CN101343327A - Antiviral protein and uses thereof - Google Patents
Antiviral protein and uses thereof Download PDFInfo
- Publication number
- CN101343327A CN101343327A CNA2008100302237A CN200810030223A CN101343327A CN 101343327 A CN101343327 A CN 101343327A CN A2008100302237 A CNA2008100302237 A CN A2008100302237A CN 200810030223 A CN200810030223 A CN 200810030223A CN 101343327 A CN101343327 A CN 101343327A
- Authority
- CN
- China
- Prior art keywords
- viral protein
- gly
- ser
- structural domain
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to anti-viral protein. The anti-viral protein is characterized in that the anti-viral protein is fusion protein and comprises a transmembrane peptide structural domain and a tandem body which is formed through at least two cytosine deaminase structural domains originated from an APOBEC family, a transmembrane peptide structural domain and various cytosine deaminase structural domains. The transmembrane peptide structural domain in the anti-viral protein provided by the invention ensures the anti-viral protein to have the transmembrane capability and to freely shuttle among cells and enters the cells in a non-receptor and non-energy dependent way; the cytosine deaminase structural domains originated from the APOBEC family ensures that the anti-viral protein can effectively inhibit the reproduction of human immunodeficiency virus and/ or hepatitis B virus after entering cells; because the non-essential sequences in the APOBEC family protein molecules are removed, not only the antiviral activity of the APOBEC family protein molecules is preserved, but also the immunogenicity of the anti-viral protein is reduced, and the transmembrane efficiency of the anti-viral protein is enhanced.
Description
Technical field
The present invention relates to protein, specifically, relate to a kind of human immunodeficiency virus (HIV that is used for the treatment of, human immunodeficiency virus) and/or hepatitis B virus (HBV, hepatitis B virus) anti-viral protein of Gan Raning, and the application of this anti-viral protein.
Background technology
(the apolipoprotein B mRNA editing enzyme-catalyticpolypeptide family of APOBEC family, apolipoprotein B mRNA editing enzymes catalytic polypeptide family) be newfound in recent years a kind of protein molecule with cytosine deaminase activity, can make the cytosine(Cyt) deamination change uridylic (C → U) into, its family member comprises: hAPOBEC1 (being people APOBEC1), hAPOBEC2 (being people APOBEC2), hAPOBEC3A (being people APOBEC3A), hAPOBEC3B (being people APOBEC3B), hAPOBEC3C (being people APOBEC3C), hAPOBEC3D (being people APOBEC3D), hAPOBEC3E (being people APOBEC3E), hAPOBEC3F (being people APOBEC3F), hAPOBEC3G (being people APOBEC3G), hAPOBEC3H (being people APOBEC3H), hAPOBEC4 (being people APOBEC4), rAPOBEC1 (being rat APOBEC1), activation inductive desaminase (activation-induced deaminase, AID) kind (APOBEC-mediated viralrestriction:not simply editing surplus the grade ten? Trends Biochem Sci (biochemical scientific advance) 2007; 32 (3): 118-128; With APOBEC family proteins:novel antiviral innateimmunity.Int J Hematol (international hematology magazine) 2006; 83 (3): 213-216).
The most important constitutional features of APOBEC family is: they all have conservative, as to rely on zine ion cytosine deaminase activity structural domain (Cloning and mutagenesis of the rabbitApoB mRNA editing protein.A zinc motif is essential for catalytic activity, and noncatalytic auxiliary factor (s) of the editing complex are widelydistributed.J Biol Chem (journal of biological chemistry) 1994; 269 (34): 21725-21734).Most APOBEC family members have only an Isocytosine deaminase structural domain, and hAPOBEC3B, hAPOBEC3F, hAPOBEC3G molecule respectively comprise two Isocytosine deaminase structural domains.Find that at present APOBEC member has very strong antiviral activity, can suppress retrovirus such as human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV, simian immunodeficiency virus), equine infectious anemia virus (EIAV, equineinfectious anemia virus), murine leukemia virus (MLV, murine leukaemia virus) and hepatitis B virus (HBV's) duplicates.
For retrovirus such as HIV, the Isocytosine deaminase structural domain of APOBEC can make the cytosine(Cyt) deamination change into uridylic (C → U), the transformation of C → U further causes three kinds of different subsequent reactions:
(1) the strand cDNA that contains U is discerned and removes U by ura DNA glycosidase (UDG), produce the site of no purine pyrimidine, by DNA base excision repair enzyme (endonuclease) effect, cause dna degradation (DNA deamination mediates innate immunity toretroviral infection.Cell (cell) 2003 again; 113 (6): 803-809);
(2) too much U base can be disturbed initial (the Incorporation ofuracil into minus strand DNA affects the specificity of plus strand synthesisinitiation during lentiviral reverse transcription.J Biol Chem (journal of biological chemistry) 2003 of normal chain synthetic; 278 (10): 7902-7909);
(3) 1～2% C can be changed into U by deamination in the minus strand, a large amount of C → U sudden change can cause occurring in the normal chain G → A high frequency sudden change, to such an extent as to viral protein that can not encoding function perhaps produces the no function product of brachymemma because form terminator codon in advance.
Above-mentioned three kinds of subsequent reactions finally cause retrovirus can not finish whole replicative cycle.
For HBV, APOBEC mainly realizes its antiviral function (Inhibition of hepatitis B virusreplication by APOBEC3G.Science (science) 2004 by packing and the nucleocapsidization that suppresses viral pregenome RNA; 303 (5665): 1829).
But APOBEC family can't bring into play antiviral function in the extracellular, and this has limited its application in medical treatment greatly.In order to make APOBEC family bring into play antiviral function, need be with in its transfered cell.
In cytobiology and clinical pharmacy research field, in transfered cells such as polypeptide, protein or oligonucleotide, the means that generally adopt have at present: physical method, as microinjection, electroporation etc.; Chemical process is as liposome method, digitonin facture etc.; Biological method is as virus vector method etc.But aforesaid method molecule importing rate is low, easily causes cell injury even death, makes that many lifeless matter membrane permeabilities and wetting ability polypeptide, protein and the oligonucleotide of easily degrading are limited greatly in the application of pharmaceutical field.
Recent study finds, have in the organism proteinoid and polypeptide can with a kind of do not have receptor-mediated, do not consume energy, the mode of non-classical endocytosis enters cytoplasm or nucleus (Proteintransports:the nonclassical ins and outs.Curr Biol (contemporary biology) 1997; 7 (5): R318-320).These have the albumen of cytolemma penetrativity or polypeptide and are called as and wear film peptide (membrane penetrating peptides, MPPs, be called the cytolemma penetrating peptide again), comprise hsv capsid protein VP22, (antennapedia is Antp) with some artificial synthetic polypeptide (The third helix of the Antennapedia homeodomain translocates throughbiological membranes.J Biol Chem (journal of biological chemistry) 1994 for human immunodeficiency virus Tat albumen, the special-shaped transcription regulatory protein of fruit bat homology; 269 (14): 10444-10450; With Intercellular trafficking and protein delivery by aherpesvirus structural protein.Cell (cell) 1997; 88 (2): 223-233; With Cellularuptake of the tat protein from human immunodeficiency virus.Cell (cell) 1988; 55 (6): 1189-1193), exist differently, all can effectively polypeptide, protein or dna fragmentation be imported multiple mammalian cell although they are located in aminoacid sequence, cell and wear aspect such as film potential.Wear the peptide-mediated substance transportation process of film and have a lot of advantages, for example: it and cytolemma affinity height, to wear film speed fast, the most important thing is that cell membrane does not have destructiveness; In addition, the membrane process of wearing of wearing the film peptide can also reverse carrying out, and that is to say, it can also pass cytolemma in the cell and enter matrix, perhaps from a cell transfer to the another one cell; It is often smaller to wear the film peptide molecular weight, be difficult for being eliminated by liver and spleen phagocytic cell, even have wear the film peptide also has transfectional cell under the situation that blood plasma exists ability; Because wearing the film peptide enters cell without receptor-mediated endocytic pathway, avoided entering the lysosome degraded behind the endocytosis, therefore prolong relatively in intracellular action time.
In addition, the APOBEC molecular weight is bigger, and immunogenicity is stronger, directly applies to human body and may induce higher antibody horizontal and reduce its antiviral effect.
Summary of the invention
Technical problem to be solved by this invention is that the antiviral activity that will wear film peptide technology and APOBEC organically combines, a kind of anti-viral protein and application thereof are provided, this anti-viral protein has cytolemma and penetrates activity, can between cell, carry out free shuttling, and the mode that relies on a kind of non-acceptor, non-energy enters in the cell, and effective duplicating of HIV (human immunodeficiency virus) inhibiting (HIV) and/or hepatitis B virus (HBV).The technical scheme that adopts is as follows:
A kind of anti-viral protein is characterized in that it is a fused protein, comprises structure of cell-penetrating peptide territory and at least two Isocytosine deaminase structural domains that derive from APOBEC family, and structure of cell-penetrating peptide territory and each Isocytosine deaminase structural domain form concatermer.
Preferred above-mentioned anti-viral protein comprises at least three Isocytosine deaminase structural domains that derive from APOBEC family; The quantity of Isocytosine deaminase structural domain increases in the anti-viral protein, helps to improve its antiviral effect.Isocytosine deaminase structural domain in the more preferably above-mentioned anti-viral protein is from three kinds of different APOBEC family members, for example: a kind of anti-viral protein comprises three Isocytosine deaminase structural domains that derive from APOBEC family, wherein first Isocytosine deaminase structural domain is from hAPOBEC3G, second Isocytosine deaminase structural domain is from hAPOBEC3B, and the 3rd Isocytosine deaminase structural domain is from hAPOBEC3F.Because there is some difference aspect the amino acid composition for the Isocytosine deaminase structural domain in different APOBEC family source, this can cause it to bring into play different functions in antiviral process, therefore from the use of uniting of three kinds of different APOBEC family members' Isocytosine deaminase structural domain, can strengthen the effect that anti-viral protein suppresses virus multiplication.
