggg taaaggtaaa 1680

cagtgcacca acaccccggt tcaggctggt gactgcccgc cgctggaact gatcacctct 1740

gttatccagg acggtgacat ggttgacacc ggtttcggtg ctatgaactt cgctgacctg 1800

cagaccaaca aatctgacgt tccgatcgac atctgcggta ccacctgcaa atacccggac 1860

tacctgcaga tggctgctga cccgtacggt gaccgtctgt tcttcttcct gcgtaaagaa 1920

cagatgttcg ctcgtcactt cttcaaccgt gctggtgaag ttggtgaacc ggttccggac 1980

accctgatca tcaaaggttc tggtaaccgt acctctgttg gttcttctat ctacgttaac 2040

accccgtctg gttctctggt ttcttctgaa gctcagctgt tcaacaaacc gtactggctg 2100

cagaaagctc agggtcacaa caacggtatc tgctggggta accagctgtt cgttaccgtt 2160

gttgacacca cccgttctac caacatgacc ctgtgcgctt ctgttaccac ctcttctacc 2220

tacaccaact ctgactacaa agaatacatg cgtcacgttg aagaatacga cctgcagttc 2280

atcttccagc tgtgctctat caccctgtct gctgaagtta tggcttacat ccacaccatg 2340

aacccgtctg ttctggaaga ctggaacttc ggtctgtctc cgccgccgaa cggtaccctg 2400

gaagacacct accgttacgt tcagtctcag gctatcacct gccagaaacc gaccccggaa 2460

aaagaaaaac cggacccgta caaaaacctg tctttctggg aagttaacct gaaagaaaaa 2520

ttctcttctg aactggacca gtacccgctg ggtcgtaaat tcctgctgca gtctggttac 2580

cgtggtcgtt cttctatccg taccggtgtt aaacgtccgg ctgtttctaa agcttctgct 2640

gctccgaaac gtaaacgtgc taaaaccaaa cgt 2673

<210> 6

<211> 1563

<212> DNA

<213> Artificial sequence

<400> 6

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atgatgtggc gtccgtctga ctctaccgtt tacgttccgc cgccgaaccc ggtttctaaa 120

