CN103468734A - Immunopotentiation adjuvant fusion expression vector used for exploiting hydatid vaccine - Google Patents

Abstract

A good adjuvant is needed for exploiting a nontoxic efficient vaccine. Research shows that: invading process of fowl mycobacterium is finished by depending combination of fibronectin-binding protein (FBP) and fibronectin of intestine epidermal M cells when fowl mycobacterium infects people and livestock, and strong immunization reaction can be inducted and generated by purified FBP immunization animals. Therefore, the protein can be used to exploit the nontoxic efficient vaccines. A conventional method comprises: mixing the antigen protein of pathogen and FBP for animal immunization. But the generation of a large amount of pathogen antigen protein and FBP needs a molecular biology means which is tedious in process and expensive in cost. Therefore, the hydatid TSP3 gene and the FBP gene are linked via GSGGSG splice, and then are introduced into pBAD/Thio-TOPO carrier for fusion expression. Mice immunization experiments of fusion protein show that: the technology helps to substantially improve immune effect, save cost and provide new thinking for exploiting effective anti-echinococcosis vaccine.

Description

A kind of for developing the immunity enhancement adjuvant fusion expression vector of Echinococcus hydatid cyst vaccine

Technical field

This research belongs to molecular biology, the vaccine development field.

Background technology

Hepatic echinococcosis is that a kind of larva by the Echinococcus tapeworm (echinococcus) colonizes in the infecting both domestic animals and human parasitosis that people and animals' liver causes, does not up to the present still develop the vaccine of prevention hepatic echinococcosis.A very important reason is not find the vaccine adjuvant of non-toxic efficient.Research shows: 1) avian tuberculosis mycobacterium paratuberculosis subspecies are to rely on its Fibronectin combine and complete phagocytic process in conjunction with the Fibronectin of albumen and intestinal epithelial cells (M cell) when infecting people and animals; 2) its Fibronectin of separation and purification in conjunction with albumen after immune animal can induce the very strong immune response of generation.This prompting Fibronectin has adjuvant effect in conjunction with albumen, can induce protective immunological reaction with the antigen co-immunization animal of Echinococcus hydatid cyst.Molecular biological development make we can by polymerase chain reaction (PCR) by the Echinococcus hydatid cyst antigen gene with involve protein-binding protein and be connected, then express recombinant protein by expression vector, simplified and expressed respectively and the process of purifying these two kinds of albumen, improved immune effect.

Summary of the invention

In the world first with the GSGGSG joint connect mycobacterium paratuberculosis bacterium ( mycobacterium avium) Fibronectin is in conjunction with albumen (fibronectin-binding protein, FBP) (tetraspanin 3, TSP3) the outer large ring zone of film (LEL) be cloned into the pBAD/Thio-TOPO vector construction and have recombinant expressed a year of immunological adjuvant effect to revolve albumen in conjunction with territory and Echinococcus hydatid cyst four.By this recombinant expression vector pBAD/Thio-TOPO fusion rotein that has been transformed into after intestinal bacteria successful expression.After this fusion rotein of purifying and mucous membrane (per os) immune mouse, induce and produced strong whole body (blood) and local (mucous membrane) immune response.This is because antigen protein easily is attached on the Fibronectin on intestinal mucosa under the protein-bonded synergy of the Fibronectin with its fusion, then bring out the activity of dendritic cell by epithelial cell (M cell), excited the adenoid immune response of intestinal tube.This research provides new thinking for developing effective anti-hydatidosis vaccine.

The accompanying drawing explanation

Fig. 1 means the figure of the formation of fusion expression vector.1. Echinococcus hydatid cyst four is revolved albumen (TSP3) and is connected by the GSGGSG joint in conjunction with albumen (FBP) with Fibronectin; 2. gene is in the insertion point of carrier; 3. expression vector.

Em-TSP3-Linker-FAP

AAGCTTCATGAGTTTGTCGGTCTTGTGGGAAAGGAAATGCAGCGAGAGATTAAGGACCTTACCGCCCATGGAAGGAATGCAAGTGACCCTCTCCTGAAGTCAATATACAAACTCCAGGAAGAGCTTGAGTGCTGTGGCGGTGTGGGCCCAACTGATTGGAGTAAGCCCTACCCTGCATCATGCTGCAAATCCGGGAAGGAGAATTGTACACAACCATATCAGCAGGGTTGTGCTGTGGCCATGTACGAGCAAATTAAGGATTCCTCTCTGCTCGAGGGTAGCGGCGGTTCTGGTGGCAACGCGCAACGCTGGTTCGTCGTCTGGCTGGGCACCTCGAACGACCCGGTGGACAAGGTCGCGGCCAAG

 

 

Claims (3)

1. the recombinant expression vector with immunological adjuvant effect, the mycobacterium paratuberculosis bacterium that will connect by the GSGGSG joint ( mycobacterium avium) Fibronectin revolves albumen in conjunction with albumen (fibronectin-binding protein, FBP) in conjunction with territory and Echinococcus hydatid cyst four (tetraspanin 3, and TSP3) the outer large ring zone of film (LEL) is inserted into the pBAD/Thio-TOPO vector construction and forms.

2. the connection of FBP according to claim 1 and Echinococcus hydatid cyst TSP3, is characterized in that the TSP3 two ends are connected with hindiII and xhoIrestriction enzyme site, and this TSP3 containing restriction enzyme site is connected with FBP by the GSGGSG joint.

3. use hindiII and xhothe I enzyme is cut after above-mentioned recombinant vectors cohesive end and GSGGSG joint and the FBP that still remains with two restriction enzyme sites, and any antigen gene with corresponding restriction enzyme site cohesive end can be connected on this carrier and build recombinant expression vector.

Images