Further, preferred above-mentioned anti-viral protein comprises at least four Isocytosine deaminase structural domains that derive from APOBEC family; The quantity of Isocytosine deaminase structural domain increases in the anti-viral protein, helps to improve its antiviral effect.Isocytosine deaminase structural domain in the more preferably above-mentioned anti-viral protein is from least three kinds of different APOBEC family members, for example: a kind of anti-viral protein comprises four Isocytosine deaminase structural domains that derive from APOBEC family, wherein the first～two Isocytosine deaminase structural domain is from hAPOBEC3F, the 3rd Isocytosine deaminase structural domain is from hAPOBEC3G, and the 4th Isocytosine deaminase structural domain is from hAPOBEC3B; Another kind of anti-viral protein comprises four Isocytosine deaminase structural domains that derive from APOBEC family, wherein first Isocytosine deaminase structural domain is from hAPOBEC3G, second Isocytosine deaminase structural domain is from hAPOBEC3B, the 3rd Isocytosine deaminase structural domain is from hAPOBEC3F, and last Isocytosine deaminase structural domain is from rAPOBEC1.Because there is some difference aspect the amino acid composition for the Isocytosine deaminase structural domain in different APOBEC family source, this can cause it to bring into play different functions in antiviral process, therefore from the use of uniting of at least three kinds of different APOBEC family members' Isocytosine deaminase structural domain, can strengthen the effect that anti-viral protein suppresses virus multiplication.
The sequence that constitutes above-mentioned structure of cell-penetrating peptide territory can be following have wear a kind of in the active sequence of film peptide: the GRKKRRQRRRPPQ sequence that derives from HIV Tat albumen (transactivator, human immunodeficiency virus Tat albumen); Derive from the proteic RKKRRQRRR sequence of HIV Tat; Derive from the DAATARGRGRSAASRPTERPRAPARSASRPRRPVD sequence of hsv capsid protein VP22; Derive from the RQIKIWFQNRRMKWKK sequence of the special-shaped transcriptional regulatory albumin A ntp of fruit bat homology (antennapedia); Transhipment (transportan) sequence GWTLNSAGYLLKINLKALAALAKKIL; Amphipathic pattern peptide KLALKLAALKAALKLA; Successive arginine RRRRRRRRR; Polypeptide GALFLGWLGAAGSTMGAWSQPKKKRKV based on signal sequence; Polypeptide A AVALLPAVLLALLAP based on signal sequence.
The change of its biologic activity can take place reasonably, not influence in the sequence that constitutes above-mentioned structure of cell-penetrating peptide territory, for example, the amino acid whose disappearance of non-core effect, the amino acid whose insertion of non-core effect, the amino acid whose replacement of non-core effect, multiplely have the combination of wearing the active sequence of film peptide etc., but the core purpose of these changes should be guiding anti-viral protein permeates cell membranes or a nuclear membrane effectively.
The position of above-mentioned structure of cell-penetrating peptide territory in anti-viral protein should be able to guarantee its effectively performance wear film activity, N end (being aminoterminal), the C that can be positioned at anti-viral protein holds (being carboxyl terminal) or region intermediate, preferred N holds.
The core motif allow that the Isocytosine deaminase structural domain of the preferred above-mentioned APOBEC of deriving from family is had is: H-X-E-(X)
23-28-P-C-(X)
2-4-C, wherein H is a Histidine, and E is a L-glutamic acid, and C is a halfcystine, and P is a proline(Pro), X represents arbitrary amino acid.
Isocytosine deaminase structural domain in the preferred above-mentioned anti-viral protein is the hAPOBEC3G that derives from the APOBEC family, hAPOBEC3F, the Isocytosine deaminase structural domain of these four kinds of protein molecules of hAPOBEC3B and rAPOBEC1, that is to say, in selecting anti-viral protein during the source of Isocytosine deaminase structural domain, pay the utmost attention to the Isocytosine deaminase structural domain of selecting these four kinds of protein molecules, total following seven kinds of the contained Isocytosine deaminase structural domain of these four kinds of protein molecules: from the Isocytosine deaminase structural domain of the N end of hAPOBEC3G, Isocytosine deaminase structural domain from the C of hAPOBEC3G end, Isocytosine deaminase structural domain from the N of hAPOBEC3F end, Isocytosine deaminase structural domain from the C of hAPOBEC3F end, Isocytosine deaminase structural domain from the N of hAPOBEC3B end, from the Isocytosine deaminase structural domain of the C of hAPOBEC3B end, from the Isocytosine deaminase structural domain of rAPOBEC1.
For hAPOBEC3G, hAPOBEC3F, these three kinds of protein of hAPOBEC3B, all have two Isocytosine deaminase structural domains in each protein molecule, lay respectively at N end and C end.The fine difference of the position of Isocytosine deaminase structural domain and amino acid composition aspect may determine them to bring into play different functions in antiviral process, therefore, more preferably anti-viral protein had both comprised the Isocytosine deaminase structural domain from the N end of hAPOBEC3G, hAPOBEC3F or hAPOBEC3B, comprised the Isocytosine deaminase structural domain from the C end of hAPOBEC3G, hAPOBEC3F or hAPOBEC3B again.
N end (being aminoterminal), C that above-mentioned Isocytosine deaminase structural domain can be in anti-viral protein hold (being carboxyl terminal) or region intermediate.
On space structure, can both relatively independent and effectively bring into play its function in order to make in the anti-viral protein placed in-line each Isocytosine deaminase structural domain, keep good biologic activity, connect with flexible peptide linker between each structural domain in the preferred anti-viral protein, specifically, between structure of cell-penetrating peptide territory and the Isocytosine deaminase structural domain, connect with flexible peptide linker between adjacent two Isocytosine deaminase structural domains.Flexible peptide linker must have enough snappinesies and flexibility ratio, therefore the amino acid that constitutes flexible peptide linker mostly is amino acid nonpolar and that side chain is short, as glycine (G) and Serine (S), that is to say that flexible peptide linker is rich in glycine (G) and Serine (S).The preferred flexible connection peptides is GGGG, GSSSG, GSGGSG, GGGGS, (GGGGS)
2(GGGGS)
3In one or any multiple combination.Too short connection peptides can cause sterically hindered at intramolecule, influences proteic correct folding; Long connection peptides then may increase proteic immunogenicity, and therefore more preferably flexible peptide linker is (GGGGS)
2, GGGGGSSSG, GSSSGGSGGSG, GSGGSGGGGGS, GGGGGSGGSG, GSSSGGGGGS or GGGGGGGGS.
The enantiopathy poisonous protein carries out purifying when preparing anti-viral protein in order to be beneficial to, and helps detecting distribution and expression after anti-viral protein is used simultaneously, and preferred above-mentioned anti-viral protein contains the protein purification label.The protein purification label can be any commercialization label, preferred 6 x His labels (i.e. the sequence HHHHHH that is made up of six Histidine His) or GST label (glutathione sulfydryl transferase).The protein purification label can be positioned at the N end or the C end of anti-viral protein; Also can a protein purification label respectively be arranged at the N of anti-viral protein end and C end.
In one embodiment of the invention, announced that this anti-viral protein carries out the method for purifying with the nickel particles affinity chromatography.Because this anti-viral protein respectively has a histone label (i.e. 6 x His labels) at N end and C end, therefore after this anti-viral protein N end being comprised 17 amino acid excisions of protein purification label with zymoplasm, the anti-viral protein that obtains is the enough nickel particles affinity chromatography purifying of energy equally, and owing to reduced partial amino-acid series, it wears that film activity can be further enhanced and antiviral activity can not reduce.
Above-mentioned anti-viral protein can be expressed with prokaryotic expression system, yeast expression system or insect cell expression system, also can obtain in vivo to express, also can obtain in the body to express by its encoding gene is entered by modes such as particle gun, liposome transfection, polylysine, polymine or chitosan mediations by its encoding gene being connected into adenovirus carrier, retroviral vector, vaccinia virus vector, gland relevant viral vector or herpesvirus vector.
The application of above-mentioned anti-viral protein in the medicine that preparation treatment human immunodeficiency virus (HIV) infects, promptly above-mentioned anti-viral protein can be used for the medicine that preparation treatment human immunodeficiency virus (HIV) infects.
The application of above-mentioned anti-viral protein in the medicine that preparation treatment hepatitis B virus (HBV) infects, promptly above-mentioned anti-viral protein can be used for the medicine that preparation treatment hepatitis B virus (HBV) infects.
In the anti-viral protein of the present invention, the structure of cell-penetrating peptide territory makes anti-viral protein have the film of wearing ability, can carry out free shuttling between cell, and the mode that relies on a kind of non-acceptor, non-energy enters in the cell; The Isocytosine deaminase structural domain that derives from APOBEC family makes anti-viral protein after entering cell, can effectively suppress duplicating of HIV and/or HBV, and, owing to removed the nonessential sequence in the APOBEC family protein molecule, thereby not only kept the antiviral activity of APOBEC family protein molecule, and reduced the immunogenicity of anti-viral protein, and improved the membrane efficiency of wearing of anti-viral protein; Flexibly connecting small peptide and can guarantee that each structural domain can bring into play its functions peculiar separately insusceptibly between each structural domain; The protein purification label can make things convenient for the purifying or the detection of anti-viral protein.