gttgttgcta ccgacgctta cgttacccgt accaacatct tctaccacgc ttcttcttct 180

cgtctgctgg ctgttggtca cccgtacttc tctatcaaac gtgctaacaa aaccgttgtt 240

ccgaaagttt ctggttacca gtaccgtgtt ttcaaagttg ttctgccgga cccgaacaaa 300

ttcgctctgc cggactcttc tctgttcgac ccgaccaccc agcgtctggt ttgggcttgc 360

accggtctgg aagttggtcg tggtcagccg ctgggtgttg gtgtttctgg tcacccgttc 420

ctgaacaaat acgacgacgt tgaaaactct ggttctggtg gtaacccggg tcaggacaac 480

cgtgttaacg ttggtatgga ctacaaacag acccagctgt gcatggttgg ttgcgctccg 540

ccgctgggtg aacactgggg taaaggtaaa cagtgcacca acaccccggt tcaggctggt 600

gactgcccgc cgctggaact gatcacctct gttatccagg acggtgacat ggttgacacc 660

ggtttcggtg ctatgaactt cgctgacctg cagaccaaca aatctgacgt tccgatcgac 720

atctgcggta ccacctgcaa atacccggac tacctgcaga tggctgctga cccgtacggt 780

gaccgtctgt tcttcttcct gcgtaaagaa cagatgttcg ctcgtcactt cttcaaccgt 840

gctggtgaag ttggtgaacc ggttccggac accctgatca tcaaaggttc tggtaaccgt 900

acctctgttg gttcttctat ctacgttaac accccgtctg gttctctggt ttcttctgaa 960

gctcagctgt tcaacaaacc gtactggctg cagaaagctc agggtcacaa caacggtatc 1020

tgctggggta accagctgtt cgttaccgtt gttgacacca cccgttctac caacatgacc 1080

ctgtgcgctt ctgttaccac ctcttctacc tacaccaact ctgactacaa agaatacatg 1140

cgtcacgttg aagaatacga cctgcagttc atcttccagc tgtgctctat caccctgtct 1200

gctgaagtta tggcttacat ccacaccatg aacccgtctg ttctggaaga ctggaacttc 1260

ggtctgtctc cgccgccgaa cggtaccctg gaagacacct accgttacgt tcagtctcag 1320

gctatcacct gccagaaacc gaccccggaa aaagaaaaac cggacccgta caaaaacctg 1380

tctttctggg aagttaacct gaaagaaaaa ttctcttctg aactggacca gtacccgctg 1440

ggtcgtaaat tcctgctgca gtctggttac cgtggtcgtt cttctatccg taccggtgtt 1500

aaacgtccgg ctgtttctaa agcttctgct gctccgaaac gtaaacgtgc taaaaccaaa 1560

cgt 1563

<210> 7

<211> 1854

<212> DNA

<213> Artificial sequence

<400> 7

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atgtctgacc aggaagctaa accgtctacc gaagacctgg gtgacaaaaa agaaggtgaa 120

tacatcaaac tgaaagttat cggtcaggac tcttctgaaa tccacttcaa agttaaaatg 180

accacccacc tgaaaaaact gaaagaatct tactgccagc gtcagggtgt tccgatgaac 240

tctctgcgtt tcctgttcga aggtcagcgt atcgctgaca accacacccc gaaagaactg 300

ggtatggaag aagaagacgt tatcgaagtt taccaggaac agaccggtgg atccatgtgg 360

cgtccgtctg actctaccgt ttacgttccg ccgccgaacc cggtttctaa agttgttgct 420

accgacgctt acgttacccg taccaacatc ttctaccacg cttcttcttc tcgtctgctg 480

gctgttggtc acccgtactt ctctatcaaa cgtgctaaca aaaccgttgt tccgaaagtt 540

tctggttacc agtaccgtgt tttcaaagtt gttctgccgg acccgaacaa attcgctctg 600

ccggactctt ctctgttcga cccgaccacc cagcgtctgg tttgggcttg caccggtctg 660

gaagttggtc gtggtcagcc gctgggtgtt ggtgtttctg gtcacccgtt cctgaacaaa 720

tacgacgacg ttgaaaactc tggttctggt ggtaacccgg gtcaggacaa ccgtgttaac 780

gttggtatgg actacaaaca gacccagctg tgcatggttg gttgcgctcc gccgctgggt 840

gaacactggg gtaaaggtaa acagtgcacc aacaccccgg ttcaggctgg tgactgcccg 900

ccgctggaac tgatcacctc tgttatccag gacggtgaca tggttgacac cggtttcggt 960

gctatgaact tcgctgacct gcagaccaac aaatctgacg ttccgatcga catctgcggt 1020

accacctgca aatacccgga ctacctgcag atggctgctg acccgtacgg tgaccgtctg 1080

ttcttcttcc tgcgtaaaga acagatgttc gctcgtcact tcttcaaccg tgctggtgaa 1140

gttggtgaac cggttccgga caccctgatc atcaaaggtt ctggtaaccg tacctctgtt 1200

ggttcttcta tctacgttaa caccccgtct ggttctctgg tttcttctga agctcagctg 1260

ttcaacaaac cgtactggct gcagaaagct cagggtcaca acaacggtat ctgctggggt 1320

aaccagctgt tcgttaccgt tgttgacacc acccgttcta ccaacatgac cctgtgcgct 1380

tctgttacca cctcttctac ctacaccaac tctgactaca aagaatacat gcgtcacgtt 1440

gaagaatacg acctgcagtt catcttccag ctgtgctcta tcaccctgtc tgctgaagtt 1500

atggcttaca tccacaccat gaacccgtct gttctggaag actggaactt cggtctgtct 1560

ccgccgccga acggtaccct ggaagacacc taccgttacg ttcagtctca ggctatcacc 1620

tgccagaaac cgaccccgga aaaagaaaaa ccggacccgt acaaaaacct gtctttctgg 1680

gaagttaacc tgaaagaaaa attctcttct gaactggacc agtacccgct gggtcgtaaa 1740

ttcctgctgc agtctggtta ccgtggtcgt tcttctatcc gtaccggtgt taaacgtccg 1800

gctgtttcta aagcttctgc tgctccgaaa cgtaaacgtg ctaaaaccaa acgt 1854

<210> 8

<211> 731

<212> PRT

<213> Artificial sequence

<400> 8

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro

1 5 10 15

Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu

20 25 30

Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu

35 40 45

Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys

50 55 60

Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn

65 70 75 80

Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu

85 90 95

Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser

100 105 110

Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu

115 120 125

Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn

130 135 140

Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp

145 150 155 160

Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu

165 170 175

Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr

180 185 190

Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala

195 200 205

Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu

210 215 220

Phe Gln Gly Pro Leu Gly Ser Met Trp Arg Pro Ser Asp Ser Thr Val

225 230 235 240

Tyr Val Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala

245 250 255

Tyr Val Thr Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu

260 265 270

Leu Ala Val Gly His Pro Tyr Phe Ser Ile Lys Arg Ala Asn Lys Thr

275 280 285

Val Val Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val

290 295 300

Leu Pro Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp

305 310 315 320

Pro Thr Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly

325 330 335

Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Phe Leu Asn

340 345 350

Lys Tyr Asp Asp Val Glu Asn Ser Gly Ser Gly Gly Asn Pro Gly Gln

355 360 365

Asp Asn Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys

370 375 380

Met Val Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly Lys

385 390 395 400

Gln Cys Thr Asn Thr Pro Val Gln Ala Gly Asp Cys Pro Pro Leu Glu

405 410 415

Leu Ile Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe

420 425 430

Gly Ala Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val Pro

435 440 445

Ile Asp Ile Cys Gly Thr Thr Cys Lys Tyr Pro Asp Tyr Leu Gln Met

450 455 460

Ala Ala Asp Pro Tyr Gly Asp Arg Leu Phe Phe Phe Leu Arg Lys Glu

465 470 475 480

Gln Met Phe Ala Arg His Phe Phe Asn Arg Ala Gly Glu Val Gly Glu

485 490 495

Pro Val Pro Asp Thr Leu Ile Ile Lys Gly Ser Gly Asn Arg Thr Ser

500 505 510

Val Gly Ser Ser Ile Tyr Val Asn Thr Pro Ser Gly Ser Leu Val Ser

515 520 525

Ser Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln

530 535 540

Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val

545 550 555 560

Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val Thr

565 570 575

Thr Ser Ser Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg His

580 585 590

Val Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr

595 600 605

Leu Ser Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser Val

610 615 620

Leu Glu Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu

625 630 635 640

Glu Asp Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln Lys

645 650 655

Pro Thr Pro Glu Lys Glu Lys Pro Asp Pro Tyr Lys Asn Leu Ser Phe

660 665 670

Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln Tyr

675 680 685

Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg Ser

690 695 700

Ser Ile Arg Thr Gly Val Lys Arg Pro Ala Val Ser Lys Ala Ser Ala

705 710 715 720

Ala Pro Lys Arg Lys Arg Ala Lys Thr Lys Arg

725 730

<210> 9

<211> 825

<212> PRT

<213> Artificial sequence

<400> 9

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro

1 5 10 15

Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu

20 25 30

Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu

35 40 45

Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys

50 55 60

Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn

65 70 75 80

Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu

85 90 95

Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser

100 105 110

Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu

115 120 125

Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn

130 135 140

Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp

145 150 155 160

Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu

165 170 175

Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr

180 185 190

Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala

195 200 205

Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Glu Val Leu

210 215 220

Phe Gln Gly Pro Ser Asp Gln Glu Ala Lys Pro Ser Thr Glu Asp Leu

225 230 235 240

Gly Asp Lys Lys Glu Gly Glu Tyr Ile Lys Leu Lys Val Ile Gly Gln

245 250 255

Asp Ser Ser Glu Ile His Phe Lys Val Lys Met Thr Thr His Leu Lys

260 265 270

Lys Leu Lys Glu Ser Tyr Cys Gln Arg Gln Gly Val Pro Met Asn Ser

275 280 285

Leu Arg Phe Leu Phe Glu Gly Gln Arg Ile Ala Asp Asn His Thr Pro

290 295 300

Lys Glu Leu Gly Met Glu Glu Glu Asp Val Ile Glu Val Tyr Gln Glu

305 310 315 320

Gln Thr Gly Gly Ser Met Trp Arg Pro Ser Asp Ser Thr Val Tyr Val

325 330 335

Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala Tyr Val

340 345 350

Thr Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu Leu Ala

355 360 365

Val Gly His Pro Tyr Phe Ser Ile Lys Arg Ala Asn Lys Thr Val Val

370 375 380

Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val Leu Pro

385 390 395 400

Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp Pro Thr

405 410 415

Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly Arg Gly

420 425 430

Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Phe Leu Asn Lys Tyr

435 440 445

Asp Asp Val Glu Asn Ser Gly Ser Gly Gly Asn Pro Gly Gln Asp Asn

450 455 460

Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys Met Val

465 470 475 480

Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly Lys Gln Cys

485 490 495

Thr Asn Thr Pro Val Gln Ala Gly Asp Cys Pro Pro Leu Glu Leu Ile

500 505 510

Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala

515 520 525

Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val Pro Ile Asp

530 535 540

Ile Cys Gly Thr Thr Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ala Ala

545 550 555 560

Asp Pro Tyr Gly Asp Arg Leu Phe Phe Phe Leu Arg Lys Glu Gln Met

565 570 575

Phe Ala Arg His Phe Phe Asn Arg Ala Gly Glu Val Gly Glu Pro Val

580 585 590

Pro Asp Thr Leu Ile Ile Lys Gly Ser Gly Asn Arg Thr Ser Val Gly

595 600 605

Ser Ser Ile Tyr Val Asn Thr Pro Ser Gly Ser Leu Val Ser Ser Glu

610 615 620

Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln Gly His

625 630 635 640

Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp

645 650 655

Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val Thr Thr Ser

660 665 670

Ser Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg His Val Glu

675 680 685

Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr Leu Ser

690 695 700

Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser Val Leu Glu

705 710 715 720

Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu Glu Asp

725 730 735

Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln Lys Pro Thr

740 745 750

Pro Glu Lys Glu Lys Pro Asp Pro Tyr Lys Asn Leu Ser Phe Trp Glu

755 760 765

Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln Tyr Pro Leu

770 775 780

Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg Ser Ser Ile

785 790 795 800

Arg Thr Gly Val Lys Arg Pro Ala Val Ser Lys Ala Ser Ala Ala Pro

805 810 815

Lys Arg Lys Arg Ala Lys Thr Lys Arg

820 825

<210> 10

<211> 891

<212> PRT

<213> Artificial sequence

<400> 10

Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys

1 5 10 15

Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr

20 25 30

Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe

35 40 45

Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala

50 55 60

His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile

65 70 75 80

Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp

85 90 95

Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu

100 105 110

Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys

115 120 125

Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly

130 135 140

Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro

145 150 155 160

Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys

165 170 175

Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly

180 185 190

Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp

195 200 205

Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala

210 215 220

Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys

225 230 235 240

Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser

245 250 255

Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro

260 265 270

Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp

275 280 285

Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala

290 295 300

Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala

305 310 315 320

Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln

325 330 335

Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala

340 345 350

Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn

355 360 365

Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile

370 375 380

Glu Gly Arg Ile Ser Glu Phe Met Trp Arg Pro Ser Asp Ser Thr Val

385 390 395 400

Tyr Val Pro Pro Pro Asn Pro Val Ser Lys Val Val Ala Thr Asp Ala

405 410 415

Tyr Val Thr Arg Thr Asn Ile Phe Tyr His Ala Ser Ser Ser Arg Leu

420 425 430

Leu Ala Val Gly His Pro Tyr Phe Ser Ile Lys Arg Ala Asn Lys Thr

435 440 445

Val Val Pro Lys Val Ser Gly Tyr Gln Tyr Arg Val Phe Lys Val Val

450 455 460

Leu Pro Asp Pro Asn Lys Phe Ala Leu Pro Asp Ser Ser Leu Phe Asp

465 470 475 480

Pro Thr Thr Gln Arg Leu Val Trp Ala Cys Thr Gly Leu Glu Val Gly

485 490 495

Arg Gly Gln Pro Leu Gly Val Gly Val Ser Gly His Pro Phe Leu Asn

500 505 510

Lys Tyr Asp Asp Val Glu Asn Ser Gly Ser Gly Gly Asn Pro Gly Gln

515 520 525

Asp Asn Arg Val Asn Val Gly Met Asp Tyr Lys Gln Thr Gln Leu Cys

530 535 540

Met Val Gly Cys Ala Pro Pro Leu Gly Glu His Trp Gly Lys Gly Lys

545 550 555 560

Gln Cys Thr Asn Thr Pro Val Gln Ala Gly Asp Cys Pro Pro Leu Glu

565 570 575

Leu Ile Thr Ser Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly Phe

580 585 590

Gly Ala Met Asn Phe Ala Asp Leu Gln Thr Asn Lys Ser Asp Val Pro

595 600 605

Ile Asp Ile Cys Gly Thr Thr Cys Lys Tyr Pro Asp Tyr Leu Gln Met

610 615 620

Ala Ala Asp Pro Tyr Gly Asp Arg Leu Phe Phe Phe Leu Arg Lys Glu

625 630 635 640

Gln Met Phe Ala Arg His Phe Phe Asn Arg Ala Gly Glu Val Gly Glu

645 650 655

Pro Val Pro Asp Thr Leu Ile Ile Lys Gly Ser Gly Asn Arg Thr Ser

660 665 670

Val Gly Ser Ser Ile Tyr Val Asn Thr Pro Ser Gly Ser Leu Val Ser

675 680 685

Ser Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Lys Ala Gln

690 695 700

Gly His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val

705 710 715 720

Val Asp Thr Thr Arg Ser Thr Asn Met Thr Leu Cys Ala Ser Val Thr

725 730 735

Thr Ser Ser Thr Tyr Thr Asn Ser Asp Tyr Lys Glu Tyr Met Arg His

740 745 750

Val Glu Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Ser Ile Thr

755 760 765

Leu Ser Ala Glu Val Met Ala Tyr Ile His Thr Met Asn Pro Ser Val

770 775 780

Leu Glu Asp Trp Asn Phe Gly Leu Ser Pro Pro Pro Asn Gly Thr Leu

785 790 795 800

Glu Asp Thr Tyr Arg Tyr Val Gln Ser Gln Ala Ile Thr Cys Gln Lys

805 810 815

Pro Thr Pro Glu Lys Glu Lys Pro Asp Pro Tyr Lys Asn Leu Ser Phe

820 825 830

Trp Glu Val Asn Leu Lys Glu Lys Phe Ser Ser Glu Leu Asp Gln Tyr

835 840 845

Pro Leu Gly Arg Lys Phe Leu Leu Gln Ser Gly Tyr Arg Gly Arg Ser

850 855 860

Ser Ile Arg Thr Gly Val Lys Arg Pro Ala Val Ser Lys Ala Ser Ala

865 870 875 880

Ala Pro Lys Arg Lys Arg Ala Lys Thr Lys Arg

885 890

<210> 11

<211> 2088

<212> DNA

<213> Artificial sequence

<400> 11

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gccctctgac tctaccgttt acgttccgcc gccgaacccg 720

gtttctaaag ttgttgctac cgacgcttac gttacccgta ccaacatctt ctaccacgct 780

tcttcttctc gtctgctggc tgttggtcac ccgtacttct ctatcaaacg tgctaacaaa 840

accgttgttc cgaaagtttc tggttaccag taccgtgttt tcaaagttgt tctgccggac 900

ccgaacaaat tcgctctgcc ggactcttct ctgttcgacc cgaccaccca gcgtctggtt 960

tgggcttgca ccggtctgga agttggtcgt ggtcagccgc tgggtgttgg tgtttctggt 1020

cacccgttcc tgaacaaata cgacgacgtt gaaaactctg gttctggtgg taacccgggt 1080

caggacaacc gtgttaacgt tggtatggac tacaaacaga cccagctgtg catggttggt 1140

tgcgctccgc cgctgggtga acactggggt aaaggtaaac agtgcaccaa caccccggtt 1200

caggctggtg actgcccgcc gctggaactg atcacctctg ttatccagga cggtgacatg 1260

gttgacaccg gtttcggtgc tatgaacttc gctgacctgc agaccaacaa atctgacgtt 1320

ccgatcgaca tctgcggtac cacctgcaaa tacccggact acctgcagat ggctgctgac 1380

ccgtacggtg accgtctgtt cttcttcctg cgtaaagaac agatgttcgc tcgtcacttc 1440

ttcaaccgtg ctggtgaagt tggtgaaccg gttccggaca ccctgatcat caaaggttct 1500

ggtaaccgta cctctgttgg ttcttctatc tacgttaaca ccccgtctgg ttctctggtt 1560

tcttctgaag ctcagctgtt caacaaaccg tactggctgc agaaagctca gggtcacaac 1620

aacggtatct gctggggtaa ccagctgttc gttaccgttg ttgacaccac ccgttctacc 1680

aacatgaccc tgtgcgcttc tgttaccacc tcttctacct acaccaactc tgactacaaa 1740

gaatacatgc gtcacgttga agaatacgac ctgcagttca tcttccagct gtgctctatc 1800

accctgtctg ctgaagttat ggcttacatc cacaccatga acccgtctgt tctggaagac 1860

tggaacttcg gtctgtctcc gccgccgaac ggtaccctgg aagacaccta ccgttacgtt 1920

cagtctcagg ctatcacctg ccagaaaccg accccggaaa aagaaaaacc ggacccgtac 1980

aaaaacctgt ctttctggga agttaacctg aaagaaaaat tctcttctga actggaccag 2040

tacccgctgg gtcgtaaatt cctgctgcag tctggttacc gtggttag 2088

<210> 12

<211> 2457

<212> DNA

<213> Artificial sequence

<400> 12

atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60

ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120

tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180

ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240

atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300

gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360

gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420

acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480

gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540

aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600

tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660

ctggaagttc tgttccaggg gccctctgac caggaagcta aaccgtctac cgaagacctg 720

ggtgacaaaa aagaaggtga atacatcaaa ctgaaagtta tcggtcagga ctcttctgaa 780

atccacttca aagttaaaat gaccacccac ctgaaaaaac tgaaagaatc ttactgccag 840

cgtcagggtg ttccgatgaa ctctctgcgt ttcctgttcg aaggtcagcg tatcgctgac 900

aaccacaccc cgaaagaact gggtatggaa gaagaagacg ttatcgaagt ttaccaggaa 960

cagaccggtg gatcctctac cgtttacgtt ccgccgccga acccggtttc taaagttgtt 1020

gctaccgacg cttacgttac ccgtaccaac atcttctacc acgcttcttc ttctcgtctg 1080

ctggctgttg gtcacccgta cttctctatc aaacgtgcta acaaaaccgt tgttccgaaa 1140

gtttctggtt accagtaccg tgttttcaaa gttgttctgc cggacccgaa caaattcgct 1200

ctgccggact cttctctgtt cgacccgacc acccagcgtc tggtttgggc ttgcaccggt 1260

ctggaagttg gtcgtggtca gccgctgggt gttggtgttt ctggtcaccc gttcctgaac 1320

aaatacgacg acgttgaaaa ctctggttct ggtggtaacc cgggtcagga caaccgtgtt 1380

aacgttggta tggactacaa acagacccag ctgtgcatgg ttggttgcgc tccgccgctg 1440

ggtgaacact ggggtaaagg taaacagtgc accaacaccc cggttcaggc tggtgactgc 1500

ccgccgctgg aactgatcac ctctgttatc caggacggtg acatggttga caccggtttc 1560

ggtgctatga acttcgctga cctgcagacc aacaaatctg acgttccgat cgacatctgc 1620

ggtaccacct gcaaataccc ggactacctg cagatggctg ctgacccgta cggtgaccgt 1680

ctgttcttct tcctgcgtaa agaacagatg ttcgctcgtc acttcttcaa ccgtgctggt 1740

gaagttggtg aaccggttcc ggacaccctg atcatcaaag gttctggtaa ccgtacctct 1800

gttggttctt ctatctacgt taacaccccg tctggttctc tggtttcttc tgaagctcag 1860

ctgttcaaca aaccgtactg gctgcagaaa gctcagggtc acaacaacgg tatctgctgg 1920

ggtaaccagc tgttcgttac cgttgttgac accacccgtt ctaccaacat gaccctgtgc 1980

gcttctgtta ccacctcttc tacctacacc aactctgact acaaagaata catgcgtcac 2040

gttgaagaat acgacctgca gttcatcttc cagctgtgct ctatcaccct gtctgctgaa 2100

gttatggctt acatccacac catgaacccg tctgttctgg aagactggaa cttcggtctg 2160

tctccgccgc cgaacggtac cctggaagac acctaccgtt acgttcagtc tcaggctatc 2220

acctgccaga aaccgacccc ggaaaaagaa aaaccggacc cgtacaaaaa cctgtctttc 2280

tgggaagtta acctgaaaga aaaattctct tctgaactgg accagtaccc gctgggtcgt 2340

aaattcctgc tgcagtctgg ttaccgtggt cgttcttcta tccgtaccgg tgttaaacgt 2400

ccggctgttt ctaaagcttc tgctgctccg aaacgtaaac gtgctaaaac caaacgt 2457

<210> 13

<211> 2628

<212> DNA

<213> Artificial sequence

<400> 13

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcagaa ttcatgtggc gtccgtctga ctctaccgtt 1200

tacgttccgc cgccgaaccc ggtttctaaa gttgttgcta ccgacgctta cgttacccgt 1260

accaacatct tctaccacgc ttcttcttct cgtctgctgg ctgttggtca cccgtacttc 1320

tctatcaaac gtgctaacaa aaccgttgtt ccgaaagttt ctggttacca gtaccgtgtt 1380

ttcaaagttg ttctgccgga cccgaacaaa ttcgctctgc cggactcttc tctgttcgac 1440

ccgaccaccc agcgtctggt ttgggcttgc accggtctgg aagttggtcg tggtcagccg 1500

ctgggtgttg gtgtttctgg tcacccgttc ctgaacaaat acgacgacgt tgaaaactct 1560

ggttctggtg gtaacccggg tcaggacaac cgtgttaacg ttggtatgga ctacaaacag 1620

acccagctgt gcatggttgg ttgcgctccg ccgctgggtg aacactgggg taaaggtaaa 1680

cagtgcacca acaccccggt tcaggctggt gactgcccgc cgctggaact gatcacctct 1740

gttatccagg acggtgacat ggttgacacc ggtttcggtg ctatgaactt cgctgacctg 1800

cagaccaaca aatctgacgt tccgatcgac atctgcggta ccacctgcaa atacccggac 1860

tacctgcaga tggctgctga cccgtacggt gaccgtctgt tcttcttcct gcgtaaagaa 1920

cagatgttcg ctcgtcactt cttcaaccgt gctggtgaag ttggtgaacc ggttccggac 1980

accctgatca tcaaaggttc tggtaaccgt acctctgttg gttcttctat ctacgttaac 2040

accccgtctg gttctctggt ttcttctgaa gctcagctgt tcaacaaacc gtactggctg 2100

cagaaagctc agggtcacaa caacggtatc tgctggggta accagctgtt cgttaccgtt 2160

gttgacacca cccgttctac caacatgacc ctgtgcgctt ctgttaccac ctcttctacc 2220

tacaccaact ctgactacaa agaatacatg cgtcacgttg aagaatacga cctgcagttc 2280

atcttccagc tgtgctctat caccctgtct gctgaagtta tggcttacat ccacaccatg 2340

aacccgtctg ttctggaaga ctggaacttc ggtctgtctc cgccgccgaa cggtaccctg 2400

gaagacacct accgttacgt tcagtctcag gctatcacct gccagaaacc gaccccggaa 2460

aaagaaaaac cggacccgta caaaaacctg tctttctggg aagttaacct gaaagaaaaa 2520

ttctcttctg aactggacca gtacccgctg ggtcgtaaat tcctgctgca gtctggttac 2580

cgtggtcgtt cttctatccg taccggtgtt aaacgtccgg ctgtttct 2628

Claims (3)

1. A method of preparing HPV 6L 1 VLPs, characterized in that the method comprises the steps of:

constructing an escherichia coli expression vector containing a coding gene of Tag-HPV 6L 1 fusion protein shown as SEQ NO. 5;

constructing an escherichia coli expression engineering strain containing the expression vector, carrying out induction expression in the escherichia coli expression engineering strain, and purifying by an affinity chromatography method to obtain the Tag-HPV 6L 1 fusion protein;

carrying out enzyme digestion on the purified Tag label of the Tag-HPV 6L 1 fusion protein by adopting Factor Xa protease to obtain HPV 6L 1 pentamer protein;

purifying the HPV 6L 1 pentamer protein to obtain an HPV 6L 1 pentamer protein solution with the purity of more than 98 percent and the average particle size of 10-15nm, pdI (positive pressure induced plasticity) < -0.1;

mixing the HPV 6L 1 pentamer protein solution with an assembly buffer solution to finally obtain an HPV 6L 1VLP protein solution with the pH value of 5.0-5.9, the salt concentration of 500-2000 mM, the average particle size of 45-65nm and PdI (Positive pressure induced plasticity) knot of 0.1.

2. A method of making HPV 6L 1 VLPs according to claim 1, wherein: the amino acid sequence of the Tag-HPV 6L 1 fusion protein is shown in SEQ NO.10.

3. A method of making HPV 6L 1 VLPs according to claim 1, wherein: wherein the E.coli host cell is GI698, ER2566, BL21 (DE 3), XA90, B834 (DE 3) or BLR (DE 3).

Images