CN104946679B - A kind of method of rhIL-10 construction of recombinant vector and its protein purification - Google Patents
A kind of method of rhIL-10 construction of recombinant vector and its protein purification Download PDFInfo
- Publication number
- CN104946679B CN104946679B CN201510325665.4A CN201510325665A CN104946679B CN 104946679 B CN104946679 B CN 104946679B CN 201510325665 A CN201510325665 A CN 201510325665A CN 104946679 B CN104946679 B CN 104946679B
- Authority
- CN
- China
- Prior art keywords
- rgd
- expression
- fusion protein
- added
- ptwin1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
A kind of hIL-10 recombinant vector, using IMPACT system expression, fusion protein label is the recombinant vector of 6 histidines (6 × His), as shown in the plasmid map of recombinant vector；Building, expression and the identification method step of recombinant vector include: the amplification of 1) rh-IL10 gene；2) building, expression and its identification of recombinant vector；The purification process step of rh-IL10 fusion protein are as follows: 1) the thick of fusion protein his-intein-IL10-RGD mentions；2) inclusion body washs；3) solubilization of inclusion bodies；4) purifying of fusion protein his-intein-IL10-RGD；5) renaturation and Self cleavage of fusion protein his-intein-IL10-RGD；6) IL10-RGD is purified；Increase the targeting of hIL-10 in vivo, albumen is imparted with antitumor and body's immunity activity, it is combined more importantly it can be targeted in wound healing process with neovascular endothelium cell-specific, to prevent the formation of inhibition cicatrical fibrosis.
Description
Technical field
The invention belongs to genetic engineering and Protein purification techniques fields, and in particular to a kind of rhIL-10 construction of recombinant vector
And its method of protein purification.
Background technique
Target gene and carrier are combined into a recombinant with the of self-replication capacity in vitro, it is then big by conversion
Enterobacteria filters out the transformant bacterium containing target gene, then is expanded, extracts a large amount of same DNA molecular copies of acquisition,
That is the building of recombinant clone or expression vector.Digestion and sequencing identification can be carried out by constructing the plasmid that finishes, be obtained and target gene
The recombinant vector for being consistent and not being mutated is converted E. coli competent and carries out inducing expression.Protein induced expression is laggard
Row isolates and purifies, and in view of rhIL-10, expression quantity is low in non-fused system or does not express, therefore the later period is carried out using emerging system
Inducing expression, and IMPACT expression system is utilized in successful innovation, isolates and purifies to obtain rhIL-10.
Interleukin 10 (IL10) is the immunomodulating cytokines for generating and acting on various kinds of cell by various kinds of cell,
Its function includes two aspect of immunosupress and Immune enhancement, the differentiation and proliferation of panimmunity cell is adjusted, while also having
Adjust the characteristic of immunostimulation.
Rgd peptide (CDCRGDCFC, 9 peptides) can be specifically bound in adult with respect to α v β 3, α v β 5 integration lacked
Element, this two kinds of integrins can selectively raise raising in angiogenesis, and therefore, RGD is neovascular endothelium cell-specific
The polypeptide sequence for identifying and combining.It, can be with by the RGD targeted peptide and IL-10 amalgamation and expression of neovascular endothelium specific binding
Dosage and treatment cost are reduced, medication bring toxic side effect is subtracted；It can make IL-10 drug orientation in vivo simultaneously
Pharmacological action is played in vascular endothelial cell.
Summary of the invention
To overcome above-mentioned the deficiencies in the prior art, the purpose of the present invention is to provide a kind of rhIL-10 construction of recombinant vector
And its method of protein purification, the expression vector of suitable recombinant protein rhIL-10 is established, and carry out mesh using this expression vector
Albumen purifying, detect it with bioactivity；The recombinant protein increases the targeting of hIL-10 in vivo, imparts egg
It is white that there is antitumor and body's immunity activity, more importantly it can be with new green blood in wound healing process
Endothelial cell special target combines, to prevent the formation of inhibition cicatrical fibrosis.
To achieve the above object, a kind of the technical solution adopted by the present invention are as follows: hIL-10 recombinant vector, which is characterized in that
Using IMPACT system expression, fusion protein label is the recombinant vector of 6 histidines (6 × His), such as the matter of recombinant vector
Shown in grain map.
