CN103031286A - Cordyceps Chinese Hirsutella uridylate-cytidylate kinase, coding gene and application thereof - Google Patents

Abstract

The invention relates to an enzyme from Bailing production bacterium Cordyceps Chinese Hirsutella for synthesizing metabolic pyrimidine nucleoside diphosphate from pyrimidine nucleoside, a gene for coding the enzyme and application thereof. The enzyme is uridylate-cytidylate kinase which has more than 90% of homology with amino acid sequence disclosed as SEQ ID NO.1; and the coding gene has more than 90% of homology with nucleotide sequence disclosed as SEQ ID NO.2. The invention researches the metabolic pathway of pyrimidine nucleotide synthesized pyrimidine nucleoside diphosphate in details in principle. The cloned DNA (deoxyribonucleic acid) comprising the nucleotide sequence provided by the invention can be transformed into engineering bacterium by transduction, conversion and conjugal transfer. By adjusting the expression of the pyrimidine nucleoside diphosphate biosynthesized gene, the host pyrimidine nucleoside diphosphate is endowed with high expressivity, thereby providing an effective way for enhancing the yield of the pyrimidine nucleoside diphosphate and having great application prospects.

Description

Cordyceps sinensis China pilose spore UMP-CMP kinase, encoding gene and application

(1) technical field

The present invention relates to the set out UMP-CMP kinase (UMP-CMP kinase) of anabolism bisphosphate pyrimidine nucleoside of a participation pyrimidine nucleotide of producing bacterium Cordyceps sinensis China pilose spore from " hundred make ", the gene of this enzyme of encoding and application thereof.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma and the complex body on the larva corpse (comprising stroma and polypide) on lepidopteran (Lepidoptera) Hepialidae insect (the Hepialus armoricanus Oberthur) larva.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various characteristics of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern worldwide enjoys high praise.The traditional Chinese medical science thinks that Cordyceps sinensis enters lung kidney two warps, and is can tonifying lung cloudy, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough phlegm blood, spontaneous sweatings etc. are unique a kind of simultaneously balances, regulate the Chinese medicine of negative and positive.Modern pharmacology confirms that Cordyceps sinensis has the widely biological activity such as immunomodulatory, antibiotic, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual productions such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the evaluation of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph conclusive evidence, activeconstituents compartment analysis and the mechanism of action, the Application and Development.The Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, so its output is very low, price is high.Wild cordyceps restricts scarcity of resources owing to factors such as being subjected to growing environment.Owing to made little progress at artificial culture in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation is produced the Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, and not climate, geographical environment and the strict restriction of Chinese caterpillar fungus parasitic conditions is suitable for large-scale industrialization production again.Its composition of the substitute of producing such as mycelium is also similar to natural cs with drug effect, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that the aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, proof is basically identical with natural cs chemical constitution, pharmacological action, can replace natural cs to produce cordyceps product, to remedy the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites all is significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, to progressively turning to deeper functional meta-bolites research by the direct utilization of Chinese caterpillar fungus raw material or crude extract in the worm grass product research and development.The Chinese caterpillar fungus meta-bolites has been done a large amount of research both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative researchs of functional meta-bolites at aspects such as biosynthesizing, pharmacological actions such as miazines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL win initial success.

Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein the miazines nucleosides comprises cytidine(C and uridine.Uridine (uracil riboside) claim again uridine (uIidine), and another name is by snow riboside, dihydro-pyrimidin nucleosides, the 1-β-D-ribosyl uridylic of muttering.Cytidine(C (cytosine riboside) has another name called cytidine (cytidine), cytidine, 1-β-D-furans nucleosides cytosine(Cyt).Pyrimidine nucleoside is multiduty nucleosides, can be used as the additive of healthcare products and food.It also becomes the requisite of people's life gradually as beauty treatment and anti-ultraviolet radiation makeup, as medicine, clinical application is in nervus centralis, uropoiesis, metabolism and many-sided disease such as cardiovascular, in the U.S., the nucleic acid medicine has shown irreplaceable effect at antiviral, anti-tumor aspect in recent years.

Because the important physiological action of pyrimidine nucleoside and analogue thereof, related microorganism is produced the existing a lot of researchs of miazines nucleosides both at home and abroad.Yet as the Cordyceps fungus of important anabolism miazines nucleosides, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in the Cordyceps fungus miazines nucleosides metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is for the deficiency of above existence and the technical issues that need to address, " hundred make " produced enzyme and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore anabolism bisphosphate pyrimidine nucleoside and further investigate, the enzyme, encoding gene and the application thereof that provide " hundred make " production bacterium Cordyceps sinensis China pilose spore participation pyrimidine nucleotide to set out anabolism bisphosphate pyrimidine nucleoside.

The technical solution used in the present invention is:

The present invention relates to a kind ofly produce bacterium Cordyceps sinensis China pilose spore from " hundred make " and participate in the set out UMP-CMP kinase of anabolism bisphosphate pyrimidine nucleoside of pyrimidine nucleotide, described enzyme has the 90% above homology of aminoacid sequence shown in the SEQ ID No.1, and preferably its aminoacid sequence (is designated as pynG albumen) shown in SEQ ID No.1; But this enzyme catalysis pyrimidine nucleotide prepares the bisphosphate pyrimidine nucleoside.Because the singularity of aminoacid sequence; any fragment or its variant that contains the peptide protein of aminoacid sequence shown in the SEQ ID No.1; such as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology all belong to the row of protection domain of the present invention more than 90%.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in the aminoacid sequence; Wherein, for the conservative property change of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replacing Isoleucine with leucine, variant also can have non-conservation and change, as replacing glycine with tryptophane.

Cordyceps sinensis China pilose spore UMP-CMP kinase UMP-CMP kinase biocatalysis pyrimidine nucleotide of the present invention prepares the bisphosphate pyrimidine nucleoside, and reaction equation is:

The invention still further relates to described enzyme and prepare application in the bisphosphate pyrimidine nucleoside at the biocatalysis pyrimidine nucleotide.

Further, described being applied as: to contain the broken mixed solution of wet thallus after cytoclasis that Cordyceps sinensis China pilose spore UMP-CMP kinase thalline fermentation culture obtains as catalyzer, take pyrimidine nucleotide as substrate, be in the transformation system that consists of of 6.5 ~ 8.5 buffered soln in pH, conversion reaction 2 ~ 3h under 30 ℃, 150rpm condition, after reaction finishes, with reacting liquid filtering, get the crude product that filtrate being contains the bisphosphate pyrimidine nucleoside, described crude product separation and purification obtains the bisphosphate pyrimidine nucleoside.

Further, the starting point concentration of described substrate is 10g/L, and the volumetric usage of described catalyzer is the 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

The invention still further relates to the encoding gene of above-mentioned enzyme, it is Cordyceps sinensis China pilose spore UMP-CMP kinase gene, described gene has the nucleotide sequence 90% above homology shown in the SEQ ID No.2, and preferably its nucleotide sequence (is designated as the pynG gene) shown in SEQ ID No.2.Because the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO:2 as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide change that has.The variant of these polynucleotide can make living displacement varient or the varient of non-life, comprises replacing varient, deletion mutation body and inserting varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from the function of the peptide protein that changes in fact its coding.

Described gene can be used for making up the genetic engineering bacterium that can the biocatalysis pyrimidine nucleotide prepares the bisphosphate pyrimidine nucleoside, to enlarge the output of bisphosphate pyrimidine nucleoside or derivatives thereof.

The invention still further relates to the application of described gene in making up the genetic engineering bacterium that can the biocatalysis pyrimidine nucleoside prepares pyrimidine nucleotide.

Further, described being applied as: make up the recombinant vectors that contains described Cordyceps sinensis China pilose spore UMP-CMP kinase gene, described recombinant vectors is converted in the intestinal bacteria, the recombination engineering bacteria that obtains carries out inducing culture, and the nutrient solution separation and purification obtains to contain the somatic cells of Cordyceps sinensis China pilose spore UMP-CMP kinase.

Aminoacid sequence of the present invention is that the enzyme work of the Cordyceps sinensis China pilose spore UMP-CMP kinase shown in the SEQ ID No.1 is defined as: under optimum condition (30 ℃), can transform the enzyme amount of 1 micromole's pyrimidine nucleotide in 1 minute.

It is that the bacterial strain of encoding gene shown in the Cordyceps sinensis China pilose spore UMP-CMP kinase shown in the SEQ ID No.1 and the SEQ ID No.2 is China pilose spore (Hirsutella Sinensis) L0106 that aminoacid sequence of the present invention can be provided, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly discloses among the patent CN102373190A of application.

Main points of the present invention have been to provide the nucleotide sequence shown in the aminoacid sequence shown in the SEQ ID NO:1 and the SEQ ID NO:2, in the situation of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, all be apparent to those skilled in the art.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in great detail the synthetic bisphosphate pyrimidine nucleoside pathways metabolism of pyrimidine nucleotide on principle, the cloned DNA that comprises nucleotide sequence provided by the present invention can be used for by transduction, transform, changes in the engineering bacteria in conjunction with the method that shifts, by regulating the expression of bisphosphate pyrimidine nucleoside biosynthesis gene, give the high expression level of host's bisphosphate pyrimidine nucleoside, for the output that enlarges bisphosphate pyrimidine nucleoside or derivatives thereof provides effective way, has the major application prospect.

(4) description of drawings

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is pyrimidine metabolic approach annotated map;

Fig. 3 is UMP-CMP kinase gene PCR amplified production gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/pynG physical map;

Fig. 6 is recombinant expression plasmid pET-28a/pynG building process synoptic diagram;

Fig. 7 is recombinant expression plasmid pET-28a/pynG physical map;

Fig. 8 is UMP-CMP kinase protein SDS-PAGE figure.

(5) embodiment

The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: at first gather natural cordyceps from Qinghai, and it is taken back Hangzhou carry out separation screening, obtained the L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly discloses among the patent CN102373190A of application.

With this bacterial classification inoculation in the inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, prepare afterwards again bevel in following ratio) be glucose 2.0%(w/v, contain 1g in the 1% expression 100mL substratum, down together), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, sal epsom 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water, cultivates 25 days at 12 ~ 16 ℃; Then with bacterial classification inoculation in fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, sal epsom 0.01%, potassium primary phosphate 0.02%, surplus is water, place on the shaking table, 12 ~ 16 ℃ of cultivations of temperature 25 days under aseptic condition, are carried out solid-liquid separation after cultivation finishes, and solid placed aseptic utensil, for subsequent use.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

Extract total RNA with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly adding liquid nitrogen fully is ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mixing leaves standstill 5min on ice, and the nucleic acid-protein mixture is separated fully.2) RNA separates: add the 0.2mL chloroform, firmly shake mixing 15s, leave standstill 2 ~ 3min on ice, and 4 ℃, the centrifugal 15min of 12000rpm, the upper strata water is got in layering, about 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leave standstill 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol will precipitate and hang, and leave standstill 10min on ice, 4 ℃, the centrifugal 15min of 7500rpm; Washing step above repeating is washed one time again.5) dissolving RNA: centrifuge tube is placed unlimited dry 5 ~ 10min on ice, add an amount of DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

After extracting the total RNA of sample, use with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, with the synthetic article one cDNA chain of hexabasic basic random primer (random hexamers), then synthesize second cDNA chain, pass through again QiaQuick PCR test kit purifying and add the EB buffer solution elution and do terminal reparation afterwards, add polyA and connect sequence measuring joints, then carrying out clip size with agarose gel electrophoresis selects, carry out at last pcr amplification, the sequencing library of building up checks order with Illumina GA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains the adaptor sequence among the primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo(Li, Zhu et al. De novo assembly of human genomes with massively parallel short read sequencing [J]. Genome Res, 2010,20:265-272.) do and transcribe group and from the beginning assemble.The reads that SOAPdenovo at first will have certain-length overlap is linked to be the longer Contig fragment that does not contain N.Then reads is compared back Contig, determine from the different Contig of same transcript and the distance between these Contig by paired-end reads, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads that Scaffold is done filling-up hole and process, it is minimum to obtain at last containing N, the Unigene sequence that two ends can not prolong again.At last, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are blastx compare (evalue＜0.00001), get the sequence direction that the best albumen of comparison result is determined Unigene.If the comparison result between the different sink is contradictory, then press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al. ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J]. In Proceedings of 9th InternationalConference on Intelligent Systems for Molecular Biology. AAAIPress, Menlo Park, CA, pp. 1999,138-148.) predict its coding region and determine the direction of sequence.Provide its sequence from 5' to the 3' direction for the Unigene that can determine the sequence direction, provide the sequence that composite software obtains for the Unigene that can't determine the sequence direction.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function note, Pathway note, COG functional annotation and the Gene Ontology(GO of Unigene) functional annotation.At first, by blastx with the Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue＜0.00001), obtain having the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.Can further obtain the Pathway note of Unigene according to the KEGG annotation information.Unigene and COG database are compared, and the possible function of prediction Unigene is also done the function statistic of classification to it.According to the nr annotation information, use Blast2GO software (Conesa, Gotz et al. Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J]. Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.After obtaining the GO note of each Unigene, with WEGO software (Ye, Fang et al. WEGO:a web tool for plotting GO annotations[J]. Nucleic Acids Research, 2006,34:293-297.) all Unigene are done GO functional classification statistics, from the gene function distribution characteristics of these species of macroscopic view understanding.

Embodiment 6: " hundred make " produced bacterium Cordyceps sinensis China pilose spore bisphosphate pyrimidine nucleoside pathways metabolism and analyzed

Fig. 2 is the pyrimidine metabolic (map00230) in the KEGG pathways metabolism note, the enzyme of note is that " hundred make " that has detected produced bacterium Cordyceps sinensis China pilose spore pyrimidine metabolic approach relevant enzymes, as can be seen from the figure, detected from 1 Unigene of UMP-CMP kinase of the synthetic bisphosphate pyrimidine nucleoside of pyrimidine nucleotide.Detect online by the ORF Finder software among the NCBI, found out the open reading frame (SEQ ID No.2) of this gene and obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces the design of bacterium Cordyceps sinensis China pilose spore UMP-CMP kinase gene primer

The gene open reading frame dna sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, be used for the UMP-CMP kinase gene that clone's " hundred make " produces bacterium China pilose spore anabolism bisphosphate pyrimidine nucleoside, primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized, and primer sequence is following listed:

PynG gene: forward primer 5 ' ACTGAATTCATGCCGTGTCGCTCATCTGC 3 '

Reverse primer 5 ' AGGGTCGACTTATGAGTTTCTACGGTGTTC 3 '

The pynG mrna length is 1266bp

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

After the method that provides according to embodiment 1 is first turned out sutella sinensis fermented mycelium, the method that provides according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain by following behind total RNA, be used for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) the following mixed solution of preparation in the Microtube pipe.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, can improve reverse transcription reaction efficient, so carry out sex change, annealing reaction at the PCR instrument, condition setting is as follows:

65℃，5 min

3) the centrifugal several seconds made the mixed solution of template ribonucleic acid/primer etc. be gathered in Microtube pipe bottom after annealing finished.

4) the following inverse transcription reaction liquid of preparation in above-mentioned Microtube pipe.

5) on the PCR instrument, carry out reverse transcription reaction by following condition.

42℃ 15～30 min

70℃ 15 min

Generalized case, at eukaryote mRNA 3 ' end a PolyA structure is arranged, the quantity of A base does not wait to hundreds of is individual ten, utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, synthetic cDNA the first chain take mRNA as template, the present invention adopts the sequence (providing among the PrimeScript 1st Strand cDNA Synthesis Kit) in the dT zone of being developed alone by TaKaRa to be primer, if the mRNA integrity that obtains is better, can obtain so cDNA first chain of all zymoprotein encoding genes in the species by the reverse transcription process.

Embodiment 9: " hundred make " produces the detection of bacterium Cordyceps sinensis China pilose spore anabolism bisphosphate pyrimidine nucleoside functional gene UMP-CMP kinase pynG gene cloning, expression and protein vigor

1, the pcr amplification of UMP-CMP kinase pynG gene

CDNA the first chain that obtains in the embodiment 8 is as template, with pynG gene primer synthetic among the embodiment 7: 5 ' ACT GAA TTC ATG CCG TGT CGC TCA TCT GC 3 ', 5 ' AGG GTC GAC TTA TGA GTT TCT ACG GTG TTC 3 ' carry out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2, UMP-CMP kinase pynG gene PCR product gel electrophoresis detection

Concrete detection method is: 0.9% the sepharose that 1) will prepare makes its dissolving evenly with microwave-oven-heating; 2) get the 15mL gel, when treating that gel is cooled to 50 ℃ of left and right sides, add 1 μ L staining fluid Gold view, pour on the treatments of Electrophoretic Slab Gels after mixing, remove and insert the point sample comb behind the bubble; 3) after gel solidifies, carefully take out the point sample comb, offset plate is put into electrophoresis chamber (point sample hole one end is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add the TAE electrophoretic buffer; 4) get 5 μ L samples and then add 6 * Loading Buffer, 1.5 μ L and ddH ₂Using liquid-transfering gun loading, applied sample amount after O 4 μ L mix is 10 μ L; 5) supply lead between connection electrophoresis chamber and the electrophoresis apparatus, just very red, negative pole is black; 6) power-on, the beginning electrophoresis, maximum voltage is no more than 5 V/cm; 7) when sample ran offset plate 2/3 the time can stop electrophoresis; 8) cut off the electricity supply after, gel taken out puts into the gel imaging instrument and observe, take pictures.

The size of transcribing group order-checking prediction UMP-CMP kinase pynG gene is 1266bp, and agarose gel electrophoresis result (Fig. 3) shows and successfully amplified UMP-CMP kinase pynG gene.

3, the base A that adds of UMP-CMP kinase pynG gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier after after glue reclaims, also need adding base A processing, purifying.It is as follows that glue recovery product adds base A system:

72 ℃ add A base 20 min in the PCR instrument, use at last AxyPrep PCR cleaning agents box purifying.

4, UMP-CMP kinase pynG gene and cloning vector is connected

Cloning vector pMD18-T Vector is available from TaKaRa company (TaKaRa code D101A), its physical map is seen Fig. 4, UMP-CMP kinase pynG gene is connected construction recombination plasmid pMD18-T/pynG with cloning vector, physical map is seen Fig. 5, and linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 ℃, 16h; Deactivation: 65 ℃, 15min.

5, the conversion of UMP-CMP kinase recombinant plasmid pMD18-T/pynG

Recombinant plasmid pMD18-T/pynG changed among the intestinal bacteria E. coli JM109 make up the recombinant bacterium E. coli JM109/pMD18-T/pynG that carries UMP-CMP kinase pynG gene.Concrete steps are: 1) 10 μ L reaction systems are gone among the competent cell E. coli JM109 ice bath 30min; 2) thermal shock: 42 ℃, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 ℃, 250rpm, 1h; 5) spread plate (containing the Amp resistance); 6) 37 ℃ of incubator overnight incubation.

6, the positive restructuring of UMP-CMP kinase E. coli JM109/pMD18-T/pynG screening

Bacterium colony PCR can extract genomic dna, and the DNA that directly exposes after the thalline pyrolysis carries out pcr amplification as template, and whether the method is easy and simple to handle, quick, can the Rapid identification bacterium colony be the positive bacterium colony that contains the purpose plasmid.Bacterium colony at first adds with toothpick picking list bacterium colony and to contain in the 1.5mL centrifuge tube of 50 μ L sterilized waters, boiling water bath 30min, then centrifugal with supernatant as template, carry out pcr amplification, the PCR program setting is Taq enzymatic amplification general procedure.Adopt at last 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of UMP-CMP kinase recombinant plasmid pMD18-T/pynG

After the detected positive recombinant bacterium liquid LB culture medium culturing of bacterium colony PCR spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is finished by Shanghai Sani's bio tech ltd.Through sequence verification, sequence SEQ ID No.2 recombinates to pMD18-T/pynG.

8, the structure of UMP-CMP kinase recombinant expression plasmid pET-28a/pynG

The experimental basis foreign gene is in the principle of expression in escherichia coli, and expression vector pET-28a and UMP-CMP kinase pynG gene restriction enzyme site comparison situation, determined EcoR I and Sal I double enzyme site, and recombination bacillus coli E. coli JM109/pMD18-T/pynG has been carried out the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.

The recombinant plasmid of UMP-CMP kinase pynG gene and expression vector pET-28a with EcoR I/Sal I restriction enzyme 37 ℃ respectively enzyme cut and process 6h, it is as follows that enzyme is cut system:

EcoR I/Sal I double digestion system:

Enzyme is cut and is finished rear 65 ℃ of deactivation 15min, then respectively with Axygen dna gel recovery test kit reclaim, purifying.

UMP-CMP kinase pynG gene and expression vector pET-28a spend the night with 16 ℃ of connections of T4 ligase enzyme behind double digestion, purifying again, make up recombinant expression plasmid pET-28a/pynG, its building process is seen Fig. 6, makes up the recombinant expression plasmid pET-28a/pynG collection of illustrative plates that obtains and sees Fig. 7.Linked system is composed as follows:

Linked system:

9, the screening of the conversion of UMP-CMP kinase recombinant expression plasmid pET-28a/pynG and positive monoclonal

The expression plasmid heat shock that builds is converted in the E. coli BL21 Host Strains, then is applied on the LB agar plate that contains kantlex (Kan) resistance (50mg/L) 37 ℃ of overnight incubation.Random choose list bacterium colony from the flat board carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of UMP-CMP kinase recombinant bacterium E. coli BL21/pET-28a/pynG

Be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (50mg/L) 37 ℃, 250r/min overnight incubation with being accredited as positive mono-clonal.Get the 1mL culture, it is transferred contain in the LB liquid nutrient medium of Kan resistance 37 ℃, 250r/min in 50mL and be cultured to cell concentration OD600 and be about about 0.6～0.8.The IPTG inducing culture 8h that adds respectively finite concentration (240mg/ml) in the culture.It is centrifugal to get inducing culture liquid, collects wet thallus and surveys for electrophoresis analysis and enzyme biopsy.

11, UMP-CMP kinase recombinant bacterium E. coli BL21/pET-28a/pynG expression product SDS-PAGE analyzes

With the E. coli BL21 bacterium that changes empty carrier over to and the recombinant bacterium that do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium behind IPTG inducing culture certain hour, get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in the 50 μ L distilled water, add 50 μ L sample-loading buffers, boil 10min behind the mixing, carry out the SDS-PAGE electrophoretic analysis, it is shown in the SEQ ID No.1 through its aminoacid sequence of sequence verification that " C " swimming lane among Fig. 8 is the UMP-CMP kinase albumen pynG(that recombinant bacterium E. coli BL21/pET-28a/pynG expresses) SDS-PAGE figure.

12, the protein-active of UMP-CMP kinase recombinant bacterium E. coli BL21/pET-28a/pynG detects

Enzyme liquid preparation: the recombinant bacterium E. coli BL21/pET-28a/pynG wet thallus 0.5g(dry weight 0.1g that takes by weighing collection) use respectively phosphate buffered saline buffer (50mM, pH8.0) 15mL to suspend, the thalline mixed solution that obtains after the ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) is as the catalysis enzyme.

UMP-CMP kinase pynG transformation system: in 50mL conversion bottle, add E. coli BL21/pET-28a/pynG ultrasonication thalline 10mL, 0.1g cytidylic acid or 0.1g and urinate sweet acid or 0.1g deoxycytidylic acid, 30 ℃, 150r/min transform 2 ~ 3h, after transforming end, the centrifuging and taking supernatant, standby with subsequent detection.

Detection method: high performance liquid chromatography detection by quantitative pyrimidine nucleoside.Pre-treatment: after conversion fluid was centrifugal, supernatant liquor was crossed 0.22 μ m microporous membrane and is used for the high performance liquid chromatography detection.Condition: chromatographic column: Agilent C18 post (4.6mm * 250mm i.d.5 μ m); Column temperature: 35 ℃; Sampling volume: 20 μ L; Flow velocity 1mL/min; Detect wavelength 260nm; Moving phase: A: ultrapure water; B: methyl alcohol.Gradient elution: 0min, 15%B keeps 3min; 3.0-3.5min, 15-24%B; 3.5min 24% keeps 5min; 8.5-9.0min, 24-35%B; 35%B keeps 6min; 15.0-16.0min, 35-85%B; 85%B keeps 6min; 22.0-22.5min, 85%-15%B; 15%B keeps 5min.

The making of typical curve: accurately take by weighing each ucleosides standard substance (cytidine diphosphate (CDP), uridine diphosphate (UDP), dCDP), about 1.00mg-2.00mg, ultrapure water constant volume.Each standard substance preparation 6 gradient (1 μ g/mL, 30 μ g/mL, 60 μ g/mL, 90 μ g/mL, 120 μ g/mL, 150 μ g/mL).Then loading successively, each concentration repeats for 5 times.After the reference liquid of getting the certain volume maximum concentration mixes, constant volume, then HPLC analyzes the optimal conditions that pyrimidine nucleoside detects.

Detect and calculate through above-mentioned chromatographic condition, we draw to draw a conclusion: the high specific enzyme of the UMP-CMP kinase that UMP-CMP kinase recombinant bacterium E. coli BL21/pET-28a/pynG is expressed (Specific Activity) alive is alive more maximum than enzyme in 8.76mol/min/mg(cytidylic acid, the sweet acid of urine and the deoxycytidylic acid), substrate conversion efficiency is respectively 55%, 53%, 57%.

SEQUENCE LISTING

＜110〉Zhejiang Polytechnical University, Zhongmei Huadong Pharmaceutical Co., Ltd. Hangzhou

＜120〉Cordyceps sinensis China pilose spore UMP-CMP kinase, encoding gene and application

<130> -

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 282

<212> PRT

<213> Hirsutella Sinensis

<400> 1

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg

20 25 30

Gly Ser Glu Phe Met Arg Cys Gly Arg Lys Leu Asn Leu Ile Trp Val

35 40 45

Asp Ser Glu Gln Leu Glu Asp Lys Thr Gln Asn Ser Asp Pro Gly Gly

50 55 60

Phe Tyr Lys Ala Trp His Asn Val Ser Thr Ala Ala Gly Ile Leu Val

65 70 75 80

Pro Gly Gly Phe Gly Gln Arg Gly Thr Glu Gly Met Ile Lys Ala Ala

85 90 95

Gln Tyr Ala Arg Glu His Lys Arg Pro Tyr Leu Gly Ile Cys Leu Gly

100 105 110

Met Gln Ile Ala Val Ile Glu Tyr Ala Arg His Val Cys Gly Leu Ala

115 120 125

Lys Ala Thr Ser Glu Glu Phe Asp Ala Arg Ala Glu His Arg Leu Ile

130 135 140

Ile Phe Met Pro Glu Gly Ser Lys Asp Thr Met Gly Gly Thr Met Arg

145 150 155 160

Leu Gly Ser Arg Glu Thr His Phe Gln Ala Gly Ser Glu His Ser Lys

165 170 175

Leu Arg Ala Leu Tyr Gly Glu Ala Thr Val Ile Glu Glu Arg His Arg

180 185 190

His Arg Tyr Glu Val Asn Pro Glu Tyr Val Arg Asp Leu Glu Glu Ala

195 200 205

Gly Leu Thr Phe Val Gly Lys Asp Asp Ser Gly Asn Arg Met Glu Ile

210 215 220

Leu Glu Leu Arg Asp His Pro Trp Phe Val Gly Val Gln Tyr His Pro

225 230 235 240

Glu Tyr Leu Ser Arg Val Leu Asp Pro Ser Arg Pro Tyr Leu Gly Phe

245 250 255

Val Ala Ala Ala Ala Gly Cys Leu Glu Arg Val Thr Tyr Glu Ala Arg

260 265 270

Lys Glu Thr Thr Pro Asp Asn Ser Cys Phe

275 280

<210> 2

<211> 849

<212> DNA

<213> Hirsutella Sinensis

<400> 2

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atggctagca tgactggtgg acagcaaatg ggtcgcggat ccgaattcat gcgctgcggt 120

cggaaactga acctgatttg ggtcgattct gagcagctgg aagacaagac gcagaacagt 180

gaccctggcg gcttctacaa ggcgtggcac aatgtctcga ccgccgctgg catcctggtc 240

ccgggaggat ttggccaacg cggcactgag ggcatgatta aggcagccca gtatgcccgc 300

gagcacaaga ggccctactt gggcatctgt ctcggcatgc agatcgccgt gattgagtac 360

gcgaggcacg tctgcggcct ggcaaaggcc acatcggagg agtttgacgc ccgtgccgag 420

caccgcctta tcattttcat gcctgaagga tccaaggaca ccatgggcgg tacgatgcgc 480

cttggctcgc gggagacgca cttccaggcc ggcagcgaac atagcaagct ccgggcgctc 540

tacggtgagg cgaccgttat cgaggagcgc catcgccacc gctacgaggt gaaccctgag 600

tacgtcaggg acctcgaaga ggccggccta acatttgtcg gcaaggacga ctcaggtaat 660

cgcatggaga tattagagct tcgcgaccac ccttggtttg taggcgttca gtatcatcct 720

gagtacctaa gtcgcgttct cgacccctcc cgcccatacc taggctttgt tgcggctgct 780

gctgggtgct tggaaagggt tacatatgag gctcggaagg agacgacgcc tgataattct 840

tgcttttag 849

Claims (10)

1. a Cordyceps sinensis China pilose spore UMP-CMP kinase is characterized in that described enzyme has the 90% above homology of aminoacid sequence shown in the SEQ ID No.1.

2. Cordyceps sinensis China pilose spore UMP-CMP kinase as claimed in claim 1, the aminoacid sequence that it is characterized in that described enzyme is shown in the SEQ ID No.1.

3. Cordyceps sinensis China pilose spore UMP-CMP kinase prepares application in the bisphosphate pyrimidine nucleoside at the biocatalysis pyrimidine nucleotide as claimed in claim 1.

4. application as claimed in claim 3, it is characterized in that described being applied as: to contain the broken mixed solution of wet thallus after cytoclasis that Cordyceps sinensis China pilose spore UMP-CMP kinase thalline fermentation culture obtains as catalyzer, take pyrimidine nucleotide as substrate, be in the transformation system that consists of of 6.5 ~ 8.5 buffered soln in pH, conversion reaction 2 ~ 3h under 30 ℃, 150rpm condition, after reaction finishes, with reacting liquid filtering, get the crude product that filtrate being contains the bisphosphate pyrimidine nucleoside, described crude product separation and purification obtains the bisphosphate pyrimidine nucleoside.

5. application as claimed in claim 4, the starting point concentration that it is characterized in that described substrate is 10g/L, and the volumetric usage of described catalyzer is the 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

6. gene of the described enzyme of claim 1 of encoding.

7. gene as claimed in claim 6 is characterized in that described gene has the nucleotide sequence 90% above homology shown in the SEQ ID No.2.

8. gene as claimed in claim 7 is characterized in that the nucleotides sequence of described gene is classified as shown in the SEQ ID No.2.

9. such as the application of gene as described in one of claim 6 ~ 8 in making up the genetic engineering bacterium that can the biocatalysis pyrimidine nucleoside prepares pyrimidine nucleotide.

10. application as claimed in claim 9, it is characterized in that described being applied as: make up the recombinant vectors that contains described Cordyceps sinensis China pilose spore UMP-CMP kinase gene, described recombinant vectors is converted in the intestinal bacteria, the recombination engineering bacteria that obtains carries out inducing culture, and the nutrient solution separation and purification obtains to contain the somatic cells of Cordyceps sinensis China pilose spore UMP-CMP kinase.

Images