Description of drawings
Fig. 1 is the prokaryotic expression carrier building process synoptic diagram of anti-viral protein among the embodiment 1;
Fig. 2 is the expression and the purification result synoptic diagram of anti-viral protein among the embodiment 1;
Fig. 3 is the Western blot detected result synoptic diagram of anti-viral protein among the embodiment 2;
Fig. 4 is the photo (being obtained by fluorescent microscope) of the interior positioning result of cell of embodiment 3 anti-viral proteins;
Fig. 5 is the detected result synoptic diagram of the influence of the relevant HBV-DNA of nucleocapsid in the anti-viral protein pair cell culture supernatant among the embodiment 4;
Fig. 6 is the detected result synoptic diagram of the influence of the relevant HBV-DNA of nucleocapsid during the anti-viral protein pair cell is starched among the embodiment 4;
Fig. 7 is the detected result synoptic diagram that is wrapped in the influence of the HBV pregenome RNA in the capsid among the embodiment 4 in the anti-viral protein pair cell slurry.
Embodiment
The preparation of embodiment 1 anti-viral protein
The aminoacid sequence of present embodiment anti-viral protein is: MetGlySerSer
HisHisHisHisHisHisSerSerGlyLeuValProArgGlySerHisMetAlaSerMetThrGlyGlyGlnGl nMetGlyArgGlySer
GlyGlyGlyGlySerValAspLeuGlu
HisHisHisHisHisHis
This anti-viral protein comprises the Isocytosine deaminase structural domain that a structure of cell-penetrating peptide territory (GlyArgLysLysArgArgGlnArgArgArgProProGln) and three derive from APOBEC family, and (these three Isocytosine deaminase structural domains are the Isocytosine deaminase structural domain HisProGluMetArgPhePheHisTrpPheSerLysTrpArgLysLeuHisArgAs pGlnGluTyrGluValThrTrpTyrIleSerTrpSerProCysThrLysCys from hAPOBEC3G molecule N end successively, Isocytosine deaminase structural domain HisAlaGluLeuCysPheLeuAspValIleProPheTrpLysLeuAspLeuAspGl nAspTyrArgValThrCysPheThrSerTrpSerProCysPheSerCys from hAPOBEC3G molecule C end, Isocytosine deaminase structural domain HisAlaGluArgCysPheLeuSerTrpPheCysAspAspIleLeuSerProAsnTh rAsnTyrGluValThrTrpTyrThrSerTrpSerProCysProGluCys from hAPOBEC3F molecule C end), structure of cell-penetrating peptide territory and each Isocytosine deaminase structural domain form concatermer, between structure of cell-penetrating peptide territory and the Isocytosine deaminase structural domain, connect with flexible peptide linker (GlyGlyGlyGlySerGlyGlyGlyGlySer) between adjacent two Isocytosine deaminase structural domains, the N end and the C end of anti-viral protein respectively have a protein purification label (HisHisHisHisHisHis).
Prepare above-mentioned anti-viral protein by following step:
One, hAPOBEC3G full-length cDNA (complementary DNA, DNA are thymus nucleic acid) and hAPOBEC3F Full Length cDNA Cloning
Human peripheral is handled with lymphocyte separation medium, obtained mononuclearcell, after handling with PMA (acetyl Semen Myristicae phorbol), extract total RNA with the Trizol method again, utilize random priming and AMV reversed transcriptive enzyme to synthesize cDNA; Be that primer is right with A3G-F and A3G-R, A3F-F and A3F-R respectively then, PCR (polymerase chain reaction, polymerase chain reaction) amplification obtains hAPOBEC3G full-length cDNA and hAPOBEC3F full-length cDNA; Wherein each primer specific design is as follows:
A3G-F is: 5 '-CGA
AAGCTTATGAAGCCTCACTTCAGAA-3 '
A3G-R is: 5 '-TTA
GGTACCTCAGTTTTCCTGATTCTG-3 '
A3F-F is: 5 '-GCT
AAGCTTATGAAGCCTCACTTCAGA-3 '
A3F-R is: 5 '-TAT
GGTACCTCACTCGAGAATCTCCTG-3 '
Underscore among above-mentioned A3G-F, A3G-R, A3F-F and the A3F-R partly is HindIII restriction enzyme site (AAGCTT) or KpnI restriction enzyme site (GGTACC).
Above-mentioned two kinds of PCR products (being hAPOBEC3G full-length cDNA and hAPOBEC3F full-length cDNA) HindIII and KpnI double digestion, be connected with commercialization pcDNA3 plasmid then through HindIII and KpnI double digestion and purifying, obtain positive plasmid, the further sequence verification of the positive plasmid that obtains, called after pcA3G plasmid and pcA3F plasmid respectively.The pcA3G plasmid has the hAPOBEC3G full-length cDNA; The pcA3F plasmid has the hAPOBEC3F full-length cDNA.
Two, the construction of prokaryotic expression vector of anti-viral protein
Each primer of design is as follows:
(1)Tat-MF：
5 '-
TGGCAGGAAGAAGCGGAGACAGCGACGAAGACCTCCTCAA
GGCGGAGGC 
C-3 '; Wherein GATC (wavy line) is the base that hangs out after Tat-MF and the pairing of Tat-MR primer, GGCGGAGGC (single underscore) is the encoding sequence of the flexible peptide linker sequence of introducing, BamHI and the SalI restriction enzyme site of GGATCCGTCGAC (double underline) for introducing;
(2)Tat-MR：
5 '-
G
GCCTCCGCCTTGAGGAGGTCTTCATCGCTGTCTCCGCTTCTTCCTGCCA-3 '; Wherein TCGA (wavy line) is the base that hangs out after Tat-MF and the pairing of Tat-MR primer, GCCTCCGCC (single underscore) is the encoding sequence of the flexible peptide linker sequence of introducing, SalI and the BamHI restriction enzyme site of GTCGACGGATCC (double underline) for introducing;
(3)A3G-NF：
5 '-GGC
AGATCT 
CACCCAGAGATGAG-3 '; Wherein AGATCT (single underscore) is the BglII restriction enzyme site, and GGCGGAGGCGGATCA (double underline) is the encoding sequence of the flexible peptide linker sequence of introducing;
(4)A3G-NR：
5 '-TAT
GCCTCCGCCACACTTTGTGCAG-3 '; Wherein CTCGAG (wavy line) is the XhoI restriction enzyme site, and GTCGACGGATCC (double underline) is SalI and the BamHI restriction enzyme site of introducing, and GCCTCCGCC (single underscore) is the encoding sequence of the flexible peptide linker sequence of introducing;
(5)A3G-CF：
5 '-GGC
GGCGGAGGCGGATCACATGCAGAGCTGTGCTT-3 '; Wherein AGATCT (double underline) is the BglII restriction enzyme site, and GGCGGAGGCGGATCA (single underscore) is the encoding sequence of the flexible peptide linker sequence of introducing;
(6)A3G-CR：
5 '-TAT
GCCTCCGCCACAGCTGAAGCA-3 '; Wherein CTCGAG (wavy line) is the XhoI restriction enzyme site, and GTCGACGGATCC (double underline) is SalI and the BamHI restriction enzyme site of introducing, and GCCTCCGCC (single underscore) is the encoding sequence of the flexible peptide linker sequence of introducing;
(7)A3F-CF：
5 '-GGC
GGCGGAGGCGGATCACATGCAGAAAGGTGCT-3 '; Wherein AGATCT (double underline) is the BglII restriction enzyme site, and GGCGGAGGCGGATCA (single underscore) is the encoding sequence of the flexible peptide linker sequence of introducing;
(8)A3F-CR：
5 '-TAT
GCCTCCGCCACACTCTGGGCAAGGG-3 '; Wherein CTCGAG (wavy line) is the XhoI restriction enzyme site, and GTCGACGGATCC (double underline) is SalI and the BamHI restriction enzyme site of introducing, and GCCTCCGCC (single underscore) is the encoding sequence of the flexible peptide linker sequence of introducing;
At first, Tat-MF and Tat-MR primer to annealed formation two strands after, be connected into carrier through the commercialization pET-28a of BamHI and XhoI double digestion, obtain containing the pTM plasmid of Tat structure of cell-penetrating peptide domain encoding sequence.
Then, on the basis of pTM plasmid, adopt the isocaudarner method to insert the Isocytosine deaminase structural domain in a plurality of APOBEC source continuously, its concrete steps are:
(1) be template with the pcA3G plasmid that has the hAPOBEC3G full-length cDNA, A3G-NF and A3G-NR are primer, and pcr amplification obtains hAPOBEC3G molecule N end Isocytosine deaminase structural domain encoding sequence; Utilize BamHI and BglII, SalI and the XhoI characteristics of isocaudarner each other then, with this PCR product (being hAPOBEC3G molecule N end Isocytosine deaminase structural domain encoding sequence) behind BglII and XhoI double digestion, be connected into pTM plasmid, obtain the pTM-N plasmid through BamHI and SalI double digestion.The pTM-N plasmid that obtains, its enzyme is cut the BamHI of connecting portion and BglII, SalI and XhoI site and can be lost simultaneously, but BamHI site of artificially being introduced and SalI site (end of this BamHI site and SalI site next-door neighbour hAPOBEC3G molecule N end Isocytosine deaminase structural domain encoding sequence) still exists.
(2) similar with step (1), be template with the pcA3G plasmid, A3G-CF and A3G-CR are primer, pcr amplification obtains hAPOBEC3G molecule C end Isocytosine deaminase structural domain encoding sequence; Then this PCR product (being hAPOBEC3G molecule C end Isocytosine deaminase structural domain encoding sequence) behind BglII and XhoI double digestion, is connected into the pTM-N plasmid through BamHI and SalI double digestion, obtains the pTM-NC plasmid.The pTM-NC plasmid contains the BamHI site and the SalI site of artificial introducing equally, and the enzyme of being convenient to carry out next round is cut.