A kind of building, expression and the identification method of hIL-10 recombinant vector, comprising the following steps:
(1) amplification of rh-IL10 gene
1) extraction of total serum IgE
Normal human peripheral blood separates mononuclearcell through lymphocyte separation medium, and PBS is washed 2 times, is resuspended in 10%
PRMI1640 culture solution is added the ConA of final concentration of 10g/L, sets 5%CO2Incubator, 37 DEG C of culture 48h collect cell, root
According to Sigma RNA extraction agent cassette method, total serum IgE is extracted, -80 DEG C save backup；
2) RNA reverse transcription and the amplification of IL-10 cDNA
Using Takara company reverse transcription reagent box, according to illustrating to carry out RT-PCR reaction: the first step removes genome
2 μ l, gDNA Eraser of DNA, 5 × gDNA Eraser Buffer, 1 μ l, Total RNA 500ng, Rnase Free dH2O
Add to 10 μ l, 42 DEG C of incubation 2min；Second step reverse transcription is separately added into PrimeScript RT Enzyme Mix I 1 μ l, RT
24 μ l of Primer Mix1 μ l, 5 × PrimeScript Buffer, 10 μ l, Rnase Free dH of first step reaction solution2O is added to
CDNA is obtained after 20 μ l, 37 DEG C of incubations 30min, 85 DEG C of reaction 3min.
(2) building, expression and its identification of recombinant vector
1) building of pTWIN1-IL10 expression vector
By the usual codon design RGD gene order of Escherichia coli, primer and corresponding restriction enzyme site, following 2 are synthesized
Primers F 1, R1；
It is as follows that RGD is oriented to peptide amino acid sequence: H2N-Cys Asp Cys Lys Gly Asp Cys Phe Cys-COOH；
RGD gene order: 5 ' tgt gat tgc cgt ggt gat tgt ttc tgt 3 '；
F1:5 ' GCTCTTCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAG3 ' BspQI
R1:5 ' CTGCAGTCAACAGAAACAATCACCACGGCAATCACAGTTTCGTATCTTCATTGTC3 ' PstI
Using F1, R1 as primer, cDNA is template, therewith press 95 DEG C of 10s initial denaturations, 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C
1min, 30 circulation after 72 DEG C carry out extension 5min, obtain PCR product, product and pTWIN1 carrier are respectively through BspQ I/Pst
I double digestion, recycling target fragment be attached, connection product convert DH5 α, picking monoclonal, extract plasmid, carry out digestion and
Sequencing identification, obtains pTWIN1-IL10-RGD expression vector；
2) building of pTWIN1-his-IL10 expression vector
With his label his-IL10-RGD amplimer:
F2:5 ' CGCAACATATGCATCATCATCATCATCATAACAACGGTAACAACGGTCTCG3 ' NdeI/6 × his
3 ' PstI of R2:5 ' AACTGCAGTCAACAGAAACAATCACCACG
Using F2, R2 as primer, pTWIN1-IL10-RGD is template, therewith press 95 DEG C of 10s initial denaturations, 95 DEG C of 30s, 60 DEG C
30s, 72 DEG C of 1.2min carry out extension 5min for 72 DEG C after 30 circulations, obtain PCR product, product and pTWIN1-IL10-RGD are carried
Body through NdeI/PstI double digestion, recycles target fragment and is attached respectively, connection product conversion Rosetta, picking monoclonal,
Plasmid is extracted, digestion identification is further identified through sequencing, is built into the engineering bacteria of pTWIN1-his-IL10-RGD expression vector；
3) expression of the rhIL-10 recombinant protein in Escherichia coli
Above-mentioned engineering bacteria pTWIN1-his-IL10-RGD/Rosetta is inoculated in LB culture medium with ampicillin,
37 DEG C of shake cultures are stayed overnight, and next day is inoculated into the inoculum concentration of 1% (v/v) containing ampicillin and chloramphenicol fermentation medium
In, continue in 37 DEG C of shake cultures to mid log phase, when culture solution optical density OD600 is 0.6,1mM IPTG is added and continues
5hr inducing expression is cultivated, thalline were collected by centrifugation；
4) detection and identification of rhIL-10 protein expression
The thalline culture of inducing expression is centrifuged, thallus is collected, is expressed and is produced using 12% SDS-PAGE electrophoretic analysis
Object, IPTG are induced compared with not inducing sample, are had an apparent deep dye nascent protein band in molecular weight corresponding position, are merged with estimated
The molecular size range of albumen is consistent.By albumen from gel electrotransfer to pvdf membrane, conventional Western blot analysis, ECL hair
Light, it is seen that an obvious developed band, molecular weight is consistent, non-inducible strain, and other bands are no positive anti-in standard protein and expression bacterium
It answers.
