CN101003812A

CN101003812A - Method in use for preparing recombined EGF-IL18 fusion protein of human

Info

Publication number: CN101003812A
Application number: CN 200610006574
Authority: CN
Inventors: 吕建新
Original assignee: Wenzhou Medical College
Current assignee: Wenzhou Medical College
Priority date: 2006-01-17
Filing date: 2006-01-17
Publication date: 2007-07-25
Anticipated expiration: 2026-01-17
Also published as: CN101003812B

Abstract

This invention discloses a method for preparing recombinant human EGF-IL18 fusion protein. This invention also relates to expression recombinant containing the fusion gene, engineering bacteria containing the expression recombinant, targeted fusion protein - recombinant human EGF-IL18 fusion protein expressed, separated and purified by the engineering bacteria, and its application in treating tumors with high EGF expression.

Description

A kind of method that is used to prepare recombinant human EGF-IL18 fusion rotein

Technical field

The present invention relates to a kind of method that is used to prepare recombinant human EGF-IL18 fusion rotein.The invention still further relates to the expression type recombinant chou that comprises described fusion gene, comprise the engineering bacteria of described expression type recombinant chou, engineering bacterium expression and the targent fused protein-people EGF-IL18 of separation and purification and the purposes that this fusion rotein is used for the treatment of EGFR high expression level tumour thus.

Background technology

Malignant tumour is to threaten human common disease.In recent years, become the important directions of drug development at the target therapeutic agent of some acceptor, gene or key substance.This class drug main wants targeting on relevant tumour cell, and it can reduce normal histiocytic undesirable action in the lethality that improves tumour cell simultaneously, is considered in the following cancer therapy research direction of tool prospect.

Interleukin-18 (Interleukin18, IL18) in 1996 by clones such as Ushio, its main biologic activity is that inducing T cell produces IFN γ, promotes T cell and NK cell proliferation activation and promotes the Fas ligand expression, suppresses vasculogenesis etc.Experimentation on animals shows that IL18 has obvious antineoplastic, this effect performance indirectly by the intravital NK cell of inducing mouse and CD4+ cytotoxic activity.Therefore, IL18 has the potential application prospect aspect tumor biotherapy.But because effector cell-H1 and the NK cell of IL-18 are distributed widely in the partes corporis humani position, excite inflammatory reaction easily, have side effects.Therefore, need a kind of targeting sequencing to strengthen the target of IL-18, promptly how to make cytokine directionally act on tumour cell in vivo tumour cell.On the other hand, EGF-R ELISA (EGFR) can reach Normocellular 100 times at a lot of tumor cell surface specificity overexpressions, and its ligands, EGF contains three conservative ring texturees, wherein the 3rd ring is and the position of EGF receptors bind to be called EGF acceptor interference sequence again.

Therefore, we have made up people EGF-loop3-IL18 (hereinafter to be referred as fusion gene recombinant human EGF-IL18), at expression in escherichia coli recombinant human EGF-IL18 fusion rotein.This fusion rotein can be with EGF acceptor interference sequence as targeting sequencing, both can strengthen the affinity of cytokine to tumour cell, can disturb the stimulatory effect of EGF again to tumour cell, can be used to simultaneously to strengthen the sequence of the tumour cell target of IL18 again, brought into play the biological action of IL18 to a greater extent.So content of the present invention provides a kind of low toxicity target medicine efficiently for the tumour of treatment EGFR high expression level.

We once utilized Bac-to-Bac baculovirus expression system successful expression recombinant human EGF-IL18 fusion gene in the Sf9 insect cell line, obtain the recombinant human EGF-IL18 fusion rotein behind the purifying, and at external preliminary assessment the biological activity (Lv Jianxin of this fusion rotein, Peng Ying, Meng Zhefeng " tumor-targeting transformation and the eukaryotic expression of mutant human IL-18 " heredity, 2005,27 (4)).But because what used at that time is baculovirus expression system, exist that expression amount is not high, complicated operation and the high shortcoming of production cost, therefore can not be used for large-scale production.And we use classical prokaryotic expression system-intestinal bacteria as recombinant human EGF-IL18 Expression of Fusion Protein host in the present invention; can be very easy; cheaply; the fermentative production of rapid large-scale; news speed obtains a large amount of target proteins, for the large-scale production of recombinant human EGF-IL18 fusion rotein is laid a good foundation.

Summary of the invention

The purpose of this invention is to provide a kind of acceptor that has in conjunction with EGF, and can disturb the stimulatory effect of EGF to tumour cell, has simultaneously the active bifunctional fusion proteins of IL18 again, for the tumour for the treatment of the EGFR high expression level provides a kind of new low toxicity target medicine efficiently.

The present invention also provides the structure that comprises people EGF-IL18 fusion gene recombinant chou, and the engineering bacterium fermentation that contains this expression of gene type recombinant chou cultivates, and the more important thing is the technological line of mass preparation, purifying and recombinant protein that recombinant human EGF-IL18 fusion rotein also is provided.

Recombinant human EGF-IL18 fusion rotein of the present invention can be in intestinal bacteria fermentative production; by using ion-exchange on-column refolding and while purifying and gel-filtration two step method; can be very easy; cheaply; rapid large-scale obtain target protein, for the large-scale production of recombinant human EGF-IL18 fusion rotein is laid a good foundation.

Technical scheme of the present invention realizes by following method and step:

1, with RT-PCR amplification mutant IL18 encoding sequence

From healthy blood donor's peripheral blood mononuclear cell (PBMC), extract mRNA, according to the hIL-18cDNA sequences Design primer of delivering, upstream primer P1: ' GACCTTCCAGATCGCTTCC 3 '; Downstream primer P2:5 ' GCTAGTCTTCGTTTTGAACAG 3 ' obtains mutant IL18 gene fragment through PCR reaction amplification, and it is cloned into pUC-mT carrier (being designated as pUC-mT18).

2, make up people EGF-IL18 fusion gene

Design 3 primers, i.e. FUS I, FUS II and P182.Adopt primer bypass method and two-step pcr method gene fusion construct, and people EGF-IL18 fusion gene is connected structure pFUS-EGF-IL18 plasmid (being designated as pFUS) with the pMD18-T carrier.

3, make up the recombinant chou that comprises people EGF-IL18 fusion gene

Design upstream and downstream primer amplification people EGF-IL18 fusion gene respectively, after double digestion reclaims the product fragment, be inserted in the expression vector that same two enzyme enzymes are cut.The recombinant chou that structure comprises people EGF-IL18 fusion gene confirms that through restriction endonuclease spectrum analysis and dna sequence analysis sequence is correct.

4, recombinant chou transformed into escherichia coli Rosetta ^TM(DE3), induce recombinant human EGF-IL18 expressing fusion protein with IPTG.Fusion rotein is present in the engineering bacteria with the inclusion body form, and expression level reaches 30～45%.SDS-PAGE, westernblot, IFN-γ induces experiment, A431 cell surface EGFR competition shows that in conjunction with analyses such as experiments expression product has the ability of inducing human peripheral blood single nucleus cell generation IFN-γ, and can with the EGFR specific combination of cell surface.

5, by fermentation technique amplification engineering bacteria, the broken bacterium in fermentation back, centrifugal collection inclusion body, behind buffered soln Xian Di dissolves inclusion body with urea, ion-exchange on-column refolding and purified fusion protein simultaneously, molecular sieve is further purified fusion rotein.

Description of drawings

The double digestion of Fig. 1: pET32a (+)-EGF-IL18 expression vector is identified, the dna molecular amount Marker of M:1Kb; 1: recombinant expression vector pET32a (+)-EGF-IL18 is with the collection of illustrative plates of Kpn I and Xho I double digestion; 2: the collection of illustrative plates before recombinant expression vector pET32a (+)-EGF-IL18 enzyme is cut

Fig. 2: the SDS-PAGE of the recombinant human EGF-IL18 fusion rotein of expression in escherichia coli, 1: engineering bacteria pET32a (+)-EGF-IL18/Rosetta ^TM(DE3) the full bacterium electrophoretogram before IPTG induces; 2: engineering bacteria pET32a (+)-EGF-IL18/Rosetta ^TM(DE3) the full bacterium electrophoretogram after 37 ℃ of IPTG induce 4 hours; 3: engineering bacteria pET32a (+)-EGF-IL18/Rosetta ^TM(DE3) the ultrasonic supernatant electrophoretogram after 37 ℃ of IPTG induce 4 hours; 4: engineering bacteria pET32a (+)-EGF-IL18/Rosetta ^TM(DE3) the ultrasound precipitation electrophoretogram after 37 ℃ of IPTG induce 4 hours; M: molecular weight of albumen Marker.

Fig. 3: the immunoblotting assay of the recombinant human EGF-IL18 fusion rotein of expression in escherichia coli; 1: engineering bacteria pET32a (+)-EGF-IL18/Rosetta ^TM(DE3) the full bacterium after 37 ℃ of IPTG induce 4 hours; 2: engineering bacteria pET32a (+)-EGF-IL18/Rosetta ^TM(DE3) induce preceding full bacterium; M: molecular weight of albumen Marker.

Fig. 4: SDS-PAGE after reorganization EGF-IL-18 fusion rotein DEAE-52 and the Sephadex G-75 molecular sieve purification; 1:Sephadex G-75 molecular sieve purification rear electrophoresis collection of illustrative plates; 2: the repetitive scrubbing rear electrophoresis collection of illustrative plates of inclusion body; 3,4,5: be DEAE-52 on-column refolding and while purifying electrophoretogram; M: molecular weight of albumen Marker.

Embodiment:

Further describe the present invention by the following examples, and unrestricted the present invention.

Embodiment 1: the acquisition of the gene people EGF-IL18 of coding recombination targent fused protein

(1) acquisition of mutant IL18

Healthy blood donor's venous blood 5mL after the dilution of equivalent physiological saline, carries out density gradient centrifugation with lymphocyte separation medium, collects mononuclearcell.Utilize guanidinium isothiocyanate-phenol chloroform single stage method to extract cell total rna.RT reaction system 20 μ L, getting the total RNA of 1 μ g is template, makes primer with OligdT, carries out according to a conventional method.According to the hIL-18cDNA sequence of delivering, utilize Primer5.0 software design PCR primer.Upstream primer P1:5 ' GACCTTCCAGATCGCTTCC 3 ' downstream primer P2:5 ' GCTAGTCTTCGTTTTGAACAG 3 ' its amplified fragments comprises the coding region of complete hIL-18 cDNA.The PCR reaction conditions is: 95 ℃ of pre-sex change of 5min; 80 ℃ of 2min warm starts; 94 ℃ of 1min, 57 ℃ of 1min, 72 ℃ of 1min, totally 25 circulations; 72 ℃ of 10min extend, and reaction system is 50 μ L, and each composition disposes routinely, and the amplification enzyme of use is high-fidelity Pfu.Purpose fragment with in the 1.0% sepharose recovery PCR product obtains the dna fragmentation about 635bp.The RT-PCR product is connected with the PUCmT carrier with the T4DNA ligase enzyme after freeze-thaw method reclaims purifying, obtains comprising the plasmid pUC-mT18 of mutant IL18.

(2) acquisition of fusion gene EGF-IL18

3 primers have been designed, i.e. FUS I, FUS II and P182.Primer is synthetic by Shanghai Sangon company.Upstream primer FUS I is: 5 ' GGTGGCGGTGGTTCCGGCGGTGGTGGCTCTGGTGGCGGCGGATCTTACTTTGGCAA GC, 3 ' upstream primer FUS II is:

5 ' ATGCGCTGCTCCCATGGCTACACTGGTATTCGTTGCCAAGCAGTAGTTCTCGGTGG CGGTGGTTCC, 3 ' downstream primer P182 is: 5 ' GCTAGTCTTCGTTTTGAACAG 3 '.Adopt two-step pcr method gene fusion construct.Being template with the pUC-mT18 plasmid at first, is primer with FUS I, P182, carries out pcr amplification 520bp gene order according to a conventional method; Being template with this gene order then, is primer with FUS II, P182, carries out pcr amplification once more with Ex Taq PCR test kit, obtains EGF-IL18 fusion gene (the Genebank accession number: AF454397) of 571bp.The PCR product is connected structure pFUS-EGF-IL18 plasmid with the pMD18-T carrier after the 10g/L agarose gel electrophoresis reclaims purifying for the second time.

The dna sequence dna of people EGF-IL18 fusion gene is:

1?atgcgctgct?cccatggcta?cactggtatt?cgttgccaag?cagtagttct?cggtggcggt

61?ggttccggcg?gtggtggctc?tggtggcggc?ggatcttact?ttggcaagct?tgaatctaaa

121?ttatcagtca?taagaaattt?gaataaccaa?gttctcttca?ttgaccaagg?aaatcggcct

181?ctatttgaag?atatgactga?ttctgactgt?agagataatg?caccccggac?catatttatt

241?ataagtatgt?ataaagatag?ccagcctaga?ggtatggctg?taactatctc?tgtgaagtgt

301?gagaaaattt?caactctctc?ctgtgagaac?aaaattattt?cctttaagga?agtgaatcct

361?cctgataaca?tcaaggatac?aaagagtgac?atcatattct?ttcagagaag?tgtcccagga

421?catgataata?agatgcaatt?tgaatcttca?tcatacgaag?gatactttct?aacttgtgaa

481?aaagagagag?acctttttaa?actcattttg?aaaaaagagg?atgaattggg?ggatagatct

541?ataatgttca?ctgttcaaaa?cgaagactag?c

People EGF-IL18 fusion gene amino acid sequence coded is:

1?MRCSHGYTGI?RCQAVVLGGG?GSGGGGSGGG?GSYFGKLESK?LSVIRNLNNQ?VLFIDQGNRP

61?LFEDMTDSDC?RDNAPRTIFI?ISMYKDSQPR?GMAVTISVKC?EKISTLSCEN?KIISFKEVNP

121?PDNIKDTKSD?IIFFQRSVPG?HDNKMQFESS?SYEGYFLTCE?KERDLFKLIL?KKEDELGDRS

181?IMFTVQNED

Embodiment 2: the structure of fusion gene people EGF-IL18 expression type recombinant chou pET32a (+)-EGF-IL18

Design the upstream and downstream primer respectively with amplification EGF-IL-18 full-length gene: p1:5 ' atggtacc gacgacgacgacaagcgctgctcccatg 3 '; P2:5 ' cgc ctcgag ctagtcttcg ttttgaa cagtga 3 ', primer p1 introduces Kpn I restriction enzyme site and enteropeptidase recognition site at 5 ' end, primer p2 introduces Xho I restriction enzyme site at 3 ' end, with pFUS-EGF-IL18 is template, pcr amplification goes out the EGF-IL18 fragment, reclaim rear clone through glue and go into pMD18-T simple, after order-checking is correct, respectively with Kpn I and Xho I double digestion, reclaim the product fragment and be connected to pET32a (+), be configured to recombinant expression vector pET32a (+)-EGF-IL18, its restriction enzyme mapping (see figure 1).

Embodiment 3: expression and the evaluation of recombinant human EGF-IL18 fusion rotein in intestinal bacteria

PET32a (+)-EGF-IL18 is transformed Rosetta ^TM(DE3), be inoculated in 5ml LB substratum (containing 100 μ g/mL penbritins and 34 μ g/mL paraxin) then, 37 ℃ of jolting overnight incubation are by the same nutrient solution of 1% inoculum size renewed vaccination, one pipe 5ml.Be cultured to OD 37 ℃ of following joltings ₆₀₀Be about at 0.6 o'clock, take out one milliliter and put into test tube 1, all the other add final concentrations be 0.4mmol/L IPTG in 37 ℃ induce 4 h after, each takes out one milliliter and puts into

test tube

2 and 3, and 12000g is behind the centrifugal 5min, abandon supernatant, every pipe adds the 20mmol/L Tris-HCl (pH8.0) of 200 μ L, mixing.The thalline of test tube 3 carries out ultrasonication (ultrasonic time 3 seconds, 5 seconds pitch times, power is 400W, 5-10 time altogether, decide on cell concentration), to thalline limpid till, cleer and peaceful precipitation in minute centrifugal collection of 12000g * 5 then, precipitation adds the 20mmol/L Tris-HCl (pH8.0) of 200 μ L, mixing.More than each pipe full bacterium of extracting, go up cleer and peaceful precipitation, add sample-loading buffer (50mmol/L Tris-HCl, pH6.8,100mmol/LDT respectively, 2%SDS, 0.1% tetrabromophenol sulfonphthalein, 10% glycerine), mixing, place 100 ℃ of boiling water baths to keep 5min, 1O000g, centrifugal 3min gets supernatant and carries out polyacrylamide gel electrophoresis (SDS-PAGE) analysis.After target protein matter expression amount dyes by Xylene Brilliant Cyanine G R-250, scanning back Bandscand computed in software expression amount.The expression of recombinant human EGF-IL18 fusion rotein in intestinal bacteria, its SDS-PAGE electrophoresis (see figure 2).

Immunoblotting assay: sample carries out electrophoresis with 12%SDS-PAGE, shifted 30 minutes with 380 milliamperes then, albumen is transferred on the nitrocellulose filter, film is with confining liquid (PBS, pH7.5, contain 5% skim-milk and 0.5%Tween-20) after 4 ℃ of sealings are spent the night, adding is with the mouse-anti human il-18 monoclonal antibody of confining liquid dilution (1: 1000), in room temperature incubation 2h, add the HRP-sheep anti-mouse igg of dilution (1: 1000) in room temperature incubation 2h after washing film, developing the color with ECL luminescence reagent box in flush away two anti-backs, develops after the exposure of X-ray sheet, photographic fixing, its westernblot is (see figure 3) as a result.

Embodiment 4: the purifying of the fermentation test of engineering bacteria and recombinant human EGF-IL18 fusion rotein

(1) fermentation test

Engineering bacteria pET32a (+)-EGF-IL18/Rosetta ^TM(DE3) be inoculated in 5.0ml LB substratum (containing 100 μ g/mL penbritins and 34 μ g/mL paraxin), 37 ℃ of jolting overnight incubation are re-seeded into by 2% inoculum size in the 500ml triangular flask of same nutrient solution, are cultured to OD 37 ℃ of following joltings ₆₀₀Be about at 1.0～3.0 o'clock, 10 liters of fermentor tanks that are inoculated in same nutrient solution by 3～5% inoculum sizes ferment.Fermentation parameter is: 30 ℃ of temperature, oxygen capacity is controlled at 35 ± 5%, pH=6.86, stirring velocity and D0 interlock.

(2) preparation of inclusion body

Washing bacterium: 8000g * 15 minute centrifugal collection bacterium, the wet thallus of weighing.With 20mmol/L Tris-HCl (pH8.0) washing thalline, stirred evenly 8000g, centrifugal 15 minutes collection thalline on the agitator 30 minutes.The damping fluid usage ratio is 10ml～50ml damping fluid/g wet thallus.

Broken bacterium: with 20mmol/L Tris-HCl (pH8.0, contain 1.0mmol/L proteinase inhibitor PMSF and 10mmol/L NaCl) resuspended thalline, adding N,O-Diacetylmuramidase to final concentration behind the mixing is 0.2mg/ml, stirring at room adds Triton X-100 after 30 minutes be 0.5% to final concentration, and ice bath is placed and to be got thickness to solution becomes in 15 minutes.

Supersound process: ultrasonication thalline (ultrasonic time 3 seconds, 5 seconds pitch times, power was 400W, totally 30 minutes, decided on cell concentration), to thalline no longer till the thickness.8000g * 15 minute centrifugal collecting precipitation then.Aforesaid operations should carry out in frozen water, and for preventing charing, ultrasonic power is unsuitable excessive, carries out in glass beaker better, and ultrasonic probe gos deep into liquid level greater than 3 centimetres, and is good apart from cup 2 centimetres of positions, the end.

(3) preliminary purification of inclusion body

With the 20mmol/L Tris-HCl (pH8.0 of the ultrasound precipitation in (2) step with 10 times of volumes, contain 1%Triton X-100,2mol/L urea and 0.5mol/L NaCl) washing, after room temperature is stirred 15min, 2000g, centrifugal 10min, precipitation is washed 1 time more in the same way, uses 20mmol/L Tris-HCl (pH 8.0) damping fluid washing 1 time at last.

(4) dissolving of inclusion body:

Gained in (3) step is precipitated with 20mmol/L Tris-HCl (pH8.0, contain 1.0mmol/L PMSF, 8mol/L urea, 10mmol/L beta-mercaptoethanol and 10mmol/L NaCl) stirring at room dissolving 2h, centrifugal collection supernatant obtains the inclusion body people EGF-IL-18 of preliminary purification.

(5) on-column refolding of target protein and purifying simultaneously

Target protein DEAE-52 on-column refolding and purifying simultaneously: with the inclusion body people EGF-IL-18 of preliminary purification after 0.45 μ m filter filters, on the sample through 20mmol/L Tris-HCl (pH8.0, contain 8mol/L urea and 10mmol/L NaCl) damping fluid equilibrated DEAE-52 post (2.6*60mm), wash 5 column volumes, (pH8.0 contains 8mol/L urea with the 20mmol/LTris-HCl damping fluid of 5 column volumes then, 10mmol/L NaCl, 0.1mmol/L PMSF, 1mM GSH, 0.2mM GSSH) reduce urea concentration 2M (flow velocity 0.5mL/min by linear gradient, cumulative volume 300mL) make people EGF-IL-18 at on-column refolding, last with 10mmol/L～1.0mmol/L NaCl linear gradient elution albumen of renaturation.The fraction collection elution peak, SDS-PAGE analyzes renaturation product, collects target protein.

Sephadex G-75 is further purified target protein: with on the target protein of DEAE-52 on-column refolding purifying gained through 20mmol/L Tris-HCl (pH8.0, contain 150mmol/L NaCl) damping fluid equilibrated Sephadex G-75, the fraction collection elution peak obtains target protein.

Recombinant human EGF-IL18 fusion rotein is through repetitive scrubbing, DEAE-52 on-column refolding and while purifying, the Sephadex G-75 molecular sieve three-step approach purifying of inclusion body, its SDS-PAGE electrophoresis (see figure 4).

(6) the enzyme trimscript is signed albumen

The target protein of gained in (5) step is added Enterokinase, make it to cut Trx and histidine-tagged.Enzyme is cut sample 20mmol/L Tris-HCl (pH8.0 contains 150mmol/L NaCl) damping fluid equilibrated Sephadex G-75 post on the product, flow velocity 0.5mL/min wash-out target protein, and fraction collection obtains activated recombinant human EGF-IL18 fusion rotein.

Claims

1, a kind of method that is used to prepare recombinant human EGF-IL18 fusion rotein is characterized in that adopting the following step:

(1), and utilize 15 to meet peptide GGGGSGGGGSGGGGS and connect into the fusion rotein encoding gene with pcr amplification EGF the 3rd ring plate section and IL18 mature peptide mutant gene fragment;

(2) clone's EGF the 3rd ring plate section and IL18 mature peptide mutant fusion gene in expression vector;

(3) use the recombinant vectors transformed into escherichia coli;

(4) fermentation culture engineering bacteria, preparation and purified fusion protein.

2, according to the process of claim 1 wherein that described expression vector is not limited to specific expression vector,, form suitable plasmid of expressing as long as it can be recombinated with described dna fragmentation.

3, according to the method for claim 2, wherein said expression vector is prokaryotic expression carrier pET32a.

4, according to the process of claim 1 wherein that described host bacterium is not limited to any specific host bacterium, as long as it can express described recombinant expression vector.

5, according to the method for claim 4, wherein said host bacterium is intestinal bacteria Rosetta ^TM(DE3).

6, method according to claim 1, wherein said purification of Recombinant fusion rotein is that engineering bacterium fermentation is after ion-exchange on-column refolding and while purifying, the gel-filtration two step method, it is characterized by: with (pH 8.0 through 20mmol/L Tris-HCl on the recombinant human EGF-IL18 fusion rotein of preliminary purification, contain 8mol/L urea and 10mmol/L NaCl) damping fluid equilibrated DEAE-52 post, wash 3-5 column volume, (pH 8.0 contains 8mol/L urea with the 20mmol/L Tris-HCl damping fluid of 3-5 column volume then, 10mmol/L NaCl, 0.1mmol/L PMSF, 1mM GSH, make recombinant human EGF-IL18 fusion rotein at on-column refolding 0.2mM GSSH) reduce urea concentration 2M by linear gradient, last albumen with NaCl linear gradient elution renaturation, the target protein that fraction collection obtains; Further with the ion-exchange on-column refolding and simultaneously on the recombinant human EGF-IL18 fusion rotein that obtains of purifying sample (pH 8.0 with 20mmol/L Tris-HCl, contain 150mmol/L NaCl) damping fluid equilibrated Sephadex G-75 post, fraction collection obtains recombinant human EGF-IL18 fusion rotein.