(3) be template with the pcA3F plasmid, A3F-CF and A3F-CR are primer, and pcr amplification obtains hAPOBEC3F molecule C end Isocytosine deaminase structural domain encoding sequence; Then with this PCR product (being hAPOBEC3F molecule C end Isocytosine deaminase structural domain encoding sequence) behind BglII and XhoI double digestion, be connected into pTM-NC plasmid through BamHI and SalI double digestion, obtain the pTM-NCC plasmid, finish the construction of prokaryotic expression vector of anti-viral protein.The pTM-NCC plasmid contains a Tat structure of cell-penetrating peptide domain encoding sequence and three Isocytosine deaminase structural domain encoding sequences.
The pTM-NCC plasmid that obtains at last contains the BamHI site and the SalI site of artificial introducing equally, and the rest may be inferred, can also obtain the tandem copy of more Isocytosine deaminase structural domains.
In sum, adopt the successive enzyme to cut and----connect that----ways of connecting again that enzyme is cut again----is connected into exogenous dna fragment the pET-28a prokaryotic expression carrier step by step.After connecting each time, its two ends that connect product all can lose some restriction enzyme sites, but have kept BamHI and SalI site again simultaneously, help that the next round enzyme cuts with connection procedure.Though 1 copy of every increase must be done 1 time cloning, for the tandem gene of 1～5 copy, experimentation is also uncomplicated.
The construction of prokaryotic expression vector process of above-mentioned anti-viral protein can represent that wherein A3G-N, A3G-C, A3F-C represent the N end Isocytosine deaminase structural domain encoding sequence of hAPOBEC3G, the C end Isocytosine deaminase structural domain encoding sequence of hAPOBEC3G and the C end Isocytosine deaminase structural domain encoding sequence of hAPOBEC3F respectively with Fig. 1.
Between adjacent Isocytosine deaminase structural domain, we have also designed flexible peptide linker sequence.It is based on following mentality of designing: the end of each pcr amplified fragment has all been introduced GCCTCCGCC sequence (coding GlyGlyGly), and the front end of each pcr amplified fragment has been introduced into GGCGGAGGCGGATCA sequence (coding GlyGlyGlyGlySer); When previous segmental end with after segmental front end respectively after BamHI cuts with the BglII enzyme and is connected, be used for the sequence (coding GlySer) that connection site place itself can form GGATCT; Therefore after two fragments connected, the junction had just formed the GCCTCCGCCGGATCTGGCGGAGGCGGATCA encoding sequence, codified GlyGlyGlyGlySerGlyGly GlyGlySer peptide sequence, i.e. (GGGGS)
2Sequence.Because Gly and Ser are nonpolar and the short amino acid of side chain, have enough flexibilities and flexibility ratio, so guaranteed the abundant exposure of each avtive spot in the anti-viral protein molecule.
Finally, by each gene fragment being inserted one by one business-like pET-28a plasmid, we have obtained containing the prokaryotic expression plasmid pTM-NCC that a Tat albumen is worn the film peptide-coding sequence Isocytosine deaminase structural domain encoding sequence different with three, show that through sequence verification the single open reading frame of construct and gene order are entirely true.Because this respectively has a histone label (i.e. 6 x His labels) encoding sequence in inserting segmental upstream and downstream pET-28a, thus when this anti-viral protein behind prokaryotic expression, its N holds and the C end can respectively have one 6 x His label coding sequence.
The full length nucleotide encoding sequence of above-mentioned anti-viral protein is described below:
ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGT
GCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAA
TGGGTCGCGGATCTGGCAGGAAGAAGCGGAGACAGCGACGAA
GACCTCCTCAAGGCGGAGGCGGATCAGGCGGAGGCGGATCACA
CCCAGAGATGAGATTCTTCCACTGGTTCAGCAAGTGGAGGAAG
CTGCATCGTGACCAGGAGTATGAGGTCACCTGGTACATATCCTG
GAGCCCCTGCACAAAGTGTGGCGGAGGCGGATCAGGCGGAGGC
GGATCACATGCAGAGCTGTGCTTCCTGGACGTGATTCCCTTTTG
GAAGCTGGACCTGGACCAGGACTACAGGGTTACCTGCTTCACCT
CCTGGAGCCCCTGCTTCAGCTGTGGCGGAGGCGGATCAGGCGG
AGGCGGATCACATGCAGAAAGGTGCTTCCTCTCTTGGTTCTGTG
ACGACATACTGTCTCCTAACACAAACTACGAGGTCACCTGGTAC
ACATCTTGGAGCCCTTGCCCAGAGTGTGGCGGAGGCGGATCCGT
CGACCTCGAGCACCACCACCACCACCACTGA
Three, the expression of anti-viral protein
The pTM-NCC plasmid that checks order correct transforms BL21 (DE3) competence intestinal bacteria, and the picking positive colony is inoculated in the 2xYT liquid nutrient medium that contains penbritin, and 37 ℃ of shaking culture are spent the night.Be transferred in the 2xYT liquid nutrient medium of 12 bottles of identical resistances with 1: 100 inoculum size again, when shaking culture reaches 0.4 left and right sides to OD600, wherein 6 bottles add inductor IPTG (isopropylthio-β-D-galactoside, isopropyl-) to 0.2mmol/L, other 6 bottles add inductor IPTG to 1mmol/L; Continue shaking culture by following condition respectively again: 37 ℃ of 4h, 37 ℃ of 6h, 30 ℃ of 4h, 30 ℃ of 6h, 25 ℃ of 4h, 25 ℃ of 6h.
Be that inducing with culture condition of each bottle is respectively:
After finishing shaking culture, the centrifugal respectively culture of collecting after inducing, PBS (phosphate buffered saline buffer) is resuspended, and adding N,O-Diacetylmuramidase to the final concentration of N,O-Diacetylmuramidase in culture is 0.5mg/L, and ice bath 30min, intermittently ultrasonic 3 times then, each ultrasonic 2min.All get the suspension after the 100 μ l supersound process, behind the centrifugal 10min of 12500g, respectively get precipitation, supernatant carries out 15%SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and analyzes.
The SDS-PAGE analytical results shows, IPTG inductive BL21 (DE3) reorganization bacterium lysate has a significantly newly-increased protein band near 22KD (22 kilodalton), this result conforms to the theoretical calculate value of this anti-viral protein (anti-viral protein is made up of 198 amino acid, the about 22.6KD of the relative molecular mass of theoretical calculate).Though expression that all can the inducing anti-disease poisonous protein under the condition of each temperature and IPTG concentration, but 37 ℃ of inductive anti-viral proteins are mainly based on inclusion body, under 30 ℃ of inductive conditions a certain amount of inclusion body is arranged also, and 25 ℃ of anti-viral proteins of inducing main generation solubility.Analysis-by-synthesis is selected IPTG concentration 0.2mmol/L, the 25 ℃ of 6h the suitableeest expression condition as this anti-viral protein.
Four, the purifying of anti-viral protein
Utilize the nickel ion affinity chromatograph post, solubility anti-viral protein under non-sex change condition in the purification of Recombinant cellular lysate supernatant, its concrete steps are: at first, the reorganization bacterium liquid 500ml that collection induces the back to obtain, ultrasonic as stated above centrifugal (the centrifugal culture of collecting after inducing, PBS is resuspended, adding N,O-Diacetylmuramidase to the final concentration of N,O-Diacetylmuramidase is 0.5mg/L, and ice bath 30min, intermittently ultrasonic 3 times then, each ultrasonic 2min, the centrifugal 10min of 12500g again) collect supernatant, through 0.45 μ m membrane filtration; Then Ni-NTA Bind resin is suspended from binding buffer liquid (50mmol/LNaH
2PO
4, 300mmol/L NaCl, 10mmol/L imidazoles, PH8.0, promptly every liter of binding buffer liquid contains 50mmol NaH
2PO
4, 300mmol NaCl, 10mmol imidazoles) in carry out balance, draw the resin after sample after filtering adds this balance again, the 1h that vibrates gently under 4 ℃ of temperature makes sample and resin mixing; Then the mixture of sample and resin is transferred in the chromatography column, treat its sedimentation after, earlier (every liter of lavation buffer solution contains 50mmol NaH with lavation buffer solution
2PO
4, 300mmol NaCl and 20mmol imidazoles, its pH value is 8.0) the gradation washing, (every liter of lavation buffer solution contains 50mmol NaH to use elution buffer again
2PO
4, 300mmol NaCl and 250mmol imidazoles, its pH value is 8.0) wash-out in batches, be in charge of and collect elutriant and carry out SDS-PAGE and analyze; The elutriant that will contain target protein matter at last is with the PBS 48h that dialyses under 4 ℃ of temperature, and measures proteinic concentration with reference to the Bradford method, the results are shown in Figure the 5th swimming lane in 2, and purity can reach 94%, and yield is about 300 μ g/ml.
Fig. 2 represents the expression and the purification result of anti-viral protein, and wherein M represents the molecular weight of albumen standard; Swimming lane 1.pET-28a plasmid transforms the supernatant after the BL21 bacterium is induced; Swimming lane 2. recombinant plasmid pTM-NCC transform the supernatant after the BL21 bacterium is induced; Swimming lane 3.pET-28a plasmid transforms the precipitation after the BL21 bacterium is induced; Swimming lane 4. recombinant plasmid pTM-NCC transform the precipitation after the BL21 bacterium is induced; Anti-viral protein behind swimming lane 5. affinity purifications.
The Western blot of the anti-viral protein of embodiment 2 embodiment 1 preparation detects
Purified anti-viral protein joins in the HepG2.2.15 cell that grows up to individual layer (be final every ml grow up in the HepG2.2.15 cell of individual layer contain the purified anti-viral protein of 10 μ g) with the final concentration of 10 μ g/ml, as experimental group; Add PBS in the control group HepG2.2.15 cell.Through behind the 8h, total protein is extracted in lysis, be Western blot with the mouse monoclonal antibody of anti-His label, utilize chemoluminescence method to detect.(among Fig. 3, M represents the molecular weight of albumen standard as Fig. 3; The Western blot result of swimming lane 1. control group HepG2.2.15 cells; Swimming lane 2. adds the experimental group HepG2.2.15 cell Western blot result of anti-viral protein) shown in, an obvious strips A has appearred in the experimental group cell at the 22KD place, conform to the molecular weight of anti-viral protein; And band does not appear in cellular control unit.
Positioning analysis in the cell of the anti-viral protein of embodiment 3 embodiment 1 preparation
Purified anti-viral protein is joined in the HepG2.2.15 cell climbing sheet that grows up to individual layer (be final every ml grow up in the HepG2.2.15 cell climbing sheet of individual layer contain the purified anti-viral protein of 5 μ g) with the final concentration of 5 μ g/ml, as experimental group; Add PBS in the control group HepG2.2.15 cell climbing sheet.Through behind the 8h, the Paraformaldehyde 96 with 4% is with cell climbing sheet fixing 10min at room temperature; Add concentration again and be 0.2% Triton-X100 (triton-X100), continue fixedly 5min under the room temperature; Then, mouse monoclonal antibody with anti-His label is anti-as one, sheep anti-mouse antibody with the Cy3 mark is anti-as two, under fluorescent microscope, observe, (what red part showed among Fig. 4 is the anti-viral protein that enters in the cytoplasm) as shown in Figure 4, found that anti-viral protein can enter in the most cells, point out it to have the very strong film activity of wearing; Simultaneously, anti-viral protein all is positioned at cytoplasm basically, and the hAPOBEC3G that reports with most of institutes conforms to hAPOBEC3F location situation, points out this anti-viral protein mainly to play a role in cytoplasm.
The antiviral activity of the anti-viral protein of embodiment 4 embodiment 1 preparation detects
One, detects the influence of the relevant HBV-DNA of nucleocapsid in the anti-viral protein pair cell culture supernatant
Add different final concentrations in the experimental group HepG2.2.15 cell and (be respectively 0.2 μ g/ml, 0.5 μ g/ml, 2 μ g/ml, 5 μ g/ml, 10 μ g/ml, 20 μ g/ml, final concentration refers to finally join total μ g number of the anti-viral protein in every ml HepG2.2.15 cell) anti-viral protein, negative control group only adds PBS, adds the 3-TC (lamivudine) of final concentration 20 μ mol/L in the positive controls.Through behind the 36h, the sucking-off supernatant, the centrifugal 30min of 10000g, remove precipitation, subsequently solution is brought to Front is TNE (10mmol/L Tris-HCL, 1mmol/L EDTA (ethylenediamine tetraacetic acid (EDTA)), the 100mmol/L NaCl of 20% glucose, pH value is 7.4, and promptly every liter of TNE contains 10mmol Tris-HCL, 1mmol EDTA, 100mmol NaCl) on, the centrifugal 4h of 65000g.Precipitation after centrifugal is after cold PBS is resuspended, and adding final concentration is the MgCl of 10mmol/L
2, and under 37 ℃ temperature, handle 1h with the DNase I (deoxyribonuclease I) of 200 μ g/mL and the RNase A (ribonuclease A) of 100 μ g/mL.Behind the centrifugal 1min of 14000g, the adding final concentration is that EDTA, the final concentration of 10mmol/L are that 1% SDS, NaCl, the final concentration that final concentration is 100mmol/L are the Proteinase K of 200 μ g/mL in supernatant, handles 2h under 37 ℃ temperature.Remove protein, the DNA alcohol precipitation of aqueous phase with the extracting of phenol chloroform subsequently.The DNA that precipitates is 8.0 TE (10mmol/L Tris-HCL, lmmol/L EDTA promptly contain 10mmol Tris-HCL, 1mmol EDTA among every liter of TE) dissolving again with pH value.Utilize primer HBV-DF, HBV-DR and SYBR Green I dyestuff to carry out real-time quantitative PCR.
HBV-DF:5 '-TCACAATACCGCAGAGTC-3 ' wherein
HBV-DR：5’-AGCAACAGGAGGGATACA-3’
As shown in Figure 5 (among Fig. 5 ,-: negative control cell (negative control group that only adds PBS); 3TC: lamivudine (positive controls that adds lamivudine); ANCC: anti-viral protein (experimental group that adds anti-viral protein)), detected result shows, this anti-viral protein can reduce the content of the relevant HBV-DNA of nucleocapsid in the cells and supernatant, and along with increasing of anti-viral protein concentration, the ability that this anti-viral protein suppresses HBV is also strengthening gradually.
Two, detect the influence of the relevant HBV-DNA of nucleocapsid in the anti-viral protein pair cell slurry
Add different final concentrations in the experimental group HepG2.2.15 cell and (be respectively 0.2 μ g/ml, 0.5 μ g/ml, 2 μ g/ml, 5 μ g/ml, 10 μ g/ml, 20 μ g/ml, final concentration refers to join total μ g number of the anti-viral protein in every mlHepG2.2.15 cell) anti-viral protein, negative control group only adds PBS, adds the 3-TC (lamivudine) of final concentration 20 μ mol/L in the positive controls.Through behind the 36h, cell is washed with cold PBS (phosphate buffered saline buffer); Cell after the washing is used buffer A (10mmol/L Hepes-NaOH, 1.5mmol/L MgCl again
2, 10mmol/L KCl, 0.5mmol/L DTT (dithiothreitol (DTT)), PH8.0, promptly contain 10mmol Hepes-NaOH, 1.5mmol MgCl in every liter of buffer A
2, 10mmol KCl, 0.5mmol DTT) handle 15min on ice; Added concentration again and be 0.5% NP40 (nonidet P-40, non-ionic detergent NP40) vortex 10 seconds, the centrifugal 1min of 12500g removes nucleus.Adding final concentration in the supernatant is the MgCl of 10mmol/L
2(promptly add MgCl
2To MgCl
2Ultimate density in supernatant is 10mmol/L), and under 37 ℃ temperature, handle 1h with the DNaseI of 200 μ g/ml and the RNase A of 100 μ g/ml; The centrifugal 1min of 14000g, the NaCl that EDTA, final concentration are 1% SDS, final concentration is 100mmol/L that adds final concentration in the supernatant after centrifugal and be 10mmol/L, the Proteinase K that final concentration is 200 μ g/ml are (promptly in the supernatant after centrifugal, the ultimate density of EDTA is 10mmol/L, the ultimate density of SDS is 1%, the ultimate density of NaCl is 100mmol/L, the ultimate density of Proteinase K is 200 μ g/ml), under 37 ℃ temperature, handle 2h.Protein is removed in the extracting of phenol chloroform, and the DNA of aqueous phase gets off with alcohol precipitation, is 8.0 TE (10mmol/L Tris-HCL, 1mmol/LEDTA) dissolving again with pH value.Utilize primer HBV-DF, HBV-DR and SYBR Green dyestuff to carry out real-time quantitative PCR.
HBV-DF:5 '-TCACAATACCGCAGAGTC-3 ' wherein
HBV-DR：5’-AGCAACAGGAGGGATACA-3’
As shown in Figure 6 (among Fig. 6 ,-: negative control cell (negative control group that only adds PBS); 3TC: lamivudine (positive controls that adds lamivudine); ANCC: anti-viral protein (experimental group that adds anti-viral protein)), detected result shows, along with increasing of anti-viral protein concentration, this anti-viral protein shows more and more stronger anti-virus ability, and the content that is arranged in the relevant HBV-DNA of nucleocapsid of HepG2.2.15 cytoplasm progressively reduces.
Three, analyze the influence that is wrapped in the HBV pregenome RNA (Yeast Nucleic Acid) in the capsid in the anti-viral protein pair cell slurry
Add anti-viral protein in the experimental group HepG2.2.15 cell, making its final concentration is 10 μ g/ml (being to contain 10 μ g anti-viral proteins in every ml HepG2.2.15 cell), and control group only adds PBS.Through behind the 36h, with cold PBS washed cell, use lysis buffer (100mmol/L Tris-HCL, 1mmol/L EDTA, 1%NP-40, PH8.0, promptly every liter of lysis buffer contains 100mmol Tris-HCL, 1mmol EDTA, 10ml NP-40) to handle 15min again; The centrifugal 1min of 14000g, supernatant is done immunoprecipitation with the antibody and the Sepharose-A albumen of anti-cAg.Capsid for break virus, with 0.7ml lysis buffer (RNeasyKit, Qiagen company) joins in the 0.2ml Sepharose suspended substance, centrifugal behind the violent vortex, remove the Sepharose strain, RNA adsorbs with silicagel column, with DNase I (deoxyribonuclease I) digestion of no RNase (RNA enzyme).Utilize primer HBV-RF, HBV-RR and SYBR Green dyestuff to carry out real-time quantitative RT-PCR.
Wherein HBV-RF is: 5 '-ATCCTGCTGCTATGCCTCATCTT-3 '
HBV-RR is: 5 '-ACAGTGGGGGAAAGCCCTACGAA-3 '
As shown in Figure 7 (among Fig. 7, HBV: have the genomic HepG2.2.15 cell of HBV (control group); HBV+ANCC: the HepG2.2.15 cell (experimental group) that has added anti-viral protein), detected result finds that the anti-viral protein of final concentration 10 μ g/ml can make the content that is wrapped in the HBV pregenome RNA in the capsid in the HBV cells infected endochylema reduce about about 10 times.
The first～three detection of the antiviral activity of above-mentioned anti-viral protein to embodiment 1 preparation shows, the anti-viral protein of embodiment 1 preparation can effectively suppress duplicating of hepatitis B virus (HBV), can be used for the medicine that preparation treatment hepatitis B virus (HBV) infects.
In other embodiments, the present invention also provides following three kinds of anti-viral proteins:
(1) aminoacid sequence of this anti-viral protein is:
Met?Gly?Ser?Ser?
His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro?Arg
Gly?Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg
Gly?Ser
Gly?Gly?Gly?Gly?Ser?Val?Asp?Leu?Glu?
His
His?His?His?His?His
This anti-viral protein comprises the Isocytosine deaminase structural domain that a structure of cell-penetrating peptide territory (Gly Arg Lys Lys ArgArg Gln Arg Arg Arg Pro Pro Gln) and three derive from APOBEC family, and (these three Isocytosine deaminase structural domains are the Isocytosine deaminase structural domain His Pro Glu Met Arg Phe Phe His TrpPhe Ser Lys Trp Arg Lys Leu His Arg Asp Gln Glu Tyr Glu Val Thr Trp TyrIle Ser Trp Ser Pro Cys Thr Lys Cys from hAPOBEC3G molecule N end successively, Isocytosine deaminase structural domain His Ala Glu Arg Cys Phe Leu Ser Trp Phe Cys Asp AspIle Leu Ser Pro Asn Thr Asn Tyr Glu Val Thr Trp Tyr Thr Ser Trp Ser ProCys Pro Glu Cys from hAPOBEC3F molecule C end, Isocytosine deaminase structural domain His Ala Glu Leu Cys Phe Leu Asp Val Ile Pro Phe Trp Lys Leu Asp Leu AspGln Asp Tyr Arg Val Thr Cys Phe Thr Ser Trp Ser Pro Cys Phe Ser Cys from hAPOBEC3G molecule C end), structure of cell-penetrating peptide territory and each Isocytosine deaminase structural domain form concatermer, between structure of cell-penetrating peptide territory and the Isocytosine deaminase structural domain, connect with flexible peptide linker (GlyGlyGlyGlySerGlyGlyGlyGlySer) between adjacent two Isocytosine deaminase structural domains, the N end and the C end of anti-viral protein respectively have a protein purification label (HisHisHisHisHisHis).
(2) aminoacid sequence of this anti-viral protein is:
Met?Gly?Ser?Ser?
His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro?Arg
Gly?Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Gly?Ser
His?His?His?His
This anti-viral protein comprises the Isocytosine deaminase structural domain that a structure of cell-penetrating peptide territory (Gly Arg Lys Lys ArgArg Gln Arg Arg Arg Pro Pro Gln) and three derive from APOBEC family, and (these three Isocytosine deaminase structural domains are the Isocytosine deaminase structural domain His Ala Glu Leu Cys Phe Leu Asp ValIle Pro Phe Trp Lys Leu Asp Leu Asp Gln Asp Tyr Arg Val Thr Cys Phe ThrSer Trp Ser Pro Cys Phe Ser Cys from hAPOBEC3G molecule C end successively, Isocytosine deaminase structural domain His Ala Glu Met Cys Phe Leu Ser Trp Phe Cys Gly Asn GlnLeu Pro Ala Tyr Lys Cys Phe Gln Ile Thr Trp Phe Val Ser Trp Thr Pro CysPro Asp Cys from hAPOBEC3B molecule N end, Isocytosine deaminase structural domain His AlaGlu Arg Cys Phe Leu Ser Trp Phe Cys Asp Asp Ile Leu Ser Pro Asn ThrAsn Tyr Glu Val Thr Trp Tyr Thr Ser TrpSer Pro Cys Pro Glu Cys from hAPOBEC3F molecule C end), structure of cell-penetrating peptide territory and each Isocytosine deaminase structural domain form concatermer, between structure of cell-penetrating peptide territory and the Isocytosine deaminase structural domain, connect with flexible peptide linker (GlyGlyGlyGlySerGlyGlyGlyGlySer) between adjacent two Isocytosine deaminase structural domains, the N end and the C end of anti-viral protein respectively have a protein purification label (HisHisHisHisHisHis).
(3) aminoacid sequence of this anti-viral protein is:
Met?Gly?Ser?Ser?
His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro?Arg
Gly?Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Gly?Ser
Gly?Gly?Gly?Gly
Ser?Gly?Gly?Gly?Gly?Ser
Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser
Gly?Ser
This anti-viral protein comprises the Isocytosine deaminase structural domain that a structure of cell-penetrating peptide territory (Gly Arg Lys Lys ArgArg Gln Arg Arg Arg Pro Pro Gln) and four derive from APOBEC family, and (these three Isocytosine deaminase structural domains are the Isocytosine deaminase structural domain His Pro Glu Met Arg Phe Phe His TrpPhe Ser Lys Trp Arg Lys Leu His Arg Asp Gln Glu Tyr Glu Val Thr Trp TyrIle Ser Trp Ser Pro Cys Thr Lys Cys from hAPOBEC3G molecule N end successively, Isocytosine deaminase structural domain His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro Ser LeuGln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile Ser Trp Ser ProCys Phe Ser Trp Gly Cys from hAPOBEC3B molecule C end, Isocytosine deaminase structural domain His Ala Glu Arg Cys Phe Leu Ser Trp Phe Cys Asp Asp Ile Leu SerPro Asn Thr Asn Tyr Glu Val Thr Trp Tyr Thr Ser Trp Ser Pro Cys Pro GluCys from hAPOBEC3F molecule C end, Isocytosine deaminase structural domain His Val Glu Val AsnPhe Ile Glu Lys Phe Thr Thr Glu Arg Tyr Phe Cys Pro Asn Thr Arg Cys SerIle Thr Trp Phe Leu Ser Trp Ser Pro Cys Gly Glu Cys from the rAPOBEC1 molecule), structure of cell-penetrating peptide territory and each Isocytosine deaminase structural domain form concatermer, between structure of cell-penetrating peptide territory and the Isocytosine deaminase structural domain, connect with flexible peptide linker (GlyGlyGlyGlySerGlyGlyGlyGlySer) between adjacent two Isocytosine deaminase structural domains, the N end and the C end of anti-viral protein respectively have a protein purification label (HisHisHisHisHisHis).
The preparation process of above-mentioned three kinds of anti-viral proteins can be with reference to embodiment 1.
Sequence table
＜110〉Medical College of Shantou University
＜120〉a kind of anti-viral protein and application thereof
<160>5
<170>Patentin?Version?3.3
<210>1
<211>597
<212>DNA
＜213〉artificial sequence
<220>
<221>CDS
<222>(1)...(597)
<220>
<221>misc_feature
<222>(13)...(30)
＜223〉N holds 6 x His label coding sequences
<220>
<221>misc_feature
<222>(103)...(141)
＜223〉structure of cell-penetrating peptide domain encoding sequence
<220>
<221>misc_feature
<222>(142)...(171)
＜223〉flexibly connect the peptide domain encoding sequence
<220>
<221>misc_feature
<222>(172)...(279)
＜223〉hAPOBEC3G molecule N end Isocytosine deaminase structural domain encoding sequence
<220>
<221>misc_feature
<222>(280)...(309)
＜223〉flexibly connect the peptide domain encoding sequence
<220>
<221>misc_feature
<222>(310)...(414)
＜223〉hAPOBEC3G molecule C end Isocytosine deaminase structural domain encoding sequence
<220>
<221>misc_feature
<222>(415)...(444)
＜223〉flexibly connect the peptide domain encoding sequence
<220>
<221>misc_feature
<222>(445)...(549)
＜223〉hAPOBEC3F molecule C end Isocytosine deaminase structural domain encoding sequence
<220>
<221>misc_feature
<222>(577)...(594)
＜223〉C holds 6 x His label coding sequences
<400>1
atgggcagca?gccatcatca?tcatcatcac?agcagcggcc?tggtgccgcg?cggcagccat 60
atggctagca?tgactggtgg?acagcaaatg?ggtcgcggat?ctggcaggaa?gaagcggaga 120
cagcgacgaa?gacctcctca?aggcggaggc?ggatcaggcg?gaggcggatc?acacccagag 180
atgagattct?tccactggtt?cagcaagtgg?aggaagctgc?atcgtgacca?ggagtatgag 240
gtcacctggt?acatatcctg?gagcccctgc?acaaagtgtg?gcggaggcgg?atcaggcgga 300
ggcggatcac?atgcagagct?gtgcttcctg?gacgtgattc?ccttttggaa?gctggacctg 360
gaccaggact?acagggttac?ctgcttcacc?tcctggagcc?cctgcttcag?ctgtggcgga 420
ggcggatcag?gcggaggcgg?atcacatgca?gaaaggtgct?tcctctcttg?gttctgtgac 480
gacatactgt?ctcctaacac?aaactacgag?gtcacctggt?acacatcttg?gagcccttgc 540
ccagagtgtg?gcggaggcgg?atccgtcgac?ctcgagcacc?accaccacca?ccactga 597
<210>2
<211>198
<212>PRT
＜213〉artificial sequence
<220>
<221>DOMAIN
<222>(5)...(10)
＜223〉N holds 6 x His labels
<220>
<221>DOMAIN
<222>(35)...(47)
＜223〉structure of cell-penetrating peptide territory
<220>
<221>DOMAIN
<222>(48)...(57)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(58)...(93)
＜223〉hAPOBEC3G molecule N end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(94)...(103)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(104)...(138)
＜223〉hAPOBEC3G molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(139)...(148)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(149)...(183)
＜223〉hAPOBEC3F molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(193)...(198)
＜223〉C holds 6 x His labels
<400>2
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro
1 5 10 15
Arg?Gly?Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg
20 25 30
Gly?Ser?Gly?Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Pro?Pro?Gln?Gly
35 40 45
Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?His?Pro?Glu?Met?Arg?Phe?Phe
50 55 60
His?Trp?Phe?Ser?Lys?Trp?Arg?Lys?Leu?His?Arg?Asp?Gln?Glu?Tyr?Glu
65 70 75 80
Val?Thr?Trp?Tyr?Ile?Ser?Trp?Ser?Pro?Cys?Thr?Lys?Cys?Gly?Gly?Gly
85 90 95
Gly?Ser?Gly?Gly?Gly?Gly?Ser?His?Ala?Glu?Leu?Cys?Phe?Leu?Asp?Val
100 105 110
Ile?Pro?Phe?Trp?Lys?Leu?Asp?Leu?Asp?Gln?Asp?Tyr?Arg?Val?Thr?Cys
115 120 125
Phe?Thr?Ser?Trp?Ser?Pro?Cys?Phe?Ser?Cys?Gly?Gly?Gly?Gly?Ser?Gly
130 135 140
Gly?Gly?Gly?Ser?His?Ala?Glu?Arg?Cys?Phe?Leu?Ser?Trp?Phe?Cys?Asp
145 150 155 160
Asp?Ile?Leu?Ser?Pro?Asn?Thr?Asn?Tyr?Glu?Val?Thr?Trp?Tyr?Thr?Ser
165 170 175
Trp?Ser?Pro?Cys?Pro?Glu?Cys?Gly?Gly?Gly?Gly?Ser?Val?Asp?Leu?Glu
180 185 190
His?His?His?His?His?His
195
<210>3
<211>198
<212>PRT
＜213〉artificial sequence
<220>
<221>DOMAIN
<222>(5)...(10)
＜223〉N holds 6 x His labels
<220>
<221>DOMAIN
<222>(35)...(47)
＜223〉structure of cell-penetrating peptide territory
<220>
<22l>DOMAIN
<222>(48)...(57)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(58)...(93)
＜223〉hAPOBEC3G molecule N end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(94)...(103)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(104)...(138)
＜223〉hAPOBEC3F molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(139)...(148)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(149)...(183)
＜223〉hAPOBEC3G molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(193)...(198)
＜223〉C holds 6 x His labels
<400>3
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro
1 5 10 15
Arg?Gly?Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg
20 25 30
Gly?Ser?Gly?Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Pro?Pro?Gln?Gly
35 40 45
Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?His?Pro?Glu?Met?Arg?Phe?Phe
50 55 60
His?Trp?Phe?Ser?Lys?Trp?Arg?Lys?Leu?His?Arg?Asp?Gln?Glu?Tyr?Glu
65 70 75 80
Val?Thr?Trp?Tyr?Ile?Ser?Trp?Ser?Pro?Cys?Thr?Lys?Cys?Gly?Gly?Gly
85 90 95
Gly?Ser?Gly?Gly?Gly?Gly?Ser?His?Ala?Glu?Arg?Cys?Phe?Leu?Ser?Trp
100 105 110
Phe?Cys?Asp?Asp?Ile?Leu?Ser?Pro?Asn?Thr?Asn?Tyr?Glu?Val?Thr?Trp
115 120 125
Tyr?Thr?Ser?Trp?Ser?Pro?Cys?Pro?Glu?Cys?Gly?Gly?Gly?Gly?Ser?Gly
130 135 140
Gly?Gly?Gly?Ser?His?Ala?Glu?Leu?Cys?Phe?Leu?Asp?Val?Ile?Pro?Phe
145 150 155 160
Trp?Lys?Leu?Asp?Leu?Asp?Gln?Asp?Tyr?Arg?Val?Thr?Cys?Phe?Thr?Ser
165 170 175
Trp?Ser?Pro?Cys?Phe?Ser?Cys?Gly?Gly?Gly?Gly?Ser?Val?Asp?Leu?Glu
180 185 190
His?His?His?His?His?His
195
<210>4
<211>197
<212>PRT
＜213〉artificial sequence
<220>
<221>DOMAIN
<222>(5)...(10)
＜223〉N holds 6 x His labels
<220>
<221>DOMAIN
<222>(35)...(47)
＜223〉structure of cell-penetrating peptide territory
<220>
<221>DOMAIN
<222>(48)...(57)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(58)...(92)
＜223〉hAPOBEC3G molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(93)...(102)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(103)...(137)
＜223〉hAPOBEC3B molecule N end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(138)...(147)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(148)...(182)
＜223〉hAPOBEC3F molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(192)...(197)
＜223〉C holds 6 x His labels
<400>4
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro
1 5 10 15
Arg?Gly?Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg
20 25 30
Gly?Ser?Gly?Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Pro?Pro?Gln?Gly
35 40 45
Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?His?Ala?Glu?Leu?Cys?Phe?Leu
50 55 60
Asp?Val?Ile?Pro?Phe?Trp?Lys?Leu?Asp?Leu?Asp?Gln?Asp?Tyr?Arg?Val
65 70 75 80
Thr?Cys?Phe?Thr?Ser?Trp?Ser?Pro?Cys?Phe?Ser?Cys?Gly?Gly?Gly?Gly
85 90 95
Ser?Gly?Gly?Gly?Gly?Ser?His?Ala?Glu?Met?Cys?Phe?Leu?Ser?Trp?Phe
100 105 110
Cys?Gly?Asn?Gln?Leu?Pro?Ala?Tyr?Lys?Cys?Phe?Gln?Ile?Thr?Trp?Phe
115 120 125
Val?Ser?Trp?Thr?Pro?Cys?Pro?Asp?Cys?Gly?Gly?Gly?Gly?Ser?Gly?Gly
130 135 140
Gly?Gly?Ser?His?Ala?Glu?Arg?Cys?Phe?Leu?Ser?Trp?Phe?Cys?Asp?Asp
145 150 155 160
Ile?Leu?Ser?Pro?Asn?Thr?Asn?Tyr?Glu?Val?Thr?Trp?Tyr?Thr?Ser?Trp
165 170 175
Ser?Pro?Cys?Pro?Glu?Cys?Gly?Gly?Gly?Gly?Ser?Val?Asp?Leu?Glu?His
180 185 190
His?His?His?His?His
195
<210>5
<211>246
<212>PRT
＜213〉artificial sequence
<220>
<221>DOMAIN
<222>(5)...(10)
＜223〉N holds 6 x His labels
<220>
<221>DOMAIN
<222>(35)...(47)
＜223〉structure of cell-penetrating peptide territory
<220>
<221>DOMAIN
<222>(48)...(57)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(58)...(93)
＜223〉hAPOBEC3G molecule N end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(94)...(103)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(104)...(140)
＜223〉hAPOBEC3B molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(141)...(150)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(151)...(185)
＜223〉hAPOBEC3F molecule C end Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(186)...(195)
＜223〉flexibly connect peptide domain
<220>
<221>DOMAIN
<222>(196)..(231)
＜223〉rAPOBEC1 molecule Isocytosine deaminase structural domain
<220>
<221>DOMAIN
<222>(241)...(246)
＜223〉C holds 6 x His labels
<400>5
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro
1 5 10 15
Arg?Gly?Ser?His?Met?Ala?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg
20 25 30
Gly?Ser?Gly?Arg?Lys?Lys?Arg?Arg?Gln?Arg?Arg?Arg?Pro?Pro?Gln?Gly
35 40 45
Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?His?Pro?Glu?Met?Arg?Phe?Phe
50 55 60
His?Trp?Phe?Ser?Lys?Trp?Arg?Lys?Leu?His?Arg?Asp?Gln?Glu?Tyr?Glu
65 70 75 80
Val?Thr?Trp?Tyr?Ile?Ser?Trp?Ser?Pro?Cys?Thr?Lys?Cys?Gly?Gly?Gly
85 90 95
Gly?Ser?Gly?Gly?Gly?Gly?Ser?His?Ala?Glu?Leu?Arg?Phe?Leu?Asp?Leu
100 105 110
Val?Pro?Ser?Leu?Gln?Leu?Asp?Pro?Ala?Gln?Ile?Tyr?Arg?Val?Thr?Trp
115 120 125
Phe?Ile?Ser?Trp?Ser?Pro?Cys?Phe?Ser?Trp?Gly?Cys?Gly?Gly?Gly?Gly
130 135 140
Ser?Gly?Gly?Gly?Gly?Ser?His?Ala?Glu?Arg?Cys?Phe?Leu?Ser?Trp?Phe
145 150 155 160
Cys?Asp?Asp?Ile?Leu?Ser?Pro?Asn?Thr?Asn?Tyr?Glu?Val?Thr?Trp?Tyr
165 170 175
Thr?Ser?Trp?Ser?Pro?Cys?Pro?Glu?Cys?Gly?Gly?Gly?Gly?Ser?Gly?Gly
180 185 190
Gly?Gly?Ser?His?Val?Glu?Val?Asn?Phe?Ile?Glu?Lys?Phe?Thr?Thr?Glu
195 200 205
Arg?Tyr?Phe?Cys?Pro?Asn?Thr?Arg?Cys?Ser?Ile?Thr?Trp?Phe?Leu?Ser
210 215 220
Trp?Ser?Pro?Cys?Gly?Glu?Cys?Gly?Gly?Gly?Gly?Ser?Val?Asp?Leu?Glu
225 230 235 240
His?His?His?His?His?His
245
Claims (12)
1, a kind of anti-viral protein is characterized in that it is a fused protein, comprises structure of cell-penetrating peptide territory and at least two Isocytosine deaminase structural domains that derive from APOBEC family, and structure of cell-penetrating peptide territory and each Isocytosine deaminase structural domain form concatermer.
2, anti-viral protein according to claim 1 is characterized in that: described anti-viral protein comprises at least three Isocytosine deaminase structural domains that derive from APOBEC family.
3, anti-viral protein according to claim 2 is characterized in that: the Isocytosine deaminase structural domain in the described anti-viral protein is from three kinds of different APOBEC family members.
4, anti-viral protein according to claim 2 is characterized in that: described anti-viral protein comprises at least four Isocytosine deaminase structural domains that derive from APOBEC family.
5, anti-viral protein according to claim 4 is characterized in that: the Isocytosine deaminase structural domain in the described anti-viral protein is from least three kinds of different APOBEC family members.
6, according to each described anti-viral protein of claim 1～5, it is characterized in that: the core motif allow that the Isocytosine deaminase structural domain of the described APOBEC of deriving from family is had is: H-X-E-(X)
23-28-P-C-(X)
2-4-C, wherein H is a Histidine, and E is a L-glutamic acid, and C is a halfcystine, and P is a proline(Pro), X represents arbitrary amino acid.
7, according to each described anti-viral protein of claim 1～5, it is characterized in that: the sequence that constitutes described structure of cell-penetrating peptide territory be following have wear a kind of in the active sequence of film peptide: the GRKKRRQRRRPPQ sequence; The DAATARGRGRSAASRPTERPRAPARSASRPRRPVD sequence; The RKKRRQRRR sequence; The GALFLGWLGAAGSTMGAWSQPKKKRKV sequence; The RQIKIWFQNRRMKWKK sequence; The GWTLNSAGYLLKINLKALAALAKKIL sequence; The KLALKLAALKAALKLA sequence; The RRRRRRRRR sequence; The AAVALLPAVLLALLAP sequence.
8, according to each described anti-viral protein of claim 1～5, it is characterized in that: the Isocytosine deaminase structural domain in the described anti-viral protein is the Isocytosine deaminase structural domain that derives from people APOBEC3G, people APOBEC3F, people APOBEC3B and these four kinds of protein molecules of rat APOBEC1 in the APOBEC family.
9, according to each described anti-viral protein of claim 1～5, it is characterized in that: connect with flexible peptide linker between each structural domain in the described anti-viral protein.
10, anti-viral protein according to claim 9 is characterized in that: described flexible peptide linker is GGGG, GSSSG, GSGGSG, GGGGS, (GGGGS)
2(GGGGS)
3In one or any multiple combination.
11, the application of the anti-viral protein of claim 1～10 in the medicine of preparation treatment HIV (human immunodeficiency virus) infection.
12, the application of the anti-viral protein of claim 1～10 in the medicine of preparation treatment hepatitis B virus infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100302237A CN101343327B (en) | 2008-08-13 | 2008-08-13 | Antiviral protein and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100302237A CN101343327B (en) | 2008-08-13 | 2008-08-13 | Antiviral protein and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101343327A true CN101343327A (en) | 2009-01-14 |
| CN101343327B CN101343327B (en) | 2012-05-23 |
Family
ID=40245454
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008100302237A Expired - Fee Related CN101343327B (en) | 2008-08-13 | 2008-08-13 | Antiviral protein and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101343327B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102241777A (en) * | 2011-06-01 | 2011-11-16 | 中国人民解放军南京军区福州总医院 | Targeted PTEN gene composite, and preparation method and application thereof |
| CN102311500A (en) * | 2010-07-02 | 2012-01-11 | 杭州师范大学 | Antiviral fusion protein and application thereof |
| CN103045612A (en) * | 2012-12-07 | 2013-04-17 | 四川大学华西医院 | Preparation method of recombinant protein |
| CN103468734A (en) * | 2012-06-08 | 2013-12-25 | 党志胜 | Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine |
| CN104491870A (en) * | 2014-12-17 | 2015-04-08 | 华东理工大学 | Application of cell penetrating peptide LTA2 from LT subunit in aspect of serving as intracellular drug delivery carrier |
| CN106866795A (en) * | 2017-03-09 | 2017-06-20 | 青岛科技大学 | A kind of rabies viruses suppresses polypeptide and its preparation method and application |
| CN110139870A (en) * | 2016-12-16 | 2019-08-16 | 爱维斯健有限公司 | Penetratin and intracellular delivery vehicles comprising it |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003257181A1 (en) * | 2002-08-05 | 2004-02-23 | University Of Rochester | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof |
-
2008
- 2008-08-13 CN CN2008100302237A patent/CN101343327B/en not_active Expired - Fee Related
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102311500A (en) * | 2010-07-02 | 2012-01-11 | 杭州师范大学 | Antiviral fusion protein and application thereof |
| CN102311500B (en) * | 2010-07-02 | 2015-05-27 | 杭州师范大学 | Antiviral fusion protein and application thereof |
| CN102241777A (en) * | 2011-06-01 | 2011-11-16 | 中国人民解放军南京军区福州总医院 | Targeted PTEN gene composite, and preparation method and application thereof |
| CN103468734A (en) * | 2012-06-08 | 2013-12-25 | 党志胜 | Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine |
| CN103045612A (en) * | 2012-12-07 | 2013-04-17 | 四川大学华西医院 | Preparation method of recombinant protein |
| CN103045612B (en) * | 2012-12-07 | 2015-02-11 | 四川大学华西医院 | Preparation method of recombinant protein |
| CN104491870A (en) * | 2014-12-17 | 2015-04-08 | 华东理工大学 | Application of cell penetrating peptide LTA2 from LT subunit in aspect of serving as intracellular drug delivery carrier |
| CN104491870B (en) * | 2014-12-17 | 2018-02-06 | 华东理工大学 | Applications of the cell-penetrating peptide LTA2 from LT subunits as Intracellular drug transport agent |
| CN110139870A (en) * | 2016-12-16 | 2019-08-16 | 爱维斯健有限公司 | Penetratin and intracellular delivery vehicles comprising it |
| CN110139870B (en) * | 2016-12-16 | 2023-12-01 | 爱维斯健有限公司 | Cell membrane penetrating peptide and intracellular delivery vehicle comprising same |
| CN106866795A (en) * | 2017-03-09 | 2017-06-20 | 青岛科技大学 | A kind of rabies viruses suppresses polypeptide and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101343327B (en) | 2012-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101343327B (en) | Antiviral protein and uses thereof | |
| Oess et al. | Novel cell permeable motif derived from the PreS2-domain of hepatitis-B virus surface antigens | |
| Vocero-Akbani et al. | Transduction of full-length Tat fusion proteins directly into mammalian cells: analysis of T cell receptor activation-induced cell death | |
| Yang et al. | HIV‐1 TAT‐mediated protein transduction and subcellular localization using novel expression vectors1 | |
| CN112209995B (en) | Preparation method of SARS-CoV-2 surface protein receptor binding region | |
| US10000541B2 (en) | Trail cell-penetrating peptide-like mutant MUR6 and preparation method thereof | |
| CN112226413B (en) | Targeting exosome based on SARS-CoV-2S protein RBD region and preparation method thereof | |
| CN101962412B (en) | Recombinant TAT-XIAP fusion protein | |
| Rumlova-Klikova et al. | Analysis of Mason-Pfizer monkey virus Gag domains required for capsid assembly in bacteria: role of the N-terminal proline residue of CA in directing particle shape | |
| CN104710534A (en) | Reorganized HBc fusion protein | |
| CN110499305A (en) | Expression vector, construction method and its expression and purification of nuclease protein Cas9 | |
| Peretti et al. | Cell death induced by the herpes simplex virus-1 thymidine kinase delivered by human immunodeficiency virus-1-based virus-like particles | |
| US10000552B2 (en) | TRAIL cell-penetrating peptide-like mutant MuR5 and preparation method thereof | |
| CN102850444B (en) | A pair of transcription activator like effector nucleases of L3 and R1 and a coding gene and an application thereof | |
| CN110372780B (en) | Antitumor polypeptide and application thereof in antitumor field | |
| KR20110106333A (en) | Cell permeable p53 recombinant protein, polynucleotide encoding the same, and anti-cancer composition containing the same as active ingredient | |
| CN105734097B (en) | A kind of MIM-I-BAR protein extraction purification process | |
| CN109942715A (en) | A kind of recombination fusion protein of targeting therapy on tumor and its preparation method and application | |
| EP2921555B1 (en) | Artificial bioparticle and method for manufacturing same | |
| CN110038120B (en) | Application of rana pipiens anti-tumor enzyme fusion protein as tumor treatment drug | |
| CN104946679B (en) | A kind of method of rhIL-10 construction of recombinant vector and its protein purification | |
| CN101481420B (en) | Heterozygous antibacterial peptide CA-MA and recombinant expression method thereof | |
| CN113388008B (en) | Endoplasmic reticulum targeted self-release protein transport carrier LCA2 and application thereof | |
| CN113321714B (en) | Recombinant N protein of SARS-CoV-2 and its preparation and purification method | |
| CN101691585B (en) | Recombinant plasmid pSEB-Wnt5a and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120523 Termination date: 20210813 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |