CN103468734A - Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine - Google Patents
Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine Download PDFInfo
- Publication number
- CN103468734A CN103468734A CN2012101879873A CN201210187987A CN103468734A CN 103468734 A CN103468734 A CN 103468734A CN 2012101879873 A CN2012101879873 A CN 2012101879873A CN 201210187987 A CN201210187987 A CN 201210187987A CN 103468734 A CN103468734 A CN 103468734A
- Authority
- CN
- China
- Prior art keywords
- fbp
- fibronectin
- tsp3
- vaccine
- exploiting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A good adjuvant is needed for exploiting a nontoxic efficient vaccine. Research shows that: invading process of fowl mycobacterium is finished by depending combination of fibronectin-binding protein (FBP) and fibronectin of intestine epidermal M cells when fowl mycobacterium infects people and livestock, and strong immunization reaction can be inducted and generated by purified FBP immunization animals. Therefore, the protein can be used to exploit the nontoxic efficient vaccines. A conventional method comprises: mixing the antigen protein of pathogen and FBP for animal immunization. But the generation of a large amount of pathogen antigen protein and FBP needs a molecular biology means which is tedious in process and expensive in cost. Therefore, the hydatid TSP3 gene and the FBP gene are linked via GSGGSG splice, and then are introduced into pBAD/Thio-TOPO carrier for fusion expression. Mice immunization experiments of fusion protein show that: the technology helps to substantially improve immune effect, save cost and provide new thinking for exploiting effective anti-echinococcosis vaccine.
Description
Technical field
This research belongs to molecular biology, the vaccine development field.
Background technology
Hepatic echinococcosis is that a kind of larva by the Echinococcus tapeworm (echinococcus) colonizes in the infecting both domestic animals and human parasitosis that people and animals' liver causes, does not up to the present still develop the vaccine of prevention hepatic echinococcosis.A very important reason is not find the vaccine adjuvant of non-toxic efficient.Research shows: 1) avian tuberculosis mycobacterium paratuberculosis subspecies are to rely on its Fibronectin combine and complete phagocytic process in conjunction with the Fibronectin of albumen and intestinal epithelial cells (M cell) when infecting people and animals; 2) its Fibronectin of separation and purification in conjunction with albumen after immune animal can induce the very strong immune response of generation.This prompting Fibronectin has adjuvant effect in conjunction with albumen, can induce protective immunological reaction with the antigen co-immunization animal of Echinococcus hydatid cyst.Molecular biological development make we can by polymerase chain reaction (PCR) by the Echinococcus hydatid cyst antigen gene with involve protein-binding protein and be connected, then express recombinant protein by expression vector, simplified and expressed respectively and the process of purifying these two kinds of albumen, improved immune effect.
Summary of the invention
In the world first with the GSGGSG joint connect mycobacterium paratuberculosis bacterium (
mycobacterium avium) Fibronectin is in conjunction with albumen (fibronectin-binding protein, FBP) (tetraspanin 3, TSP3) the outer large ring zone of film (LEL) be cloned into the pBAD/Thio-TOPO vector construction and have recombinant expressed a year of immunological adjuvant effect to revolve albumen in conjunction with territory and Echinococcus hydatid cyst four.By this recombinant expression vector pBAD/Thio-TOPO fusion rotein that has been transformed into after intestinal bacteria successful expression.After this fusion rotein of purifying and mucous membrane (per os) immune mouse, induce and produced strong whole body (blood) and local (mucous membrane) immune response.This is because antigen protein easily is attached on the Fibronectin on intestinal mucosa under the protein-bonded synergy of the Fibronectin with its fusion, then bring out the activity of dendritic cell by epithelial cell (M cell), excited the adenoid immune response of intestinal tube.This research provides new thinking for developing effective anti-hydatidosis vaccine.
The accompanying drawing explanation
Fig. 1 means the figure of the formation of fusion expression vector.1. Echinococcus hydatid cyst four is revolved albumen (TSP3) and is connected by the GSGGSG joint in conjunction with albumen (FBP) with Fibronectin; 2. gene is in the insertion point of carrier; 3. expression vector.
Em-TSP3-Linker-FAP
AAGCTTCATGAGTTTGTCGGTCTTGTGGGAAAGGAAATGCAGCGAGAGATTAAGGACCTTACCGCCCATGGAAGGAATGCAAGTGACCCTCTCCTGAAGTCAATATACAAACTCCAGGAAGAGCTTGAGTGCTGTGGCGGTGTGGGCCCAACTGATTGGAGTAAGCCCTACCCTGCATCATGCTGCAAATCCGGGAAGGAGAATTGTACACAACCATATCAGCAGGGTTGTGCTGTGGCCATGTACGAGCAAATTAAGGATTCCTCTCTGCTCGAGGGTAGCGGCGGTTCTGGTGGCAACGCGCAACGCTGGTTCGTCGTCTGGCTGGGCACCTCGAACGACCCGGTGGACAAGGTCGCGGCCAAG
Claims (3)
1. the recombinant expression vector with immunological adjuvant effect, the mycobacterium paratuberculosis bacterium that will connect by the GSGGSG joint (
mycobacterium avium) Fibronectin revolves albumen in conjunction with albumen (fibronectin-binding protein, FBP) in conjunction with territory and Echinococcus hydatid cyst four (tetraspanin 3, and TSP3) the outer large ring zone of film (LEL) is inserted into the pBAD/Thio-TOPO vector construction and forms.
2. the connection of FBP according to claim 1 and Echinococcus hydatid cyst TSP3, is characterized in that the TSP3 two ends are connected with
hindiII and
xhoIrestriction enzyme site, and this TSP3 containing restriction enzyme site is connected with FBP by the GSGGSG joint.
3. use
hindiII and
xhothe I enzyme is cut after above-mentioned recombinant vectors cohesive end and GSGGSG joint and the FBP that still remains with two restriction enzyme sites, and any antigen gene with corresponding restriction enzyme site cohesive end can be connected on this carrier and build recombinant expression vector.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012101879873A CN103468734A (en) | 2012-06-08 | 2012-06-08 | Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012101879873A CN103468734A (en) | 2012-06-08 | 2012-06-08 | Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103468734A true CN103468734A (en) | 2013-12-25 |
Family
ID=49793775
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2012101879873A Pending CN103468734A (en) | 2012-06-08 | 2012-06-08 | Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103468734A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107041950A (en) * | 2016-10-28 | 2017-08-15 | 青海大学 | A kind of Echinococcus moltilocularis polyepitope vaccines LTB AE design, preparation method and application |
CN114874336A (en) * | 2022-05-07 | 2022-08-09 | 新疆医科大学 | Echinococcus granulosus recombinant protein EgG1Y162-2(4) and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101343327A (en) * | 2008-08-13 | 2009-01-14 | 汕头大学医学院 | Antiviral protein and uses thereof |
-
2012
- 2012-06-08 CN CN2012101879873A patent/CN103468734A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101343327A (en) * | 2008-08-13 | 2009-01-14 | 汕头大学医学院 | Antiviral protein and uses thereof |
Non-Patent Citations (5)
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107041950A (en) * | 2016-10-28 | 2017-08-15 | 青海大学 | A kind of Echinococcus moltilocularis polyepitope vaccines LTB AE design, preparation method and application |
CN107041950B (en) * | 2016-10-28 | 2020-06-02 | 青海大学 | Design, preparation method and application of echinococcus multiepitope vaccine LTB-AE |
CN114874336A (en) * | 2022-05-07 | 2022-08-09 | 新疆医科大学 | Echinococcus granulosus recombinant protein EgG1Y162-2(4) and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107653260B (en) | Preparation method and application of recombinant lactococcus lactis | |
CN113293145B (en) | New measles virus live vector corona vaccine | |
CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
Lin et al. | Avian reovirus sigma C enhances the mucosal and systemic immune responses elicited by antigen-conjugated lactic acid bacteria | |
CN101016541A (en) | Method of producing brucella vaccine antigen protein | |
Gao et al. | Enhanced mucosal immune responses induced by a combined candidate mucosal vaccine based on Hepatitis A virus and Hepatitis E virus structural proteins linked to tuftsin | |
CN103468734A (en) | Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine | |
CN104725503B (en) | A kind of Fugu rubripes nervous necrosis virus capsid protein Yolk antibody and its application | |
CN110054687A (en) | Grass carp ATG12 polyclonal antibody and preparation method thereof | |
CN107961371A (en) | Season influenza-RSV combined vaccine and its preparation method and application | |
Tebianian et al. | Cloning, expression, and immunogenicity of novel fusion protein of Mycobacterium tuberculosis based on ESAT-6 and truncated C-terminal fragment of HSP70 | |
CN102274496A (en) | O/Asia I type foot and mouth disease virus bivalent genetic engineering polypeptide vaccine, its preparation method and its purpose | |
CN104548087B (en) | Epitope vaccine for resisting A/B subgroup avian leucosis virus infection and preparation method and application of epitope vaccine | |
CN105861521A (en) | Preparation method and application of tilapia source streptococcus agalactiae recombinant GroEL protein vaccine | |
CN105567660A (en) | Escherichia coli recombinate expression method of mycobacterium tuberculosis Rv 2837c active protein and applications thereof | |
CN102406929B (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
CN104479028B (en) | Bovine rota VP8* subunits recombinate chimeric protein and its application | |
CN104726413B (en) | The monoclonal antibody of one plant of Mycoplasma bovis nadh oxidase | |
CN106117365A (en) | Anti-streptococcus suis is sick and has the active fusion protein of autoimmune and preparation thereof and application | |
CN103243105B (en) | A kind of Trichina recombinant protein and application | |
CN101070347B (en) | Bird-flu H5N1 novel mucous membrane immunization vaccine and its use | |
CN106177934B (en) | A kind of haemophilus parasuis subunit vaccine and preparation method thereof | |
CN104248754A (en) | Streptococcus suis vaccine composition, and preparation method and application thereof | |
CN104306995B (en) | Epitope vaccine for resisting subgroup J avian leukosis virus infection as well as preparation method and application of epitope vaccine | |
CN104127883B (en) | With many t cell epitopes tuberculosis gene vaccine that HSP65 is epi-position support |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131225 |