The purification process of rh-IL10 fusion protein, comprising the following steps:
1) the thick of fusion protein his-intein-IL10-RGD mentions
The thallus 20g for taking inducing expression, with 200ml lysate (10mM Tris-Cl, pH8.5；1mM EDTA, pH
8.0) it after, 15min is sufficiently stirred in magnetic stirring apparatus, is added 200 μ l lysozymes (50 μ g/ml), 15min, 4 DEG C of standings is sufficiently stirred
1hr, sampling 50 μ l, 12000rpm are centrifuged 5min, 2 × loadingbuffer mixing are added in supernatant, 50 μ l are added in precipitating
ddH2O is resuspended, and 2 × loading buffer is added and mixes.Waste water boils 5min, and 12000rpm is centrifuged 5min, examines through SDS-PAGE
The fusion protein for surveying discovery expression is present in precipitating, illustrates that the recombinant protein of inducing expression is existing for inclusion bodies；
2) inclusion body washs
The first step is added 0.1% (w/v) NaTDC (DOC), continuously adds 1mM MgCl2, 2.5 μ g/ml are added
20min is sufficiently stirred in DNA enzymatic (Dnase I), magnetic stirring apparatus, stands 10min, 4 DEG C of centrifugations, 12000rpm/ after sampling 50 μ l
Min is centrifuged 20min, abandons supernatant；
200ml lysate is added in second step, and 0.5%DOC (w/v) is washed, magnetic stirrer 15min, sampling
10min, 4 DEG C of centrifugations are stood after 50 μ l, 12000rpm/min is centrifuged 20min, abandons supernatant；
200ml lysate is added in third step, and 0.5%Triton X-100 (v/v), magnetic stirrer 15min take
10min, 4 DEG C of centrifugations are stood after 50 μ l of sample, 12000rpm/min is centrifuged 20min, abandons supernatant；
4th step repeats previous action；
3) solubilization of inclusion bodies
The first step, 400ml lysate (0.1M Tris-Cl (pH 10.0), 0.1M NaCl, 8M urea, 10mM 2- sulfydryl
Ethyl alcohol (β-ME)) dissolution inclusion body, magnetic stirrer 1.5hr, 4 DEG C stand overnight；
Above-mentioned lysate 12000rpm is centrifuged 20min, collects supernatant by second step；
Supernatant is packed into bag filter by third step, with pH8.0 lysate without β-ME dialysis 24-36hr, changes liquid 2-3 times, from
The heart collects supernatant；
4) purifying of fusion protein his-intein-IL10-RGD
GE company nickel column matrix NI Sepharose Fast Flow is taken to fill column, column volume 5.4 × 15cm is molten with pH8.0
Liquid is solved to balance without β-ME, it is linear with being dissolved containing 0.01,0.02,0.05,0.1,0.2,0.3M imidazoles pH8.0 respectively after loading
Gradient elution collects each peak sample, SDS-PAGE identification；
5) renaturation and Self cleavage of fusion protein his-intein-IL10-RGD
When 4 DEG C, the slow renaturation under the gradually dilution of renaturation buffer, the fusion protein his- in pH6.0 buffer
Self cleavage occurs for intein-IL10-RGD, dialyses into pH8.0 buffer.SDS-PAGE runs glue identification；
6) IL10-RGD is purified
0.1M Tris-Cl (pH 8.0), 0.1M NaCl buffer balance columns, with containing after buffer balance columns after loading
0.01,0.02,0.15,0.25M imidazoles linear elution, collect each peak sample, and SDS-PAGE is identified after concentration；Silver staining result card
Bright sample purity is up to 95% or more, as rhIL-10-RGD.
The beneficial effects of the present invention are:
After above-mentioned recombinant vector pTWIN1-his-IL10 inducing expression, purifying is greatly reduced in protein purification procedures
Difficulty.In the experimentation of early period, a variety of expression vectors are attempted, expression effect is all undesirable, even if using pTWIN1
The characteristic of initial carrier, which is purified, does not also achieve the purpose that purifying, therefore uses secondary building, i.e., carries pTWIN1-IL10
PCR is connected into Intein-IL10-RGD then by PCR product and pTWIN1-IL10 digestion simultaneously again in body.Inducing expression,
SDS-PAGE gray scale scanning identifies 45% or more destination protein inducing expression amount, it was demonstrated that the reliability of this expression system；It is repeatedly pure
Change obtains destination protein, and then shows its stability.Later experiments show that this expression and purification system can be repeated effectively.
The present invention will be Human interleukin-10 (human interlenkin 10, hIL-10) and newborn by genetic engineering means
The rgd peptide of vascular endothelial cell specific bond is formed new albumen (rhIL-10) in gene level amalgamation and expression, recombination, and
Impart that the albumen is antitumor and body's immunity is active.More importantly its in wound healing process can with it is new
The targeting of angiogenic endothelial-cell specific combines, to prevent the formation of inhibition cicatrical fibrosis.
