CN105349566B - A kind of preparation method for the oral recombination nutrition polypeptide supplementing essential amino acid - Google Patents

Abstract

The present invention relates to a kind of preparation methods of oral recombination nutrition polypeptide for supplementing essential amino acid, belong to recombination fusion protein technical field of pharmaceuticals；Nutrition polypeptide gene np with enterokinase label is integrated on pJS700 carrier by the present invention, then use gemma capsid protein gene cotC as molecular vehicle, construct the integrated recombinant plasmid of amalgamation and expression, converted bacillus subtilis, make exogenous origin gene integrator in the amylase gene on chromosome, and the recombined bacillus subtilis bacterial strain of the cotC-NP containing amalgamation and expression is filtered out, the spore surface that induction recombinant bacterial strain generates shows nutrition polypeptide；The surface display that the present invention constructs has the recombinant spore of enterokinase label nutrition polypeptide, can be used for animal, people and directly takes orally in the free digestion and absorption of enteron aisle progress, becomes a kind of novel oral sport nutrition health care product, be with a wide range of applications；It overcomes BCAA and derives from the limitation that chemical synthesis is extracted, also overcome the disadvantage of recombination fermenting and producing nutrition peptide separation purification process complexity.

Description

A kind of preparation method for the oral recombination nutrition polypeptide supplementing essential amino acid

Technical field

The present invention relates to preparation methods and product that essential amino acid constitutes polypeptide and its recombinant spore surface display, specifically It is related to a kind of preparation method of oral recombination nutrition polypeptide for supplementing essential amino acid, belongs to recombination fusion protein drug skill Art field.

Background technique

Amino acid (Amino acid) is the basic unit for constituting protein, assigns the specific molecular structure shape of protein State participates in the physiological and biochemical procedures such as catalysis, transport, movement, defence and the transmitting of protection information of protein.It is formed in nature The amino acid of protein is mainly 20 kinds, and wherein human body, which cannot synthesize, or aggregate velocity can not meet human metabolism more slowly needs The amino acid wanted is known as essential amino acid.Essential amino acid usually has 8 kinds, i.e., isoleucine, leucine, lysine, methionine, Phenylalanine, threonine, valine, tryptophan, are generally supplied by food protein.If human body lacks any required ammonia Base acid, so that it may cause physiological function abnormal, influence being normally carried out for antibody metabolism, so that the immune function of body be made to decline and lead Cause disease.Essential amino acid insufficiency of intake can also cause the reduction of insulin synthesis, and the raising for thus easily causing blood glucose is led Diabetogenic occurrence and development (Miyake T, Abe M, Furukawa S, et al.Long-term branched-chain amino acid supplementation improves glucose tolerance in patients with nonalcoholic steatohepatitis-related cirrhosis.Intern Med,2012,51(16):2151- 2155.).Human body is also changing with the synthesis and degradation of the variation at age its protein, it is considered that in the elderly's body Breaks down proteins it is more and synthesize it is slower, so the elderly needs the raw material of synthetic proteins matter more for person between twenty and fifty, Demand (Tatpati LL, Irving BA, Tom A, et al.The effect of especially to methionine and lysine branched chain amino acids on skeletal muscle mitochondrial function in young and elderly adults.J Clin Endorcrinol Metab,2010,95(2):894-902).Research in recent years report, The elderly and young people give identical nutritional condition, but (figured silk fabrics, relies, egg, silk, the third ammonia bright, junket for the elderly its Amino Acid Acid) content attenuating, special branched-chain amino acid BCAA (figured silk fabrics, bright, isoleucine) display is insufficient.The U.S. in 1998 " it was found that " number space flight Aircraft can be improved the resistance and anti-aging of body in the intake that the human trial of space demonstrates essential amino acid, subsequent Clinical test also illustrate that the supplement of essential amino acid is reasonably necessary for the elderly.Study Of Sports Nutriology also indicates that The supplement of BCAA can slow down the consumption of energy substance, the generation of delay fatigue, promote fatigue recovery (Kim DH, Kim SH, Jeong WS,et al.Effect of BCAA intake during endurance exercises on fatigue substances,muscle damage substance,and energy metabolism substances.J Exerc Nutrition Biochem,2013,17(4):169-180.).It is oral that there are many relevant compound amino acids currently on the market Liquid, but this kind of product is expensive, and ratio contained by branched-chain amino acid BCAA is not high, is easy by gastrointestinal tract extreme environment pair The influence and destruction of amino acid structure reduce absorption efficiency.Has the method Escherichia coli fermentation by genetic engineering at present Production recombinates various nutrition polypeptides, but to realize and take orally to digest polypeptide and supplement essential amino acid, improves human motion efficiency With reduce fatigue still there are many shortcomings that and deficiency because Escherichia coli contain there are many endotoxin product purity is wanted in this way Ask high, any micro foreign protein all may cause serious immune response.This makes fermentation method production recombination nutrition polypeptide Isolation and purification method and step it is complicated, production cost is higher.

Bacillus subtilis is environmentally friendly bacterium, is had very to harmful bacterias such as vibrios, Escherichia coli and baculovirals Strong inhibiting effect, when nutritional deficiency, can form the gemma in metabolism dormant state, and gemma can be sprouted again under optimum conditions At the vegetative cell with fertility, the promotion such as a large amount of multivitamins, organic acid, amino acid, protease, carbohydrase is generated The substance of digestion and absorption.Gemma is easy culture, than it is great it is easily separated, do not need complicated to isolate and purify operation.Gemma is biology The strongest life entity of resistance in boundary, stability is good, can resistance to oxidation, high temperature resistant, can long-term resistance to 60 DEG C of high temperature, 120 DEG C~ 140 DEG C can also survive a few houres, and anti-chemicals and in terms of it is also very prominent, can deposit in harsh environment Several years living to decades.Gemma is able to maintain activity in acidic stomach environment, can be passed through dynamic with the attack of resistance to saliva and bile Object alimentary canal goes directly intestine and small intestine, can be used as the carrier of heterologous protein or bioactive molecule under extreme environment (such as gastrointestinal tract) (Oggioni MR,Ciabattini A,Cuppone AM,and Pozzi G.2003.Bacillus spores for vaccine delivery.Vaccine.31:96-101).After bacillus subtilis enters alimentary canal with spore state, rapidly by Dormant state is brought back to life, and is multiplied into the dominant population of high bacteria containing amount in a short time, is consumed a large amount of oxygen in enteron aisle, and can generate Hydrogen oxide, bacteriocin, establish microecological balance, promote the breeding beneficial to anaerobe, inhibit harmful bacteria (Escherichia coli, Salmonella) growth, thus can stomach tract disease, immunity and the constitution for enhancing body such as pre- anti-diarrhea, diarrhea it is horizontal. There are oral bacillus subtilis viable capsule product, Zizhu Pharmaceutical Co., Ltd., Beijing, national drug standard currently on the market S20030018 (http://www.777aaa.com/html/yao/200791823 402711963569029.htm), shows Bacillus subtilis spore can be administered orally by people and generate efficacy.

It is an object of the invention to the digestion features according to human gastrointestinal tract, with probiotics bacillus subtilis spore capsid Albumen is carrier, and the nutrition polypeptide display of enterokinase label A sp-Asp-Asp-Asp-Lys will be had by gemma display technique In spore surface, enable polypeptide obtain rapid, high volume expression have while good resistance human body intestinal canal carry out proliferation and It freely digests and assimilates, the oral healthcare suitable for the recombination nutrition polypeptide that rapid, high volume preparation has effects that supplement essential amino acid Product.The product combines the resistance feature of bacillus subtilis and the digestive characteristic of human gastrointestinal tract, increases enterokinase position Point, develop can in the nutrition health-care polypeptide product that human oral is freely digested and assimilated, meanwhile, can be carried out large-scale work Industry production, so far there is not yet similar report and patent of invention.

Summary of the invention

Human nutrition and sport efficiency are improved in order to effectively obtain supplement essential amino acid, the present invention provides one Kind surface display is rich in the preparation method and product of BCAA nutrition polypeptide recombinant spore.The present invention is with bacillus subtilis spore clothing Glutelin CotC is carrier, and the battalion of enterokinase label A sp-Asp-Asp-Asp-Lys will be had by spore surface display technique Polypeptide display is supported in the spore surface of bacillus subtilis, can be used for animal and directly take orally, becomes a kind of novel raising campaign effect Rate be rich in BCAA nutrition polypeptide, safety, tolerance, pharmacodynamics and in terms of and compound amino acid With similar effect.Relative to other amino acids oral-liquor products, the preparation method master of surface display nutrition polypeptide of the present invention It is used for body and is taken to improve sport efficiency, while there is industrialized production feature, there is wider application value.It is this The invention of product overcomes current BCAA from chemically synthesized limitation, while also overcoming the battalion of Escherichia coli fermentation production The disadvantage for supporting peptide separation purification process complexity, has a good application prospect in field of health care products.

The technical scheme adopted by the invention is as follows: a kind of preparation method of oral recombination nutrition polypeptide utilizes withered grass gemma Bacillus gemma capsid protein gene CotC is molecular vehicle, is recombinated with the nutrition polypeptide gene np with enterokinase label, building The integrated recombinant plasmid pJS700-NP of amalgamation and expression, and convert bacillus subtilis and obtain bacillus subtilis recombinant bacterial strain Bacillus subtilis 168/pJS700-NP, induction recombinant bacterial strain generate recombinant spore, have in recombinant spore surface display Nutrition polypeptide is recombinated, the recombinant spore can pass through oral supplementation essential amino acid.

A kind of recombinant spore is by bacillus subtilis recombinant bacterial strain Bacillus subtilis 168/pJS700-NP The recombinant spore of induced synthesis, surface display have the fusion protein CotC-NP with enterokinase label.Specific behaviour of the invention Work is:

(1) section of DNA segment (SEQ ID NO.1) is designed, includes nutrition polypeptide gene fragment, is named as np, the battalion Feeding polypeptide gene fragment includes (lysine, tryptophan, phenylalanine, methionine, the Soviet Union's ammonia of eight kinds of amino acid needed by human Acid, isoleucine, leucine, valine) genetic fragment, further, the nutrition polypeptide gene np includes BCAA (branch ammonia Base acid) genetic fragment；

(2) nutrition polypeptide gene np is obtained by amplification in the method subsidiary company synthetic DNA segment of PCR (the raw work in Shanghai), The gene of acquisition is inserted into carrier pMD18-T and converts bacillus coli DH 5 alpha preservation；The recombinant plasmid of clone is named as PMD18-T-NP, recon Strain Designation are DH5 α/pMD18-T-NP；

(3) the recombinant plasmid pMD18-T-NP and plasmid pJS-700 that step (2) obtains pass through double digestion for nutrition polypeptide base Because np is inserted between KpnI the and EcoRI restriction enzyme site of prokaryotic expression plasmid pJS700, building can with human body intestinal canal The integrated recombinant plasmid pJS700-NP for freely digesting and assimilating enterokinase label A sp-Asp-Asp-Asp-Lys is turned with the plasmid Change bacillus subtilis (Bacillus subtilis 168), gemma is generated using depletion method induction host strain, in spore surface Displaying has the fusion protein CotC-NP with enterokinase label.

Selection has good conversion capability and can produce the bacillus subtilis strain of gemma and attaches most importance in the present invention The conversion bacterial strain of group plasmid, such as a series of Bacillus subtilis 168 and its derivative bacterial strain (Bacillus Genetic Stock Center,Department of Biochemistry,The Ohio State University, West 12th Avenue,Columbus,Ohio,43210,USA)；

Select gemma capsid protein gene cotC (Gene Bank sequence number: NP_389653) as surface displayed proteins Molecular vehicle.

Bacillus subtilis is environmentally friendly bacterium, and hypopus gemma, gemma can be differentiated to form in nutritional deficiency , can be with resistance to bronsted lowry acids and bases bronsted lowry with extremely strong resistance, survival ability is stronger, and it is than great, is readily isolated purifying.Withered grass The cultural method of bacillus is simple and convenient, and rapidly, nutritional requirement is simple for growth, is easy to carry out industry amplification culture.In withered grass The spore surface of bacillus shows the nutrition polypeptide for having enterokinase label, and nutrition polypeptide protein is made to obtain rapid, high volume expression While the stability freely digested and assimilated with good resistance and human body intestinal canal, and isolate and purify simple and efficient.

The present invention also provides gemma capsid protein gene cotC and np gene coded sequences selected in a kind of present invention The recombinant plasmid constructed after recombination, promoter containing gemma capsid protein gene in this recombinant plasmid are free of termination codon Gene after the coded sequence recombination of the coded sequence and np gene of son, can the fusion when bacillus subtilis is differentiated to form gemma Express CotC-NP.The integrated recombinant plasmid for freely digesting and assimilating enterokinase label with human body intestinal canal by constructing, so that melting It closes gene cotC-np and is integrated in the specific site on bacillus subtilis chromosome and stable progress heredity, avoid plasmid The shortcomings that being easily lost in B. subtilis cell.

It is thin that expression vector with amalgamation and expression PROTEIN C otC-NP can convert host by thermal shock method or electroporation Born of the same parents, the cell of successful conversion have the cell for the fusion that the present invention constructs by further screening, can pass through this field Well known method is identified, such as collects cell, DNA is extracted after cracking, then carries out PCR identification etc., can also be in induction table Western blot detection is carried out with NP antibody after reaching.

The present invention also provides the recombination and integration type plasmids of amalgamation and expression CotC-NP that the present invention constructs a kind of to convert withered grass bud Spore bacillus screens obtained recombinant bacterial strain, and the spore surface displaying of these recombinant bacterial strain induced synthesis has recombination nutrition polypeptide, And the recombinant polypeptide NP of its spore surface displaying can be detected by Western blot.

The primer sequence of the clone of gene np coding sequence fragment involved in the present invention are as follows:

Np-F (SEQ ID NO.2):

5’-GGGGTACCCCCTGAAGGTGACCATCAAGAC-3’

Wherein, single underscore indicates that restriction enzyme Kpn I, double underline indicate the recognition site of enterokinase；

Np-R (SEQ ID NO.3):

5-’CGGAATTCCGCTTGGTCACCAGCAGGATCAC- 3’

Wherein, single underscore indicates that restriction enzyme EcoR I, double underline indicate Flag label；

Bacillus subtilis amylase gene amyE involved in the present invention (Gene Bank sequence number: NP_388186) piece The primer sequence of section amplification:

AmyE-F:ATTGCTCGGGCTGTATGACTGG (SEQ ID NO.4)

AmyE-R:GTTACACCATCACTGTTCGTTCCTT (SEQ ID NO.5)

Outstanding advantages of the invention show themselves in that

By nutrition polypeptide display on bacillus subtilis surface, using uniqueness resistance possessed by gemma, so that nutrition Polypeptide protein passes through animal body digestion barrier.The surface display that the present invention constructs has enterokinase label A sp-Asp-Asp- The bacillus subtilis recombinant spore of Asp-Lys nutrition polypeptide can be used for animal, people and directly take orally freely to be disappeared in enteron aisle Change and absorb, becomes a kind of novel oral sport nutrition health care product, be with a wide range of applications and wide market value.This The invention of kind product overcomes current BCAA and derives from the limitation that chemical synthesis is extracted, and reduces the production valence of branched-chain amino acid Lattice, while also overcoming the disadvantage of the nutrition peptide separation purification process complexity of recombination fermenting and producing.

Detailed description of the invention

Fig. 1 is the corresponding amino acid knot of nutrition polypeptide np gene coded sequence search comparison in expasy that the present invention clones Fruit.Capitalization trigram letter indicates that np gene pairs should encode the codon of amino acid, has the trigram of small letter to indicate amino acid sequence Column, Chinese font indicate the mode of the digestion polypeptide of the digestive ferment in the presence of human body alimentary canal.

Fig. 2 is the construction method and its structure map of the integrated recombinant plasmid pJS700-NP of amalgamation and expression CotC-NP.Its In, 3 '-end of amyE 5 '-end and amyE respectively indicates the 5 ' ends and 3 ' ends of amylase gene coded sequence, by homologous heavy Group is incorporated into 168 (trp of Bacillus subtilis^-) chromosome amylase gene in；Amp^r, Em^rIt is green to respectively indicate ammonia benzyl Mycin resistant gene and erythromycin resistance gene, in 168 (trp of Escherichia coli and Bacillus subtilis^-) middle as sieve Choosing label.Enterokinase indicates the label site Asp-Asp-Asp-Asp-Lys of enterokinase digestion.CotC-np be Bacillus subtilis 168(trp^-) gemma in amalgamation and expression CotC-NP recombinant protein genetic fragment, which contains There are whole code sequences of the promoter sequence of cotC gene, the CotC coded sequence without containing cotC terminator codon and NP Column；OriC is that Escherichia coli replicate sub-piece.

Fig. 3 is 168 (trp of recombinant bacterial strain Bacillus subtilis^-The amylase activity of)/pJS700-NP analyzes knot Fruit.Wherein, 168 (trp of A: wild-type strain Bacillus subtilis^-) and recombinant bacterial strain Bacillus subtilis 168(trp^-)/pJS700-NP is cultivated on starch plate；B: in the iodine solution of starch plate wild type bacterial strain and recombinant bacterial strain Dyeing.

Fig. 4 is Em^r- cotC-np genetic fragment is in 168 (trp of Bacillus subtilis^-) integration in chromosome shows It is intended to.

Fig. 5 is the Em in PCR detection recombinant bacterial strain^r- cotC-np segment.Wherein, M:250bp DNA Ladder Marker；Respectively with 168 (trp of Bacillus subtilis^-) (Wild-type, WT) and Bacillus subtilis 168 (trp^-The chromosome of)/pJS700-NP (Transgenic, TG) is template, with amyE-F/amyE-R, np-F/np-R, np-F/ AmyE-R and amyE-F/np-R is that four groups of primer pairs (attached drawing 4 is seen in the position in chromosome of primer pair) carry out PCR identification weight Group gene.

The western blot of Fig. 6 transgenosis recombinant bacterial strain surface display NP recombinant spore is identified.Wherein, M: albumen pre-dyed Marker；Swimming lane 1: wild-type strain B.subtilis 168 (trp-) (negative control)；Swimming lane 2: without Flag label B.subtilis 168 (trp-)/pJS700-Np recombinant bacterial strain (positive control)；Swimming lane 3: without Flag label B.subtilis 168 (trp-)/pJS700-Bs recombinant bacterial strain (positive control)；Swimming lane 4: it is arrived with the anti-Flag antibody test of mouse Recombinant bacterial strain fusion protein cotC-Np；Swimming lane 5: the recombinant bacterial strain fusion protein cotC- that repetition is arrived with the anti-Flag antibody test of mouse Np。

Specific embodiment

Below in conjunction with specific embodiments and the drawings, the present invention is further described.

Experimental material:

Various restriction enzymes, T₄DNA ligase, LA Taq, Taq enzyme, pMD18-T carrier purchase most valuable treasure biology work Journey (Dalian) Co., Ltd, PCR primer are synthesized by Shanghai Jierui Biology Engineering Co., Ltd, are sequenced by hundred Ao Maike (Biomics) Bioisystech Co., Ltd completes, and the recycling for all DNA fragmentations of the invention is all made of Omega Bio- Tek Gel Extraction Kit is isolated and purified, coli strain DH5 α (China General Microbiological preservation administrative center CGMCC, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, institute of microbiology, the Chinese Academy of Sciences, 100101) it is that this laboratory saves, it is other Reagent is that domestic analysis is pure.

Term as used in the present invention, in the case where non-specifically illustrating, generally those of ordinary skill in the art institute The meaning of understanding.Do not make the Examination on experimental operation illustrated in following embodiment referring to " Molecular Cloning:A Laboratory guide " (Sambrook etc. writes, Science Press, version in 1992), kit specification and product description carry out.Implementation below Example is of the invention solely for the purpose of illustration, not limits the scope of the invention in any way.In the examples below, not in detail The some processes and method of description are all conventional method that is familiar to those skilled in the art and understanding.The source of agents useful for same, quotient The name of an article is indicated on the first occurrence, and same reagents used is unless otherwise specified, identical as what is indicated for the first time thereafter.This hair The biomaterial saved involved in bright embodiment by inventor can provide 20 years to the public.

Embodiment 1: clone, sequencing and the identification of nutrition polypeptide np gene

Amplification obtains nutrition polypeptide NP's in the synthetic DNA segment (the raw work in Shanghai) bought by the method subsidiary company of PCR Gene.

The PCR amplification primer of nutrition polypeptide np genetic fragment are as follows:

Np-F:GGGGTACCCCCTGAAGGTGACCATCAAGAC

Np-R:CGGAATTCCG TCCTTGGTCACCAGCAGGATCAC

PCR reaction system is strictly carried out by TaKaRa LA Taq operation instructions, and TaKaRa is contained in 20 μ L reaction systems II (Mg of LA Taq0.2 μ L, 10 × LA PCR Buffer²⁺Plus) 2 μ L, dNTP Mixture (each 2.5mM) 3.2 μ L, template DNA 100ng, upstream and downstream primer (20 μM) each 0.4 μ L, finally plus sterilizing ultrapure water polishing is to 20 μ L.PCR condition are as follows: 94 DEG C of changes Property 5min, 94 DEG C of 1min, 56 DEG C of 40s, 72 DEG C of 40s, 30 circulation.PCR product size is 180bp, including nutrition polypeptide np base The coded sequence of cause.By TaKaRa pMD18-T Simple Vector, (TaKaRa, precious bioengineering (Dalian) have amplified fragments Limit company) specification method, be cloned in pMD18-T carrier, convert bacillus coli DH 5 alpha, screening and cloning bacterial strain, extract matter Grain, by PCR and KpnI and EcoRI double digestion, agarose gel electrophoresis identifies positive colony, and surveys to recombinant plasmid The sequencing of sequence, cloned sequence is completed by hundred Ao Maike (Biomics) Bioisystech Co., Ltd.The recombinant plasmid of clone is named as PMD18-T-NP, recon Strain Designation are DH5 α/pMD18-T-NP.Positive restructuring bacterial strain is stored in the LB containing 15% glycerol In culture medium, freeze in -80 DEG C.

Embodiment 2: the preparation and application of the bacillus subtilis recombinant spore of NP are shown using CotC as carrier surface

1. the building of recombination and integration type plasmid pJS700-NP

(Li Qian is using CotX as the withered grass of molecular vehicle surface display WSSV envelope protein Vp19 and Vp28 by plasmid pJS700 Research [D] Zhenjiang, Jiangsu of bacillus recombinant spore: Jiangsu University, 2010:36-38) by Jiangsu University, Ningde, Environmental Studies Institute Rigid associate professor give, which is about 5.5kb.In pJS700 plasmid, 3 '-end of amyE 5 '-end and amyE difference 5 ' the ends and 3 ' ends for indicating amylase gene amyE (Gene Bank sequence number: NP_388186) coded sequence, by homologous heavy Group is incorporated into 168 (trp of Bacillus subtilis^-) chromosome amylase gene in.Amp^r, Em^rIt is green to respectively indicate ammonia benzyl Mycin resistant gene and erythromycin resistance gene, in 168 (trp of Escherichia coli and Bacillus subtilis^-) middle as sieve Choosing label.Enterokinase indicates the label site Asp-Asp-Asp-Asp-Lys of enterokinase digestion.CotC is withered grass gemma Bacillus gemma capsid protein CotC gene, the genetic fragment contain cotC gene (Gene Bank sequence number: NP_389653) Promoter sequence, the CotC coded sequence without containing cotC terminator codon；OriC is that Escherichia coli replicate sub-piece.

KpnI and EcoRI digested plasmid pMD18-T-NP and pJS-700 is used respectively, is returned with Ago-Gel QIAquick Gel Extraction Kit Np segment and pJS-700 are received, T is used₄Purified segment after two double digestion of DNA ligase connection, connection product convert large intestine bar Bacterium DH5 α competent cell, conversion product are coated on 37 DEG C of overnight incubations, next day in the LB plate containing 50 μ g/mL ampicillins Positive monoclonal bacterial strain is selected in the LB liquid medium containing 50 μ g/mL ampicillins, 37 DEG C of cultures 12 to 16h mention Plasmid is taken, by PCR and KpnI and EcoRI double digestion, agarose gel electrophoresis is identified will recombination after positive colony, identification are correct Integrative plasmid is named as pJS700-NP, and positive restructuring bacterial strain is named as DH5 α/pJS700-NP.The recombination and integration type plasmid Recombination cotC-np in pJS700-NP containing enterokinase label, the building process and its map of the plasmid are shown in Fig. 2.

2. the screening and identification of the bacillus subtilis strain of amalgamation and expression recombinant spore

Integrated recombinant plasmid pJS700-NP is converted into 168 (trp of Bacillus subtilis^-)(Bacillus Genetic Stock Center,Department of Biochemistry,The Ohio State University, West 12th Avenue, Columbus, Ohio, 43210, USA), with containing 0.4 μ g/mL erythromycin (being purchased from SIGMA company) LB plate screening recon, be inoculated in the LB plate containing 1% starch from picking individual colonies on plate, 37 DEG C are incubated overnight, Secondary daily Wagner's reagent dyes starch plate to identify recombinant bacterial strain.

The preparation method of 1% starch plate: in 100mL LB solid medium plus soluble starch 0.1g, high steam go out Plate processed after bacterium.

The preparation of Wagner's reagent: potassium iodide 2g, iodine 1g, distilled water 300mL, first by potassium iodide be dissolved on a small quantity go from In sub- water, iodine is added after all dissolutions, 300mL is diluted to after oscillation dissolution, is kept in dark place in Brown Glass Brown glass bottles and jars only, the used time 2~10 times can be diluted.

Take appropriate Wagner's reagent drop on starch plate, periphery of bacterial colonies generates transparent circle and shows that recombination does not have It is inserted into amylase gene amyE, bacterium colony and its ambient color become indigo plant and show that recombination is successfully inserted into Bacillus subtilis 168(trp^-) in amylase gene amyE on chromosome, thus cause amylase gene amyE without activity, See Fig. 3.

In order to further prove that the inactivation of amylase gene in recombinant bacterial strain is due to Em^rCaused by the insertion of-cotC-np, Respectively using amyE-F/amyE-R, np-F/np-R, amyE-F/np-R, np-F/amyE-R as primer pair, with bacillus subtilis Chromosome be template, PCR amplification identification recombinant bacterial strain in whether contain Em^r- cotC-np genetic fragment.Em^r- cotC-np piece Section is in 168 (trp of Bacillus subtilis^-) the integration schematic diagram in chromosome is shown in Fig. 4.PCR reaction system presses TaKaRa LA Taq operation instructions strictly carry out, 0.2 μ L, 10 × LA PCR of the Taq of LA containing TaKaRa in 20 μ L reaction systems BufferⅡ(Mg²⁺Plus) 2 μ L, dNTP Mixture (each 2.5mM) 3.2 μ L, template DNA 100ng, upstream and downstream primer (20 μ M) each 0.4 μ L, finally plus sterilizing ultrapure water polishing is to 20 μ L.PCR reaction condition is respectively set according to the feature of each primer pair. It detects about 180bp, 730bp, 3000bp respectively in recombinant bacterial strain, and only detects the shallow lake of about 1.1kp in wild-type strain Powder enzyme gene, qualification result are shown in Fig. 5.This shows to contain Em on recombinant bacterial strain chromosome^r- cotC-np recombination, and Em^r- CotC-np recombinant fragment is successfully inserted into amylase gene.Recombinant bacterial strain after identification is named as Bacillus subtilis 168(trp^-)/pJS700-NP。

The extracting method of bacillus subtilis chromosome are as follows: it chooses single colonie and is connected to LB and add in the culture medium of corresponding antibiotic, It cultivates in 37 DEG C of shaking tables to OD₆₀₀It is 1.0~2.0.Take 1.5mL bacterium solution in Eppendorf pipe, 8000rpm is centrifuged 10min, Supernatant is abandoned, the TE buffer (10mM Tris-HCl, 1mM EDTA) of 100 μ L pH8.0 is added to wash precipitating, is centrifuged and removes supernatant, then plus 100 μ L TE, which suspend, to be precipitated；Add 30 μ L 100mg/ml lysozyme solns into suspension, not rock, in 37 DEG C of incubators 1h is put, 50 μ L 10%SDS and 20 μ L 20mg/mL Proteinase Ks are added, 37 DEG C are continued to cultivate 1h；TE to 300 μ L is mended, respectively plus 150 μ L phenol and chloroform, 12000rpm are centrifuged 10min, take supernatant；Again plus 300 μ l chloroforms, 12000rpm are centrifuged 5min, take Clearly, add the NaCl of 1/4 volume 5M, the dehydrated alcohol of 2 times of volumes precipitates DNA 2h at room temperature, and 12000rpm is centrifuged 10min, receives Collection precipitating washes precipitating with the ethyl alcohol of 500 μ L 70%, it is to be evaporated it is dry after, add 10 μ L TE buffer solutions precipitating, take 1 μ L fine jade Sepharose electrophoresis detection DNA concentration, remaining can be placed in -20 DEG C save backup.

3. the induction and identification of surface display nutrition polypeptide recombinant spore

168 (trp of recombinant bacterial strain Bacillus subtilis is induced with DSM culture medium^-)/pJS700-NP forms gemma. The formula of DSM culture medium are as follows: 0.8%nutrient broth (nutrient broth Difo), 0.1%KCl, 0.025%MgSO₄· 7H₂O, 1.0mM Ca (NO₃)₂·4H₂O, 10 μM of MnCl₂, 1.0 μM of FeSO₄.By wild-type strain Bacillus subtilis 168(trp^-) and recombinant bacterial strain be inoculated in DSM culture medium respectively, recombinant bacterial strain takes 8h and 48h culture to be handled respectively, Wild-type strain takes the culture of 48h to be handled.

The processing method of gemma albumen: thalline were collected by centrifugation by 12000rpm × 10min, is resuspended in the GTE of same volume In Buffer (50mM glucose, 20mM pH7.5Tris-HCl, 10mM EDTA, 2mg/mL lysozyme), 37 DEG C are handled 30 minutes To destroy vegetative cell, 12000rpm × 10min precipitates gemma, is resuspended in same volume after washing 3 times with the PBS of pH7.4 In SDS-DTT buffer (0.1mM pH 7.4PBS, 50mM DTT, 1.5%SDS), 65 DEG C of water bath processing 10min carry out SDS- PAGE electrophoresis, is transferred on pvdf membrane, and using rabbit-anti Flag serum as primary antibody, Western blot detects recombinant bacterial strain and wild type The gemma albumen of bacterial strain.As the result is shown: NP is not all detected in the culture of wild-type strain 48h and recombinant bacterial strain 8h, and After recombinant bacterial strain culture 48h, since nutrition exhausts, cell differentiation forms gemma, and during sporulation, NP is with gemma Capsid protein CotC is expressed together, thus can detect NP, sees Fig. 6.This shows that nutrition polypeptide NP passes through in recombinant spore Capsid protein support C otC is shown on the surface of recombinant spore.

Embodiment 3: the functional analysis of Mouse oral recombinant spore raising sport efficiency

This experiment selects 5 weeks big healthy ICR mouse (20-25g) to carry out oral gemma experiment.Experiment mice is pressed completely Requirement and guidance according to Yangzhou University's Experimental Animal Center are raised.Raising temperature, which is controlled, provides sufficient drink at 25 ± 1 DEG C Use water.Carry out the acute toxicological experiment of gemma in advance before formal experiment.5 mouse are chosen, by the dosage of 5mg/ grams of weight Mouse oral recombinant spore is disposably given, is then observed one week, discovery all physiological activities of mouse normally carry out real in next step afterwards It tests.

46 ICR mouse (20-25g) are taken, are provided by Yangzhou University's animal center.It is randomly divided into 5 groups, control group 6, Other groups 10.Normal group；It moves control group (oral normal saline)；It moves wild type processing group and (takes orally wild-type strain Gemma, a given low are 2mg/ grams of weight)；Move transgenosis recombinant spore processing group (2mg/ grams of body of a given low Weight).Mouse feed is provided by Nantong Te Luofei feed technology Co., Ltd.All mouse are at 25 ± 1 DEG C of temperature, humidity 40- By group sub-cage rearing under 60% natural lighting, sufficient drinking water is provided.The set time claims rat body weight weekly.Mouse adaptability After swimming 3 days, exercise group is using no swimming with a load attached to the body campaign, 1 time a day, 2 hours every time, for 2 weeks.Run duration is arranged in down Noon carries out.Swimming pool be 100cm × 70cm × 60cm cuboid, depth of water 50cm, 32 ± 1 DEG C of water temperature.Mouse is swum in adaptability When swimming movement, every morning progress stomach-filling is primary, and given low is 2mg/ grams of weight.Equal volume is given in movement control group (E) Physiological saline.

After animal last is taken exercise, fasting 12 hours, penta bar of the dosage intraperitoneal injection 1% by 50mg/kg in second day Anesthesia is received than appropriate, then takes blood from eyeball, is injected in EP pipe, after room temperature stands 1 hour, after 3000rpm/min is centrifuged 15min, Serum is separated, -20 DEG C of refrigerators are stored in.

Then carry out serum every physical signs detected, mainly include succinate dehydrogenase (SDH), plasma wrea, Then statistical t check analysis is carried out to compare the variation of each group physical signs, sees below Tables 1 and 2, and table 1 is oral recombination The result that gemma influences motion model mouse amber acidohydrogenase (SDH)；Table 2 is oral recombinant spore to motion model mouse blood The variation of urea (BUN) content.

Illustrate that oral recombinant spore can supplement rapidly the raw material of essential amino acid, is acutely transported to meet synthesis body Required a large amount of energy matters are moved, it is living which substantially increases the energetic supersessions of most critical enzyme SDH in tricarboxylic acid cycle energetic supersession Property, Lai Tigao aerobic sport ability, while advantageously reducing BUN and maintaining energy balance in muscle.

Table 1., which takes orally recombinant spore, changes exercised rats succinate dehydrogenase (SDH)

Group	SDH(U/ml)
		Normal group	14.00±3.225
Move control group	17.20±2.573*
		Take orally wild gemma group	27.60±10.091#
Oral recombinant spore group	37.60±13.858##

The * p < 0.05 compared with normal；#p < 0.05, ##p < 0.01 compared with moving control group；

Table 2. takes orally influence of the recombinant spore to movement to mouse urea (Urea)

Group	Urea(μmol/L)
		Normal group	19.5596±0.0164
Move control group	19.6001±0.0114**
		Take orally wild gemma group	19.5907±0.0095#
Oral recombinant spore group	19.5753±0.0112##

The * * p < 0.01 compared with normal group；#p < 0.05, ##p < 0.01 compared with moving control group

Embodiment 4: oral recombinant spore influences exercised rats testosterone (T)

Testosterone promotes intracorporal anabolism, is conducive to the training effect for improving strength, speed, endurance.In general Plasma testosterone level variation is little when physical function is good, and has physical efficiency enhancing with the increased trend of testosterone.And in tired mistake Plasma testosterone level can then decline when degree is trained or functional state is bad.

For experimental procedure with embodiment 3, analysis of experimental results is as follows:

Movement control group testosterone be significantly higher than control group, illustrate that mouse is well-adjusted to the exercise intensity, this with it is big It is consistent that part research thinks that adaptation amount of exercise can be the increased theory of testosterone.Recombinant spore group relatively movement control group increases, And there is significant difference, illustrate that recombinant spore can increase the content of testosterone.Testosterone is an important rush in human body Synthetic hormone, it can not only maintain male's sexual and pair feature, but also it also stimulates tissue forceps to take amino acid, and take orally Recombinant spore then meets body to the needs of necessary amino acid just, promotes the conjunction of nucleic acid and protein as supplement raw material At the growth of promotion muscle fibre and bone promotes the generation of kidney hematopoietin, increases muscle glycogen deposit, and enhancing is exempted from Epidemic disease function.

Table 3., which takes orally recombinant spore, influences mouse testosterone (T)

P < 0.01 * * compared with normal group；##p < 0.01 compared with moving control group.

SEQUENCE LISTING

<110>Jiangsu University

<120>a kind of preparation method for the oral recombination nutrition polypeptide for supplementing essential amino acid

<130>a kind of preparation method for the oral recombination nutrition polypeptide for supplementing essential amino acid

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 120

<212> DNA

<213>artificial sequence

<400> 1

ctgaaggtga ccatcaaggt gctgaccatc aagctgaccg tgatcaagac cgtgctgatc 60

accatcaagg tgctgaccat caagctgatc aagaccctgg tgatcaagct ggtgaccgtg 120

<210> 2

<211> 45

<212> DNA

<213>artificial sequence

<400> 2

ggggtacccc gacgatgacg ataagctgaa ggtgaccatc aagac 45

<210> 3

<211> 58

<212> DNA

<213>artificial sequence

<400> 3

cggaattccg tcacttgtcg tcatcgtctt tgtagtcctt ggtcaccagc aggatcac 58

<210> 4

<211> 22

<212> DNA

<213>artificial sequence

<400> 4

attgctcggg ctgtatgact gg 22

<210> 5

<211> 25

<212> DNA

<213>artificial sequence

<400> 5

gttacaccat cactgttcgt tcctt 25

Claims (10)

1. a kind of preparation method of oral recombination nutrition polypeptide, which is characterized in that the nutrition polypeptide base of enterokinase label will be had It is then molecular vehicle, structure using bacillus subtilis spore capsid protein gene CotC because np is integrated on pJS700 carrier The integrated recombinant plasmid pJS700-NP of amalgamation and expression is built, and converts bacillus subtilis and obtains bacillus subtilis recombinant bacterium Strain, induction recombinant bacterial strain generate recombinant spore, have recombination nutrition polypeptide, the nutrition polypeptide gene in recombinant spore surface display The nucleotide sequence of np is as shown in SEQ ID NO.1.

2. a kind of preparation method of oral recombination nutrition polypeptide according to claim 1, which is characterized in that the nutrition is more Peptide gene np includes eight kinds of amino acid needed by human (lysine, tryptophan, phenylalanine, methionine, threonine, different bright ammonia Acid, leucine, valine) genetic fragment.

3. a kind of preparation method of oral recombination nutrition polypeptide according to claim 2, which is characterized in that the nutrition is more Peptide gene np includes BCAA (branched-chain amino acid) genetic fragment.

4. a kind of preparation method of oral recombination nutrition polypeptide according to claim 1, which is characterized in that the amplification base Because of the specific primer sequence of np coding sequence fragment are as follows:

Np-F:

5’-GGGGTACCCCGACGATGACGATAAGCTGAAGGTGACCATCAAGAC-3’

Wherein, single underscore indicates that restriction enzyme Kpn I, double underline indicate the recognition site of enterokinase；

Np-R:

5-’CGGAATTCCGCTTGGTCACCAGCAGGATCAC-3’

Wherein, single underscore indicates that restriction enzyme EcoR I, double underline indicate Flag label.

5. a kind of integrated recombinant plasmid, which is characterized in that the recombinant plasmid encodes the fusion protein containing enterokinase label CotC-NP, the integrated recombinant plasmid are constructed after gemma capsid protein gene cotC and np gene coded sequence recombinates, Promoter containing gemma capsid protein gene, coded sequence and np without terminator codon in the integrated recombinant plasmid Gene after the coded sequence recombination of gene, the nucleotide sequence of the nutrition polypeptide gene np is as shown in SEQ ID NO.1.

6. a kind of recombinant bacterial strain is the weight that integrated recombinant plasmid transformed bacillus subtilis obtains as described in claim 5 The spore surface displaying of group bacterial strain, the recombinant bacterial strain induced synthesis has recombination nutrition polypeptide.

7. a kind of bacillus subtilis recombinant spore, be by the recombinant spore of recombinant bacterial strain induced synthesis as claimed in claim 6, It is nutrition polypeptide that its surface display, which has fusion protein CotC-NP, NP with enterokinase label,.

8. recombinant spore as claimed in claim 7 is preparing the application in nutritional health food.

9. application according to claim 8, which is characterized in that the nutritional health food is oral sports type health care food Product.

10. application according to claim 8, which is characterized in that the nutritional health food is that oral supplementation is needed by human Amino acids health food.