Detailed description of the invention
Fig. 1 is the plasmid map of recombinant vector of the present invention.
Fig. 2 is purifying process flow chart of the present invention.
Specific embodiment
Invention is further described in detail in the following with reference to the drawings and specific embodiments.
Embodiment 1:
The building of rhIL-10 recombinant vector and expression in escherichia coli, purifying
(1) amplification of rh-IL10 gene
1) extraction of total serum IgE
Normal human peripheral blood separates mononuclearcell through lymphocyte separation medium, and PBS is washed 2 times, is resuspended in 10%
PRMI1640 culture solution is added the ConA of final concentration of 10g/L, sets 5%CO2Incubator, 37 DEG C of culture 48h collect cell.Root
According to Sigma RNA extraction agent cassette method, total serum IgE is extracted, -80 DEG C save backup；
2) RNA reverse transcription and the amplification of IL-10 cDNA
Using Takara company reverse transcription reagent box, according to illustrating to carry out RT-PCR reaction: the first step removes genome
2 μ l, gDNA Eraser of DNA, 5 × gDNA Eraser Buffer, 1 μ l, Total RNA 500ng, Rnase Free dH2O
Add to 10 μ l, 42 DEG C of incubation 2min；Second step reverse transcription is separately added into PrimeScript RT Enzyme Mix I 1 μ l, RT
24 μ l of Primer Mix1 μ l, 5 × PrimeScript Buffer, 10 μ l, Rnase Free dH of first step reaction solution2O is added to
CDNA is obtained after 20 μ l, 37 DEG C of incubations 30min, 85 DEG C of reaction 3min.
(2) building, expression and its identification of recombinant vector
1) building of pTWIN1-IL10 expression vector
By the usual codon design RGD gene order of Escherichia coli, primer and corresponding restriction enzyme site, following 2 are synthesized
Primers F 1, R1；
It is as follows that RGD is oriented to peptide amino acid sequence: H2N-Cys Asp Cys Lys Gly Asp Cys Phe Cys-COOH；
RGD gene order: 5 ' tgt gat tgc cgt ggt gat tgt ttc tgt 3 '；
F1:5 ' GCTCTTCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAG3 ' BspQI
R1:5 ' CTGCAGTCAACAGAAACAATCACCACGGCAATCACAGTTTCGTATCTTCATTGTC3 ' PstI
Using F1, R1 as primer, cDNA is template, therewith press 95 DEG C of 10s initial denaturations, 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C
1min, 30 circulation after 72 DEG C carry out extension 5min, obtain PCR product, product and pTWIN1 carrier are respectively through BspQ I/Pst
I double digestion, recycling target fragment be attached, connection product convert DH5 α, picking monoclonal, extract plasmid, carry out digestion and
Sequencing identification, obtains pTWIN1-IL10-RGD expression vector.
2) building of pTWIN1-his-IL10 expression vector
With his label his-IL10-RGD amplimer:
F2:5 ' CGCAACATATGCATCATCATCATCATCATAACAACGGTAACAACGGTCTCG3 ' NdeI/6 × his
3 ' PstI of R2:5 ' AACTGCAGTCAACAGAAACAATCACCACG
Using F2, R2 as primer, pTWIN1-IL10-RGD is template, therewith press 95 DEG C of 10s initial denaturations, 95 DEG C of 30s, 60 DEG C
30s, 72 DEG C of 1.2min carry out extension 5min for 72 DEG C after 30 circulations, obtain PCR product, product and pTWIN1-IL10-RGD are carried
Body through NdeI/PstI double digestion, recycles target fragment and is attached respectively, connection product conversion Rosetta, picking monoclonal,
Plasmid is extracted, digestion identification is further identified through sequencing, is built into the engineering bacteria of pTWIN1-his-IL10-RGD expression vector；
3) expression of the rhIL-10 recombinant protein in Escherichia coli
Above-mentioned engineering bacteria pTWIN1-his-IL10-RGD/Rosetta is inoculated in LB culture medium with ampicillin,
37 DEG C of shake cultures are stayed overnight, and next day is inoculated into 1% inoculum concentration containing in ampicillin and chloramphenicol fermentation medium, after
Continue in 37 DEG C of shake cultures to mid log phase, culture solution optical density OD600When being 0.6,1mM IPTG is added and continues to cultivate
5hr inducing expression, thalline were collected by centrifugation.
4) detection and identification of rhIL-10 protein expression
The thalline culture of inducing expression is centrifuged, thallus is collected, is expressed and is produced using 12% SDS-PAGE electrophoretic analysis
Object, IPTG are induced compared with not inducing sample, are had an apparent deep dye nascent protein band in molecular weight corresponding position, are merged with estimated
The molecular size range of albumen is consistent.By albumen from gel electrotransfer to pvdf membrane, conventional Western blot analysis, ECL hair
Light, it is seen that an obvious developed band, molecular weight is consistent, non-inducible strain, and other bands are no positive anti-in standard protein and expression bacterium
It answers.
(3) purification process of rh-IL10 fusion protein, as shown in Figure 2
1) the thick of fusion protein his-intein-IL10-RGD mentions
As shown in Figure 1, the thallus 20g of inducing expression is taken, with 200ml lysate (10mM Tris-Cl, pH8.5；1mM
EDTA, pH 8.0), after 15min is sufficiently stirred in magnetic stirring apparatus, it is added 200 μ l lysozymes (50 μ g/ml), is sufficiently stirred
15min, 4 DEG C of standing 1hr, 50 μ l of sampling, 12000rpm is centrifuged 5min, 2 × loading buffer is added in supernatant and mixes, heavy
50 μ l ddH are added in shallow lake2O is resuspended, and 2 × loading buffer is added and mixes.Waste water boils 5min, and 12000rpm is centrifuged 5min,
The fusion protein for detecting discovery expression through SDS-PAGE is present in precipitating, illustrates that the recombinant protein of inducing expression is with inclusion body
Existing for form；
2) inclusion body washs
The first step is added 0.1% (w/v) NaTDC (DOC), continuously adds 1mM MgCl2, 2.5 μ g/ml are added
20min is sufficiently stirred in DNA enzymatic (Dnase I), magnetic stirring apparatus, stands 10min, 4 DEG C of centrifugations, 12000rpm/ after sampling 50 μ l
Min is centrifuged 20min, abandons supernatant；
200ml lysate is added in second step, and 0.5%DOC (w/v) is washed, magnetic stirrer 15min, sampling
10min, 4 DEG C of centrifugations are stood after 50 μ l, 12000rpm/min is centrifuged 20min, abandons supernatant；
200ml lysate is added in third step, and 0.5%Triton X-100 (v/v), magnetic stirrer 15min take
10min, 4 DEG C of centrifugations are stood after 50 μ l of sample, 12000rpm/min is centrifuged 20min, abandons supernatant；
4th step repeats previous action；
3) solubilization of inclusion bodies
The first step, 400ml lysate (0.1M Tris-Cl (pH 10.0), 0.1M NaCl, 8M urea, 10mM 2- sulfydryl
Ethyl alcohol (β-ME)) dissolution inclusion body, magnetic stirrer 1.5hr, 4 DEG C stand overnight；
Above-mentioned lysate 12000rpm is centrifuged 20min, collects supernatant by second step；
Supernatant is packed into bag filter by third step, with pH8.0 lysate without β-ME dialysis 24-36hr, changes liquid 2-3 times, from
The heart collects supernatant.
4) purifying of fusion protein his-intein-IL10-RGD
GE company nickel column matrix NI Sepharose Fast Flow is taken to fill column, column volume 5.4 × 15cm is molten with pH8.0
Liquid is solved to balance without β-ME, it is linear with being dissolved containing 0.01,0.02,0.05,0.1,0.2,0.3M imidazoles pH8.0 respectively after loading
Gradient elution collects each peak sample, SDS-PAGE identification；
5) renaturation and Self cleavage of fusion protein his-intein-IL10-RGD
In 4 DEG C of slow renaturation under the gradually dilution of renaturation buffer.The finally fusion protein his- in pH6.0 buffer
Self cleavage occurs for intein-IL10-RGD.Dialysis is into pH8.0 buffer.SDS-PAGE runs glue identification；
6) IL10-RGD is purified
0.1M Tris-Cl (pH 8.0), 0.1M NaCl buffer balance columns, with containing after buffer balance columns after loading
0.01,0.02,0.15,0.25M imidazoles linear elution, collect each peak sample, and SDS-PAGE is identified after concentration；
Silver staining result proves sample purity up to 95% or more.As rhIL-10-RGD.
(4) Determination of biological activity of rhIL-10-RGD
MC/9 cell origin is in the mast cell of mouse, under the collaboration stimulation of mouse IL-4 or IL-3 and hIL-10
Growth and breeding, specific as follows:
100 μ l MC/9 cells (1 × 105Cells/ml), mouse IL-4 (mIL-4 200U/ml), hIL-10 is added
(hIL-10 25U/ml) or 37 DEG C of rhIL-10-RGD 400U/ml, 5%CO2Incubator culture 72hr, cell counting
Kit (CCK-8) detect cell proliferative conditions, mIL-4, hIL-10, rhIL-10-RGD compared with the control group difference without significant meaning
Adopted (P > 0.05), and the stimulation MC/9 cell Proliferation in various degree respectively of mIL4 and hIL10, mIL4 and two groups of rhIL10, and compare
The group difference that compares has significant meaning (p < 0.05).Therefore, the rhIL-10-RGD that Rosetta expresses renaturing inclusion bodies has
Biological activity.Renaturing inclusion bodies rhIL-10-RGD specific activity is 5 × 103U/mg。
Claims (1)
1. a kind of hIL-10 recombinant vector, which is characterized in that use IMPACT system expression, fusion protein label is 6 groups
The recombinant vector of propylhomoserin, as shown in plasmid map Fig. 1 of recombinant vector；
Building, expression and the identification method of a kind of hIL-10 recombinant vector the following steps are included:
(1) amplification of rh-IL10 gene
1) extraction of total serum IgE
Normal human peripheral blood separates mononuclearcell through lymphocyte separation medium, and PBS is washed 2 times, is resuspended in 10%PRMI1640
The ConA of final concentration of 10g/L is added in culture solution, sets 5% CO2Incubator, 37 DEG C of culture 48h collect cell, according to
SigmaRNA extraction agent cassette method extracts total serum IgE, and -80 DEG C save backup；
2) RNA reverse transcription and the amplification of IL-10 cDNA
Using Takara company reverse transcription reagent box, according to illustrating to carry out RT-PCR reaction: the first step removes genomic DNA, 5 ×
2 μ l, gDNA Eraser of gDNA Eraser Buffer, 1 μ l, Total RNA 500ng, Rnase Free dH2O adds to 10 μ
L, 42 DEG C of incubation 2min；Second step reverse transcription, respectively plus PrimeScript RT Enzyme Mix I 1 μ l, RTPrimer
24 μ l of Mix1 μ l, 5 × PrimeScript Buffer, 10 μ l, Rnase Free dH of first step reaction solution2O adds to 20 μ l, and 37
DEG C 30min is incubated, obtains cDNA after 85 DEG C of reaction 3min；
(2) building, expression and its identification of recombinant vector
1) building of pTWIN1-IL10 expression vector
By the usual codon design RGD gene order of Escherichia coli, primer and corresponding restriction enzyme site, following 2 primers are synthesized
F1,R1；
It is as follows that RGD is oriented to peptide amino acid sequence: H2N-Cys Asp Cys Lys Gly Asp Cys Phe Cys-COOH；
RGD gene order: 5 ' tgt gat tgc cgt ggt gat tgt ttc tgt 3 '；
F1:5 ' GCTCTTCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAG3 ' BspQI
R1:5 ' CTGCAGTCAACAGAAACAATCACCACGGCAATCACAGTTTCGTATCTTCATTGTC3 ' Pstl
Using F1, R1 as primer, cDNA is template, therewith press 95 DEG C of 10s initial denaturations, 95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C
1min, 30 circulation after 72 DEG C carry out extension 5min, obtain PCR product, product and pTWIN1 carrier are respectively through BspQ I/Pstl
Double digestion, recycling target fragment are attached, and connection product converts DH5 α, and picking monoclonal extracts plasmid, carry out digestion and survey
Sequence identification, obtains pTWIN1-IL10-RGD expression vector；
2) building of pTWIN1-his-IL10 expression vector
With his label his-IL10-RGD amplimer:
F2:5 ' CGCAACATATGCATCATCATCATCATCATAACAACGGTAACAACGGTCTCG3 ' Ndel/6xhis
R2:5 ' AACTGCAGTCAACAGAAACAATCACCACG3 ' Pstl
Using F2, R2 as primer, pTWIN1-IL10-RGD is template, therewith press 95 DEG C of 10s initial denaturations, 95 DEG C of 30s, 60 DEG C
30s, 72 DEG C of 1.2min, 30 circulation after 72 DEG C carry out extension 5min, obtain PCR product, product and pTWIN1-IL10-RGD
Carrier through Ndel/Pstl double digestion, recycles target fragment and is attached, connection product converts Rosetta, picking Dan Ke respectively
It is grand, plasmid is extracted, digestion identification is further identified through sequencing, is built into the engineering of pTWIN1-his-IL10-RGD expression vector
Bacterium；
3) expression of the rhIL-10 recombinant protein in Escherichia coli
Above-mentioned engineering bacteria pTWIN1-his-IL10-RGD/Rosetta is inoculated in LB culture medium with ampicillin, and 37 DEG C
Shake culture is stayed overnight, and next day is inoculated into 1% inoculum concentration containing in ampicillin and chloramphenicol fermentation medium, is continued
37 DEG C of shake cultures are to mid log phase, and when culture solution optical density OD600 is 0.6, addition 1mM IPTG continues culture 5hr and lures
Expression is led, thalline were collected by centrifugation；
4) detection and identification of rhIL-10 protein expression
The thalline culture of inducing expression is centrifuged, thallus is collected, using 12% SDS-PAGE electrophoretic analysis expression product,
IPTG is induced compared with not inducing sample, is had an apparent deep dye nascent protein band in molecular weight corresponding position, is merged egg with estimated
White molecular size range is consistent；By albumen from gel electrotransfer to pvdf membrane, conventional Western blot analysis, ECL shines,
It can be seen that an obvious developed band, molecular weight is consistent, non-inducible strain, other no positive reactions of band in standard protein and expression bacterium；
The purification process of rh-IL10 fusion protein, comprising the following steps:
1) the thick of fusion protein his-intein-IL10-RGD mentions
The thallus 20g for taking inducing expression, with 200ml lysate: 10mM Tris-Cl, pH8.5；1mM EDTA, pH8.0, magnetic force
After 15min is sufficiently stirred in blender, the 50 μ g/ml lysozymes of 200 μ l are added, 15min, 4 DEG C of standing 1hr are sufficiently stirred, samples
50 μ l, 12000rpm are centrifuged 5min, and 2 × loading buffer mixing is added in supernatant, 50 μ l ddH are added in precipitating2O weight
It is outstanding, 2xloading buffer is added and mixes；Waste water boils 5min, and 12000rpm is centrifuged 5min, detects discovery table through SDS-PAGE
The fusion protein reached is present in precipitating, illustrates that the recombinant protein of inducing expression is existing for inclusion bodies；
2) inclusion body washs
First, the NaTDC DOC that 0.1% unit is w/v is added, continuously adds 1mM MgCl2, 2.5 μ g/ml DNA are added
20min is sufficiently stirred in enzyme Dnase l, magnetic stirring apparatus, stands 10min after sampling 50 μ l, and 4 DEG C are centrifuged, 12000rpm/min, from
Heart 20min abandons supernatant；
Second, 200ml lysate is added, 0.5% unit is that the NaTDC DOC of w/v is washed, magnetic stirrer
15min stands 10min, 4 DEG C of centrifugations after sampling 50 μ l, and 12000rpm/min is centrifuged 20min, abandons supernatant；
Third, is added 200ml lysate, and 0.5% unit is v/v Triton X-100, magnetic stirrer 15min, sampling
10min, 4 DEG C of centrifugations are stood after 50 μ l, 12000rpm/min is centrifuged 20min, abandons supernatant；
4th, repeat previous action；
3) solubilization of inclusion bodies
First, 400ml lysate dissolve inclusion body, and magnetic stirrer 1.5hr, 4 DEG C stand overnight；Wherein, lysate is
0.1M Tris-Cl, pH 10.0,0.1M NaCl, 8M urea, 10mM 2 mercapto ethanol；
Second, above-mentioned lysate 12000rpm is centrifuged 20min, collects supernatant；
Supernatant is packed into bag filter by third, with pH8.0 lysate without β-ME dialysis 24-36hr, is changed liquid 2-3 times, is collected by centrifugation
Supernatant；
4) purifying of fusion protein his-intein-IL10-RGD
GE company nickel column matrix NI Sepharose Fast Flow is taken to fill column, 5.4 × 15cm of column volume, with pH8.0 lysate
It is balanced without β-ME, dissolves linear gradient with containing 0.01,0.02,0.05,0.1,0.2,0.3M imidazoles pH8.0 respectively after loading
Each peak sample, SDS-PAGE identification are collected in elution；
5) renaturation and Self cleavage of fusion protein his-intein-IL10-RGD
When 4 DEG C, the slow renaturation under the gradually dilution of renaturation buffer, the fusion protein his- in pH6.0 buffer
Self cleavage occurs for intein-IL10-RGD, dialyses into pH8.0 buffer；SDS-PAGE runs glue identification；
6) IL10-RGD is purified
The Tris-ClpH8.0 that 0.1M pH is 8.0,0.1M NaCl buffer balance columns, with containing after buffer balance columns after loading
0.01,0.02,0.15,0.25M imidazoles linear elution, collect each peak sample, and SDS-PAGE is identified after concentration；Silver staining result card
Bright sample purity is up to 95% or more, as rhIL-10-RGD.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510325665.4A CN104946679B (en) | 2015-06-15 | 2015-06-15 | A kind of method of rhIL-10 construction of recombinant vector and its protein purification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510325665.4A CN104946679B (en) | 2015-06-15 | 2015-06-15 | A kind of method of rhIL-10 construction of recombinant vector and its protein purification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104946679A CN104946679A (en) | 2015-09-30 |
| CN104946679B true CN104946679B (en) | 2019-01-01 |
Family
ID=54161742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510325665.4A Expired - Fee Related CN104946679B (en) | 2015-06-15 | 2015-06-15 | A kind of method of rhIL-10 construction of recombinant vector and its protein purification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104946679B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110357970A (en) * | 2019-07-10 | 2019-10-22 | 杭州纽龙日尚生物制品有限公司 | A kind of hEGF's fusion protein and its nucleic acid molecules, a kind of hEGF's preparation method for being easy to purify |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101003812A (en) * | 2006-01-17 | 2007-07-25 | 温州医学院 | Method in use for preparing recombined EGF-IL18 fusion protein of human |
-
2015
- 2015-06-15 CN CN201510325665.4A patent/CN104946679B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101003812A (en) * | 2006-01-17 | 2007-07-25 | 温州医学院 | Method in use for preparing recombined EGF-IL18 fusion protein of human |
Non-Patent Citations (2)
| Title |
|---|
| Intein介导的重组昆虫毒素BmK IT在大肠杆菌中的可溶性表达、纯化及活性分析;许成钢 等;《生物工程学报》;20071130;第23卷(第6期);989-994 |
| RGD重组人IL-10的克隆、表达及其拮抗纤维化的初步研究;石继红 等;《中国生物工程杂志》;20121231;第32卷(第2期);17-23 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104946679A (en) | 2015-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100564517C (en) | A kind of anti-glioma peptide of scorpion and its production and application | |
| CN104402975B (en) | Anti-aging small peptide and preparation method thereof | |
| CN102181469A (en) | Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof | |
| CN104946679B (en) | A kind of method of rhIL-10 construction of recombinant vector and its protein purification | |
| CN101343327A (en) | Antiviral protein and uses thereof | |
| CN107488639A (en) | Toluene monooxygenase and its application in the synthesis of chiral sulfoxide living things catalysis | |
| CN102731658B (en) | Tat PTD-Endostatin recombination protein, preparation method and application thereof | |
| CN103554270A (en) | Novel recombinant protein and preparation and application thereof | |
| CN103031285B (en) | Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof | |
| CN113667005B (en) | Pacific codin-gamma protein, gene, recombinant plasmid, recombinant yeast engineering bacteria and application thereof | |
| CN103031295B (en) | Cordyceps cytidine deaminase, coding gene and application thereof | |
| CN101891811B (en) | Shark angiogenesis inhibiting factor and production and purification method and application | |
| CN104480126A (en) | Trachinotus ovatus peroxiredoxin gene | |
| CN101434958A (en) | Method for preparing porcine alpha-interferon | |
| CN105349566B (en) | A kind of preparation method for the oral recombination nutrition polypeptide supplementing essential amino acid | |
| CN103031287B (en) | Cordyceps Chinese Hirsutella nucleoside diphosphokinase, coding gene and application thereof | |
| CN103045631B (en) | Preparation method for oral hypoglycemic recombinant human proinsulin | |
| CN109022471A (en) | Produce the escherichia expression system of oxalate oxidase, the production method and its application of oxalate oxidase | |
| CN104120118B (en) | Arginase, encoding gene and application thereof from Cordyceps China pilose spore | |
| CN103045574B (en) | Cordyceps sinensis hirsutella sinensis uridylic acid synthetase, as well as coding gene and application thereof | |
| CN103031286A (en) | Cordyceps Chinese Hirsutella uridylate-cytidylate kinase, coding gene and application thereof | |
| CN104120113B (en) | Cordyceps 3-Isopropylmalate dehydrogenase C, encoding gene and application thereof | |
| CN103045549A (en) | Cordyceps sinensis reduced coenzyme II, coding gene and application thereof | |
| CN103045557B (en) | Cordyceps sinensis China pilose spore nucleosidetriphosphate pyrophosphatase, encoding gene and application | |
| CN116333070A (en) | Preparation method and application of Tibetan ganoderma lucidum immunomodulatory protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190101 Termination date: 20200615 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |