CN102936604A - Human hcrcn81 pronucleus recombinant plasmid, protein and rabbit anti-human polyclonal antibody expressed by same and application - Google Patents
Human hcrcn81 pronucleus recombinant plasmid, protein and rabbit anti-human polyclonal antibody expressed by same and application Download PDFInfo
- Publication number
- CN102936604A CN102936604A CN2012104458626A CN201210445862A CN102936604A CN 102936604 A CN102936604 A CN 102936604A CN 2012104458626 A CN2012104458626 A CN 2012104458626A CN 201210445862 A CN201210445862 A CN 201210445862A CN 102936604 A CN102936604 A CN 102936604A
- Authority
- CN
- China
- Prior art keywords
- hcrcn81
- human
- protein
- rabbit
- polyclonal antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention provides a human hcrcn81 pronucleus recombinant plasmid constructed by means of a genetic engineering technology. The pronucleus recombinant plasmid is transferred into engineering bacteria to induce and express human hcrcn81 protein and extract and purify an expressed product. The human HCRCN81 protein is used for immunizing New Zealand big-ear white rabbits and preparing a rabbit anti-human polyclonal antibody (Anti-HCRCN81). An experiment shows that the rabbit anti-human polyclonal antibody (Anti-HCRCN81) can detect expressions of cancer cells and HCRCN81 protein in human tissues and is a useful tool for studying the role and the status of the hcrcn81 protein in human cancer incidence and development.
Description
Technical field
The present invention relates to a kind of Prokaryotic Recombinant Plasmids and expressed albumen and the anti-human polyclonal antibody of rabbit and purposes thereof.
Background technology
In recent years, malignant tumour becomes increasingly conspicuous to the mankind's threat, and tumour has become one of dead common cause, is having a strong impact on the mankind's health.Cancer is a kind of common malignant tumour, in its generation and evolution, have been found that the activation (as survivin, c-myc, Bcl-2 etc.) of some oncogene and the inactivation (as p53, DCC, nm23, APC, PTEN, DPC4 etc.) of cancer suppressor gene, the generation of described oncogene and cancer suppressor gene and human cancer, development have substantial connection, but also have so far many oncogene, cancer suppressor gene not yet to find.
People hcrcn81 gene is registered at GenBank, number of registration NM_001013649.3, quantitative fluorescence PCR shows, the expression of the mRNA of people hcrcn81 gene is lowered in knot rectal adenocarcinoma tissue, the low expression of NM_001013649.3 in tumor tissues may cause the low expression of corresponding protein in malignant cell, thereby cause the activation of Related oncogene and the inactivation of cancer suppressor gene, hcrcn81 may relevantly with the morbidity of knot rectal adenocarcinoma (be shown in Qin Jiang, Chunle Zhang, Yao Chen. NM_001013649.3 gene is down-regulated in human colorectal adenocarcinoma. Molecular Medicine Reports.2011, 4 (6): 1279-1281).Therefore, be necessary further to study the effect of HCRCN81 protein in the human malignant lesion.
Antibody is in the immunne response to antigenic stimulation, the class glycoprotein that bone-marrow-derived lymphocyte produces.It is can be special with corresponding antigens combination, produce the sphaeroprotein of various physiological effects.Polyclonal antibody is the first step that the mankind on purpose utilize antibody, century-old developing history its application at aspects such as biomedicines is existing.The Anti-TNF-α physical efficiency effectively improves antigen uptake, processing and identification, therefore, is necessary to prepare novel polyclonal antibody, for the function of further studying the hcrcn81 gene provides instrument.
Summary of the invention
The Prokaryotic Recombinant Plasmids, recombinant human HCRCN81 protein and the anti-human polyclonal antibody of rabbit that the purpose of this invention is to provide a kind of people hcrcn81, and prove that the anti-human polyclonal antibody of described rabbit can be used for detecting HCRCN81 protein expression in human cancer cell and people's tissue, the instrument that the effect for research hcrcn81 gene in the human cancer genesis and status provide use.
The nucleotide sequence of people hcrcn81 gene is as described in SEQ ID NO.1 in sequence table.Prokaryotic Recombinant Plasmids of the present invention, gene fragment and Prokaryotic expression vector construction in sequence table in SEQ ID NO.1 form, described gene fragment is the nucleotide sequence of the 73rd to the 573rd in SEQ ID NO.1, and described gene fragment forward inserts prokaryotic expression carrier.
Prokaryotic Recombinant Plasmids of the present invention, its prokaryotic expression carrier is the pET pUC pUC, comprises pET-28a, pET-30a, pET-32a or pET32a (+).
Recombinant human HCRCN81 protein of the present invention, expressed and formed by above-mentioned Prokaryotic Recombinant Plasmids, and its aminoacid sequence is as described in SEQ ID NO.2 in sequence table.
The anti-human polyclonal antibody of rabbit of the present invention, obtain by after the immune New Zealand of above-mentioned recombinant human HCRCN81 protein large ear rabbit, collecting the antiserum(antisera) purifying, and its preparation method comprises the following steps successively:
(1) react by RT-PCR, obtain people HCRCN81 protein coding gene, i.e. the nucleotide sequence of the 73rd to the 573rd in sequence table SEQ ID NO.1;
(2) the people HCRCN81 protein coding gene of step (1) amplification is inserted into to the Prokaryotic expression vector construction Prokaryotic Recombinant Plasmids, again described Prokaryotic Recombinant Plasmids is converted in the competence bacterium and is cultivated, then filter out the clone who contains correct Insert Fragment;
(3) utilize pcr amplification and restriction endonuclease map to analyze described Prokaryotic Recombinant Plasmids, and carry out DNA sequence analysis;
(4) in the Prokaryotic Recombinant Plasmids Transformation Engineering bacterium that will correctly clone, expressed, the albumen that separation and purification is expressed obtain recombinant human HCRCN81 protein;
(5) adopt SDS-PAGE, mass spectroscopy to identify the exactness of recombinant human HCRCN81 protein;
(6) will after the immune New Zealand of described recombinant human HCRCN81 protein large ear rabbit, collect antiserum(antisera);
(7) adopt the antigen affinity purification method antiserum(antisera) collected from step (6) and obtain the anti-human polyclonal antibody of rabbit (Anti-HCRCN81).
The present invention's rapamycin treatment colon cancer cell, and, to before processing, with the processing expressed total protein of colon cancer cell afterwards, carrying out Western blot test, verify the detection effect of the HCRCN81 albumen that the anti-human polyclonal antibody of described rabbit (Anti-HCRCN81) is expressed colon cancer cell.
The present invention extracts the total protein of Human colorectal carcinoma tissue and normal colorectal carcinoma, and extracted total protein is carried out to Western blot test, verify the detection effect of the anti-human polyclonal antibody of described rabbit (Anti-HCRCN81) expressed HCRCN81 albumen to Human colorectal carcinoma tissue and normal colorectal carcinoma.
Experimental result shows, the anti-human polyclonal antibody of rabbit of the present invention (Anti-HCRCN81) organizes expressed HCRCN81 native protein all to have detection effect to human cancer cell and people, can application aspect preparation detects the detection agent of the expressed protein of hcrcn81 gene in human cancer cell and people's tissue.
The present invention has following beneficial effect:
The present invention has prepared recombinant human HCRCN81 protein first, and provide a kind of novel rabbit anti-human polyclonal antibody, experimental result shows, the anti-human polyclonal antibody of rabbit of the present invention all has detection effect to the expressed HCRCN81 native protein in human cancer cell and people's tissue, thereby contributes to study effect and the status of hcrcn81 gene in the human cancer genesis.
The accompanying drawing explanation
Fig. 1 is the structural representation of prokaryotic expression carrier pET32a (+).
Fig. 2 is the structural representation of the Prokaryotic Recombinant Plasmids pET32a (+)/hcrcn81 of people hcrcn81 of the present invention.
Fig. 3 is the sequencer map of the Prokaryotic Recombinant Plasmids pET32a (+)/hcrcn81 of people hcrcn81 of the present invention.
Fig. 4 is the PCR electrophorogram of the Prokaryotic Recombinant Plasmids pET32a (+)/hcrcn81 of people hcrcn81 of the present invention, M:DM2000 Plus Marker in figure, be followed successively by 8000,5000,3000,2000,1000,750,500,250,100bp from top to bottom.
Fig. 5 is the SDS-PAGE electrophorogram that the Prokaryotic Recombinant Plasmids pET32a (+)/hcrcn81 of people hcrcn81 of the present invention transforms the expressed HCRCN81 albumen of BL21 (DE3) pLysS competence bacterium, in figure, M:PageRuler Unstained Broad Range Protein Ladder (Fermentas), be respectively 250,150,100,70,50,40,30,20,15kD from top to bottom; 1,2:BL21 (DE3) pLysS (pET32a), 0,1mM IPTG respectively induces; 3-6:BL21 (DE3) pLysS (pET32a::hcrcn81) 0,0.01,0.1,1mM IPTG respectively induces.
Fig. 6 is the SDS-PAGE electrophorogram that the Prokaryotic Recombinant Plasmids pET32a (+)/hcrcn81 of people hcrcn81 of the present invention transforms the expressed HCRCN81 albumen of the ultrasonic rear cleer and peaceful precipitation of BL21 (DE3) pLysS competence bacterium, in figure, M:PageRuler Unstained Broad Range Protein Ladder (Fermentas), be respectively 250,150,100,70,50,40,30,20,15kD from top to bottom; 1,2:0mM IPTG induces cleer and peaceful precipitation; 3,4:0.1mM IPTG induces cleer and peaceful precipitation.
Fig. 7 is the SDS-PAGE electrophorogram of the recombinant human HCRCN81 protein after purifying, in figure, M:PageRuler Unstained Broad Range Protein Ladder (Fermentas), be respectively 250,150,100,70,50,40,30,20,15,10kD from top to bottom; 1: stream is worn liquid; 2-7: be respectively 10,20,50,100,250,500mM imidazoles elutriant.
Fig. 8 is SDS-PAGE electrophorogram after recombinant human HCRCN81 protein electroelution, in figure, M:PageRuler Unstained Broad Range Protein Ladder (Fermentas), be respectively 250,150,100,70,50,40,30,20,15kD from top to bottom; 1: electroelution albumen; 2: concentrated filtrate; 3:1mg/ml BSA standard substance.
Fig. 9 is the mass spectroscopy chart of recombinant protein HCRCN81.
Figure 10 is that the SDS-PAGE after the anti-human polyclonal antibody of rabbit of the present invention (Anti-HCRCN81) purifying detects figure, and in figure, 1 is albumen Marker; 2 is the anti-human polyclonal antibody of CWRA320 antigen affinity purification rabbit; 3 is the anti-human polyclonal antibody of CWRA321 antigen affinity purification rabbit.
The figure of Figure 11 (a) is used the anti-human polyclonal antibody of rabbit (Anti-HCRCN81), detect the protein expression figure of HCRCN81 in colon glandular cell strain SW480 by Western blot method, figure (b) is used the anti-human polyclonal antibody of rabbit (Anti-HCRCN81), detects the protein expression figure of HCRCN81 in colon glandular cell strain LoVo by Western blot method; In figure, SDS-PAGE shows that HCRCN81 albumen is at colon glandular cell strain SW480
-RAPA, SW480
-DMSOAnd LoVo
-RAPA, LoVo
-DMSOIn electrophoretic band, SW480
-RAPARepresentative is through the colon glandular cell strain SW480 of rapamycin treatment, SW480
-DMSOThe colon glandular cell strain SW480 that representative is processed through DMSO, LoVo
-RAPARepresentative is through the colon glandular cell strain LoVo of rapamycin treatment, LoVo
-DMSOThe colon glandular cell strain LoVo that representative is processed through DMSO, β-actin is internal reference albumen.
Figure 12 is the protein expression figure that uses the anti-human polyclonal antibody of rabbit (Anti-HCRCN81), detects HCRCN81 in colon colon cancer tissue and healthy tissues by Western blot method, wherein, the detection figure that figure (a) is the first patient, in figure, the tumor tissues sample that T1 is first patient's rectum cancer, N1 is the other 5cm healthy tissues of first patient's tumour sample; The detection figure that figure (b) is the second patient, the tumor tissues sample that T2 is second patient's rectum cancer, N2 is the other 5cm healthy tissues of second patient's tumour sample.
Embodiment
Embodiment 1: the structure of the Prokaryotic Recombinant Plasmids of people hcrcn81
According to aim sequence (nucleotide sequence of the 73rd to the 573rd in sequence table SEQ ID NO.1), design full gene synthetic primer, hcrcn81-1F in table 1, hcrcn81-3F, hcrcn81-5F, hcrcn81-7F, hcrcn81-9F, hcrcn81-11F, hcrcn81-13F is the positive-sense strand primer, hcrcn81-2R in table 1, hcrcn81-4R, hcrcn81-6R, hcrcn81-8R, hcrcn81-10R, hcrcn81-12R, hcrcn81-14R is the antisense strand primer, upstream primer hcrcn81-1F adds EcoRI restriction enzyme site (line place), downstream primer hcrcn81-14R adds the HindIII restriction enzyme site.
Table 1: full gene synthetic primer sequence
| The primer title | Sequence (5 '--3 ') |
| hcrcn81-1F | CCG GAATTCATGGAGGCGGGGCCGCATCCCCGGCCGGGGCACTGCTG |
| hcrcn81-3F | CGGCTGGACATGAACCACGGCTTCGTGCACCATATCCGACGGAACCAGATCGCTCGGGA |
| hcrcn81-5F | GAAGCAGGCGGCCAAGGAGAAGGTGAGGAGGCGGCACACGCCCGCGCCGAC |
| hcrcn81-7F | GCAGGTGTACCTGCCGCGACACCGAGATGTCTCTGCCCACCCACGCAACCCAGACTA |
| hcrcn81-9F | AGCAGTAGTGGAGGCTCTGAGCTGGAGCCTTCTGGCCATCAGCTCTTCTGCTTAGAATA |
| hcrcn81-11F | GGTCACATCAGTTATCGTCTATCAGGGTGATGACCCAGGAAAGGTGAGTGAGAAGG |
| hcrcn81-13F | CGCCTCTGGATCCACCCATGCGAGAAGCCCTCAAGTTGCGTATCCAGGAGGA |
| hcrcn81-2R | CGTGGTTCATGTCCAGCCGCCCCCCAGGCTTGCAGCAGTGCCCCGGCCGGGGATGCGGC |
| hcrcn81-4R | CTTCTCCTTGGCCGCCTGCTTCACCTTCTTGTCATAGTCGTCCCGAGCGATCTGGTTCC |
| hcrcn81-6R | TCGCGGCAGGTACACCTGCAGGTCTGGCTTGCGGGGCCGCGTCGGCGCGGGCGTGTG |
| hcrcn81-8R | CTCAGAGCCTCCACTACTGCTGCTTTCACCGGACTCTTCATAGTCTGGGTTGCGTGGG |
| hcrcn81-10R | GACGATAACTGATGTGACCTCTCCACTGTCTGCCTCGTATTCTAAGCAGAAGAGCT |
| hcrcn81-12R | ATGGGTGGATCCAGAGGCGTGTGTGCCGACACCTTCTCACTCACCTTTCC |
| hcrcn81-14R | CCC AAGCTTTTATCAGTGTTGGCTCTGGCGCTTTGCAATCTCCTCCTGGATACGCAACT |
By first group of primer: hcrcn81-1F, hcrcn81-2R, hcrcn81-3F, hcrcn81-4R, hcrcn81-5F, hcrcn81-6R, hcrcn81-7F, hcrcn81-8R mixes, and pcr amplification obtains hcrcn81 fragment 1, and the PCR reaction system is in Table 2; By second group of primer: hcrcn81-9F, hcrcn81-10R, hcrcn81-11F, hcrcn81-12R, hcrcn81-13F, hcrcn81-14R mixes, and pcr amplification obtains hcrcn81 fragment 2, and the PCR reaction system is in Table 3.
Table 2:PCR reaction system 1
| |
Volume (μ l) |
| 10×Es?Taq? |
5 |
| dNTP(2.5mM?each) | 4 |
| MgCl 2?(25mM) | 3 |
| Primer (1F, 2R, 3F, 4R, 5F, 6R, each 1 μ l of 7F and 8R) | 8 |
| Es?Taq?DNA?Polymerase | 0.3 |
| Water | 29.7 |
| Altogether | 50 |
Table 3:PCR reaction system 2
| |
Volume (μ l) |
| 10×Es?Taq? |
5 |
| dNTP(2.5mM?each) | 4 |
| MgCl 2?(25mM) | 3 |
| Primer (9F, 10R, 11F, 12R, 13F, each 1 μ l of 14R) | 6 |
| Es?Taq?DNA?Polymerase | 0.3 |
| Water | 31.7 |
| Altogether | 50 |
Amplification condition: 94
oC 10min denaturation; 94
oC 30S, 54
oC 30S, 72
oC 30S is totally 30 circulations; Last 72
oC extends 10min again.After completion of the reaction, with 1.5% agarose gel electrophoresis, check amplification, cut hcrcn81 fragment 1 and hcrcn81 fragment 2 under ultraviolet lamp, reclaim test kit (purchased from Promega company) with DNA gel and reclaim the purpose fragment, step is undertaken by the test kit specification sheets.Using the hcrcn81 fragment 1 that reclaims and hcrcn81 fragment 2 as template, take hcrcn81-1F/14R as primer, pcr amplification purpose fragment hcrcn81.
Amplification condition: 94
oC 10min denaturation; 94
oC 30S, 55
oC 30S, 72
oC 30S is totally 30 circulations; Last 72
oC extends 10min.After completion of the reaction, with 1% agarose gel electrophoresis, check amplification, cut target DNA fragment hcrcn81 under ultraviolet lamp, reclaim test kit with DNA gel and reclaim the purpose fragment.The purpose fragment hcrcn81 reclaimed carries out double digestion, 37 with EcoRI/HindIII
oThe C enzyme is cut 2h, after completion of the reaction, with 1% agarose gel electrophoresis inspection enzyme, cuts result, reclaims test kit with DNA gel and reclaims the purpose fragment.
Plasmid pUC18 (purchased from sky, Beijing bounties company) forms linear pUC18 with EcoRI/ HindIII double digestion, and linear pUC18 is connected to (22 with the purpose fragment hcrcn81 after above-mentioned EcoRI/ HindIII double digestion
oC connects 2h), connecting fluid 10 μ l are transformed to DH5 α, shake bacterium, extract plasmid.EcoRI/ Hind double digestion prokaryotic expression carrier pET32a(is shown in Fig. 1, purchased from sky, Beijing bounties company), make its linearizing, purpose fragment hcrcn81 after double digestion and the prokaryotic expression carrier pET32a after double digestion are connected to form to the Prokaryotic Recombinant Plasmids pET32a (+) of people hcrcn81/hcrcn81(and see Fig. 2), by connecting fluid 10 μ l transformed competence colibacillus bacillus coli DH 5 alphas, next day, the single bacterium colony of picking white, carry out bacterium colony PCR, bacterium colony PCR system is in Table 4.
Table 4: bacterium colony PCR system
| Composition | Volume (μ l) |
| 2×Taq?MasterMix | 10 |
| hcrcn81-1F（10μM） | 0.5 |
| hcrcn81-14R（10μM） | 0.5 |
| Distilled water | 9 |
| Altogether | 20 |
Amplification condition: 94
oC 10min denaturation; 94
oC 30S, 55
oC 30S, 72
oC 30S is totally 30 circulations; Last 72
oC extends 10min again.After reaction finishes, with 1% agarose gel electrophoresis, detect, detected result is shown in Fig. 4.Bacterium colony PCR identifies that correct bacterial strain extracts recombinant plasmid pET32a/hcrcn81 and carries out sequencing, and sequencing result is shown in Fig. 3.With NCBI-Blast, sequencing result is carried out to sequence alignment, comparison result shows, the fragment and the aim sequence that insert fit like a glove.
Embodiment 2: the preparation of recombinant human HCRCN81 protein
The recombinant plasmid pET32a/hcrcn81 that checks order correct transforms BL21 (DE3) pLysS competence bacterium, construction expression bacterial strain BL21 (DE3) pLysS (pET32a/hcrcn81).Expression strain BL21 (DE3) pLysS (pET32a::hcrcn81) built is inoculated in LB substratum (containing 100 μ g/ml Amp), and 37 ℃ of shaking culture, spend the night (12 hours) activate.Next day, in the 1%(percent by volume) ratio transfers in fresh LB substratum (containing 100 μ g/ml Amp), and 37 ℃, 250 rpm shaking culture, be about at 0.6 o'clock to OD600, adds that final concentration is respectively 0,0.01mM, 0.1mM, 1mM IPTG; 37 ℃, 250rpm are induced 4 h.Get 1ml bacterium liquid, the centrifugal 1min of 8000rpm collects thalline, abandon supernatant, add 40 μ 11 * PBS suspension thalline, 5 * SDS the sample-loading buffer that adds 10 μ 1, mix latter 100 ℃ and boil 10 min, centrifugal 10 min of 12000 rpm, get its supernatant liquor and carry out the SDS-PAGE electrophoresis detection, detected result is shown in Fig. 5.The centrifugal collection of 2mL bacterium liquid that to induce by the method for foregoing description equally, add 500 μ l 1 * PBS suspension thalline, with the broken bacterium liquid of the Probe Ultrasonic Searching of Ultrasonic Cell Disruptor VCX130PB (U.S. SONICS) diameter 2mm, until bacterium liquid is limpid.Get 40 μ l in 4 ℃ of centrifugal 10 min, supernatant is drawn in an other pipe, 40 μ l PBS Eddy diffusions for precipitation, then go up in cleer and peaceful precipitation and add respectively 10 μ l 5 * SDS sample-loading buffers, boiling water boils 10min, get supernatant liquor after centrifugal and carry out the SDS-PAGE electrophoresis detection, detected result is shown in Fig. 6.Detected result shows, in the upper cleer and peaceful precipitation of expression strain BL21 (DE3) pLysS (pET32a/hcrcn81) built, all contains recombinant human HCRCN81 protein.
Expression strain BL21 (DE3) pLysS (pET32a/Hcrcn81) is in the 1%(percent by volume) ratio transfers in fresh LB substratum (containing 100 μ g/ml Amp), 37 ℃, 250 rpm shaking culture, be about at 0.6 o'clock to OD600, the IPTG that the interpolation final concentration is 0.1mM, 37 ℃, 250rpm induces 4h.Bacterium after collection is induced, ultrasonication, collect respectively supernatant and precipitation.The direct Ni post of crossing of ultrasonic rear supernatant carries out protein purification, process is shown in Ni-Agarose His label protein purification kit (being the century bio tech ltd purchased from health) operation instruction, the imidazoles elutriant of different concns carries out the SDS-PAGE electrophoresis detection, result shows 100mM, in the imidazoles elutriant of 250mM, target protein concentration is higher, but assorted band (see figure 7) is arranged.After 37 ℃ of expression strain BL21 (DE3) pLysS (pET32a::hcrcn81) induce the ultrasonic rear supernatant of thalline to cross the Ni column purification, albumen carries out the SDS-PAGE electrophoresis detection, the purpose band carries out electroelution after cutting glue, carry out the SDS-PAGE electrophoresis detection after ultrafiltration and concentration, band (see figure 8) consistent with expected results, recombinant human HCRCN81 albumen after purifying carries out mass-spectrometer measurement, measuring result is shown in Fig. 9, and after race glue dyeing-decolorzing, cutting target protein band send immunity.
Embodiment 3: the preparation of the anti-human polyclonal antibody of rabbit (Anti-HCRCN81)
3.1. antiserum(antisera) preparation
3.1.1 antiserum titre detection method: indirect ELISA
Indirect ELISA test experience step (this is tested involved indirect ELISA and all carries out in the steps below):
1) coated: the coating protein of each concentration 2ug/ml is added in enzyme plate, 100ul/ hole, 4 ℃ of refrigerator overnight;
2) washing: PBST washing (3 times, each vibration plate 5sec, below the step wash conditions all herewith);
3) sealing: the 5%(mass concentration) skimmed milk sealing, 300 μ l/ holes, 37 ℃, sealing 2h;
4) washing: PBST washing;
5) hatch primary antibodie: antiserum(antisera) to be detected or preimmune serum are added in enzyme plate after designing dilution, and the 100ul/ hole,, hatch 1h by 37 ℃;
6) washing: PBST washing;
7) hatching two resists: the goat anti-rabbit igg of HRP mark adds enzyme plate after diluting by suitable proportion, and the 100ul/ hole,, hatch 40min by 37 ℃;
8) washing: PBST washing;
9) TMB colour developing: add the tmb substrate colour developing working fluid of now joining, 100ul/ hole, colour developing 10min;
10) color development stopping: add 2 M H
2SO
4Color development stopping, the 50ul/ hole;
11) survey the OD value: microplate reader is surveyed the OD value of 450nm wavelength.
3.1.2. preimmune serum background detection
Two of New Zealand's large ear rabbits (purchased from Haidian District, Beijing City prosperous laboratory animal cultivation factory), body weight 2.0kg/ only.
Every New Zealand's large ear rabbit auricular vein is got blood 0.5 ~ 1ml, separates antiserum(antisera).
Indirect ELISA detects the preimmune serum background:
1) hatch primary antibodie: preimmune serum
Primary antibodie Dilution ratio: 1:1000,1:3000,1:9000,1:27000,1:81000,1:243000,1:729000.
Blank: PBS.
2) hatching two resists: the goat anti-rabbit igg of HRP mark.
Two anti-Dilution ratio: 1:10000.
3.1.3. immunologic process
Head exempts from (the 0th day): only, antigenic solution adds subcutaneous multi-point injection (6 point) after the emulsification of equal-volume Freund's complete adjuvant to 600 μ g/.
Two exempt from (the 21st day): only, antigenic solution adds subcutaneous multi-point injection (4 point) after the emulsification of equal-volume Freund's incomplete adjuvant to 400 μ g/.
Three exempt from (the 35th day): only, antigenic solution adds subcutaneous multi-point injection (4 point) after the emulsification of equal-volume Freund's incomplete adjuvant to 400 μ g/.
Four exempt from (the 49th day): only, antigenic solution adds subcutaneous multi-point injection (4 point) after the emulsification of equal-volume Freund's incomplete adjuvant to 400 μ g/.
3.1.4. after immunity, serum titer is measured
After immunity 10 days, every rabbit auricular vein is got blood 0.5 ~ 1ml, separates antiserum(antisera), and indirect ELISA detects the rear serum titer of immunity.Tiring touches the mark adopts whole blood (method with cardiac puncture is adopted whole blood) in the 2nd day after detection is tired, and separates antiserum(antisera).
1) hatch primary antibodie: antiserum(antisera)
Primary antibodie Dilution ratio: 1:1000,1:3000,1:9000,1:27000,1:81000,1:243000,1:729000.
Negative control: preimmune serum 1:10000 doubly dilutes.
Blank 2:PBS.
2) hatching two resists: the goat anti-rabbit igg of HRP mark.
Two anti-Dilution ratio: 1:10000.
3.2. obtain the anti-human polyclonal antibody of rabbit from antiserum(antisera) with the antigen affinity purification method
3.2.1. antigen affinity column preparation
1) activation: with activating damping fluid by cyanogen bromide-activated sepharose 4B(CnBr-activated Sepharose 4B) (purchased from Pharmaci company) fully activation;
2) balance: the CnBr-activated Sepharose 4B gel of Coupling Buffer balance activation is steady to baseline;
3) hanging column: antigen is added in the above-mentioned gel that balance is good to the normal temperature revolving reaction 2 hours;
4) sealing: add sealing damping fluid normal temperature revolving reaction 1 hour, sealing residue activating group
5) wash post: alternately wash the antigen affinity column prepared with Washing Buffer1# and Washing Buffer2#
3.2.2. specific antibody purifying
1) balance: steady to baseline with Binding Buffer balance antigen affinity column;
2) loading: by New Zealand's large ear rabbit antiserum(antisera) load upper prop, collect stream and wear liquid; Stream is worn to liquid upper prop again, continue balance steady to baseline
3) wash-out: add Elution Buffer wash-out, collect elution peak, SDS-PAGE detects purity.
4) use 0.01M, the elution peak that pH7.2 PBS dialysis is collected, make the antibody after purifying be kept at 0.01M, in pH7.2 PBS environment.
5) antibody after concentrated dialysis.
6) measure specific antibody concentration with protein quantification detector (AmershamBiosciences company): the anti-human polyclonal antibody of the rabbit obtained after the antigen affinity purification, measure antibody concentration by the protein quantification detector, detected result is as shown in table 5.
Table 5: the anti-human Anti-TNF-α bulk concentration of purified rabbit
3.2.3. the anti-human polyclonal antibody purity of rabbit after purifying
Detect the anti-human polyclonal antibody purity of rabbit after purifying by SDS-PAGE, applied sample amount is 8ug.As shown in figure 10, Figure 10 shows detected result, and the purity of the anti-human polyclonal antibody of rabbit that obtains meets the requirements.
3.2.4. after the detection purifying, the anti-human polyclonal antibody of rabbit is tired
After detecting purifying by indirect elisa method, the anti-human polyclonal antibody of rabbit is tired, and concrete steps are as follows:
1) coated: with the carbonate buffer solution envelope antigen of concentration 2 μ g/ml, pH9.6,100 μ l/ holes, 4 ℃ are spent the night;
2) washing: PBST washing, with automatic washer carry out (parameter setting: 3 times, each vibration plate 5sec, below the step wash conditions all herewith);
3) sealing: the 5%(mass percent) skim-milk sealing, 300ul/ hole, 37 ℃, incubation 2h;
4) washing: PBST washing;
5) hatch primary antibodie: primary antibodie Dilution ratio 1000ng/ml, 333ng/ml, 111ng/ml, 33ng/ml, 11ng/ml, 3.3ng/ml, 1.1ng/ml; Blank: PBS100ul/ hole, 37 ℃, incubation 1h;
6) washing: PBST washing;
7) hatching two resists: goat anti-rabbit igg (H+L), HRP, Dilution ratio: 1 ︰ 10000,100 μ l/ holes, 37 ℃, incubation 40min;
8) washing: PBST washing;
9) TMB colour developing: add the tmb substrate colour developing working fluid of now joining, 100ul/ hole, colour developing 5min;
10) color development stopping: add 2M H
2SO
4Color development stopping, 50 μ l/ holes;
11) survey the OD value: microplate reader is surveyed the OD value of 450nm wavelength.
The anti-human polyclonal antibody of CWRA320 antigen affinity purification rabbit, detection sensitivity 11ng/ml.The anti-human polyclonal antibody of CWRA321 antigen affinity purification rabbit, detection sensitivity 11ng/ml, detected result is in Table 6.
Antibody titer after table 6 indirect ELISA detectable antigens affinity purification
Embodiment 4: the anti-human polyclonal antibody of rabbit (Anti-HCRCN81) determination of activity
4.1. the cultivation of cell
With containing the 10%(mass concentration) foetal calf serum, 100U/mL penicillin, the DMEM nutrient solution of 100U/mL Streptomycin sulphate is in 37 ℃, 5% CO
2Cultivator colorectal cancer cell LoVo and SW480 in incubator.When Growth of Cells arrives the confluent culture base, use the 0.25%(mass concentration) trysinization the cultivation of going down to posterity, the phase cell of taking the logarithm after 24h is for experiment.Rapamycin dissolves with DMSO, and the solution that is mixed with 5mg/mL is stored in-20 ℃, and facing the used time, to take DMEM nutrient solution dilution be desired concn.Experiment is divided into rapamycin intervention group and control group.Take the logarithm after phase cell routine digestion, with containing the 10%(mass concentration) the DMEM nutrient solution of foetal calf serum is inoculated in 35cm after suspending
2Culturing bottle, every bottle adds 5mL concentration is 1 * 10
6The cell suspension of/mL.Abandon supernatant after hatching 24h, add rapamycin, concentration is 10 μ M, separately establishes the DMSO control group, and wherein the DMSO final concentration is 0.1%.
4.2. the collection of tissue sample
Agreement through the approval of Ethics Committee of Sichuan University and patient, collect knot rectal adenocarcinoma tissue (diagnosis of knot rectal adenocarcinoma is all through proved by pathology) and the normal colorectal carcinoma of own control (more than borderline tumor 5cm, pathologic finding is not found cancer cells) sample 2 examples in Huaxi Hospital Attached to Sichuan Univ and Chengdu No. 3 People's Hospital.Be transferred in liquid nitrogen and preserve immediately after collection organization's sample.
4.3．Western?blot
After rapamycin intervention group and cellular control unit are cultivated 48h, collecting cell, 3mL4 ℃ of precooling PBS washs 2 times, get respectively knot rectal adenocarcinoma tissue and the normal colorectal carcinoma 50 ~ 100mg of own control, in liquid nitrogen, grind evenly, transfer in the EP pipe of 1.5ml, by the 1mL lysate, add 10 μ LPMSF(100nM), shake up and be placed on ice.Add cell protein lysate 400 μ L, standing 30min in ice bath, 4 ℃ of centrifugal 10min of 12000r/min, collect supernatant liquor, and the BCA method is measured protein content ,-80 ℃ of preservations.
To with 2 * sample-loading buffer, with the 1:1 volume ratio, mix containing equal protein quality sample (30 μ g), 100 ℃ of sex change 5min, after the 12%SDS-PAGE electrophoretic separation, electrotransfer is to nitrocellulose filter, with containing the 5%(mass concentration) the TBST damping fluid room temperature sealing 6～8h of skim-milk, add 4 ℃ of the anti-human polyclonal antibodies of rabbit (being diluted to 1:500) of embodiment 3 preparation to spend the night, add horseradish peroxidase mark mouse-anti rabbit igg antibody (being diluted to 1:3000) incubated at room 2h, adopt ECL chemoluminescence colour developing, utilizing scanning densitometer to detect analyzes, detected result is shown in Figure 11, Figure 12.
4, conclusion
From experimental result, the anti-human polyclonal antibody of rabbit of the present invention (Anti-HCRCN81) is 1:500 to the concentration of the protein detection of colorectal cancer cell hcrcn81 genetic expression, concentration to the protein detection of colorectal carcinoma hcrcn81 genetic expression is 1:500, above-mentioned experimental result shows, the anti-human polyclonal antibody of rabbit of the present invention (Anti-HCRCN81) is expressed and had detection effect the expressed HCRCN81 native protein in human cancer cell and people's tissue.
Claims (6)
1. the Prokaryotic Recombinant Plasmids of a people hcrcn81, it is characterized in that gene fragment and the Prokaryotic expression vector construction in SEQ ID NO.1 forms in sequence table, described gene fragment is the nucleotide sequence of the 73rd to the 573rd in SEQ ID NO.1, and described gene fragment forward inserts prokaryotic expression carrier.
2. the Prokaryotic Recombinant Plasmids of people hcrcn81 according to claim 1, is characterized in that prokaryotic expression carrier is the pET pUC pUC, comprises pET-28a, pET-30a, pET-32a or pET32a (+).
3. a recombinant human HCRCN81 protein, is characterized in that being expressed and being formed by the described Prokaryotic Recombinant Plasmids of claim 1 or 2, and its aminoacid sequence is as described in SEQ ID NO.2 in sequence table.
4. the anti-human polyclonal antibody of rabbit, obtain by after the described recombinant human HCRCN81 protein immunity of claim 3 New Zealand large ear rabbit, collecting the antiserum(antisera) purifying.
5. the anti-human polyclonal antibody of rabbit according to claim 4 is characterized in that the preparation method comprises the following steps successively:
(1) react by RT-PCR, obtain people HCRCN81 protein coding gene, i.e. the nucleotide sequence of the 73rd to the 573rd in sequence table SEQ ID NO.1;
(2) the people HCRCN81 protein coding gene of step (1) amplification is inserted into to the Prokaryotic expression vector construction Prokaryotic Recombinant Plasmids, again described Prokaryotic Recombinant Plasmids is converted in the competence bacterium and is cultivated, then filter out the clone who contains correct Insert Fragment;
(3) utilize pcr amplification and restriction endonuclease map to analyze described Prokaryotic Recombinant Plasmids, and carry out DNA sequence analysis;
(4) Prokaryotic Recombinant Plasmids that will correctly clone is transformed in engineering bacteria is expressed, and the albumen that separation and purification is expressed obtain recombinant human HCRCN81 protein;
(5) adopt SDS-PAGE, mass spectroscopy to identify the exactness of recombinant human HCRCN81 protein;
(6) will after the immune New Zealand of described recombinant human HCRCN81 protein large ear rabbit, collect antiserum(antisera);
(7) adopt the antigen affinity purification method antiserum(antisera) collected from step (6) and obtain the anti-human polyclonal antibody of rabbit.
6. the application of the anti-human polyclonal antibody of the described rabbit of claim 4 aspect preparation detects the detection agent of the expressed protein of hcrcn81 gene in human cancer cell and people's tissue.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012104458626A CN102936604A (en) | 2012-11-09 | 2012-11-09 | Human hcrcn81 pronucleus recombinant plasmid, protein and rabbit anti-human polyclonal antibody expressed by same and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012104458626A CN102936604A (en) | 2012-11-09 | 2012-11-09 | Human hcrcn81 pronucleus recombinant plasmid, protein and rabbit anti-human polyclonal antibody expressed by same and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102936604A true CN102936604A (en) | 2013-02-20 |
Family
ID=47695526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012104458626A Pending CN102936604A (en) | 2012-11-09 | 2012-11-09 | Human hcrcn81 pronucleus recombinant plasmid, protein and rabbit anti-human polyclonal antibody expressed by same and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102936604A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106496328A (en) * | 2016-11-22 | 2017-03-15 | 浙江达美生物技术有限公司 | The preparation method of hyaluronic acid binding protein polyclonal antibody |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448509A (en) * | 2002-03-29 | 2003-10-15 | 天津医科大学总医院 | Human ICAM-1 extramembranous I-III domain gene expression product ,its prep. and application in radioimmunological technology |
| CN1676600A (en) * | 2005-01-28 | 2005-10-05 | 华东师范大学 | Genetically engineered bacteria for efficiently expressing recombinant human sweet gland antibacterial peptide, and its constructing method and use |
| CN101003812A (en) * | 2006-01-17 | 2007-07-25 | 温州医学院 | Method in use for preparing recombined EGF-IL18 fusion protein of human |
| CN101275147A (en) * | 2008-04-30 | 2008-10-01 | 中国人民解放军南京军区南京总医院 | Expression vector and fused protein of human differential initiator 3 and preparation thereof |
| CN101353668A (en) * | 2008-05-29 | 2009-01-28 | 四川大学 | Mouse beta-alexin 1 recombinant plasmids, polypeptides, uses and preparations thereof |
-
2012
- 2012-11-09 CN CN2012104458626A patent/CN102936604A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448509A (en) * | 2002-03-29 | 2003-10-15 | 天津医科大学总医院 | Human ICAM-1 extramembranous I-III domain gene expression product ,its prep. and application in radioimmunological technology |
| CN1676600A (en) * | 2005-01-28 | 2005-10-05 | 华东师范大学 | Genetically engineered bacteria for efficiently expressing recombinant human sweet gland antibacterial peptide, and its constructing method and use |
| CN101003812A (en) * | 2006-01-17 | 2007-07-25 | 温州医学院 | Method in use for preparing recombined EGF-IL18 fusion protein of human |
| CN101275147A (en) * | 2008-04-30 | 2008-10-01 | 中国人民解放军南京军区南京总医院 | Expression vector and fused protein of human differential initiator 3 and preparation thereof |
| CN101353668A (en) * | 2008-05-29 | 2009-01-28 | 四川大学 | Mouse beta-alexin 1 recombinant plasmids, polypeptides, uses and preparations thereof |
Non-Patent Citations (2)
| Title |
|---|
| JIANG Q ET AL: "Homo sapiens chromosome 2 open reading frame 68 (C2orf68), mRNA", 《GENBANK》 * |
| QIN JIANG ET AL: "NM_001013649.3 gene is down-regulated in human colorectal adenocarcinoma", 《MOLECULAR MEDICINE REPORTS》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106496328A (en) * | 2016-11-22 | 2017-03-15 | 浙江达美生物技术有限公司 | The preparation method of hyaluronic acid binding protein polyclonal antibody |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102634486B (en) | GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof | |
| CN101949937A (en) | Oophoroma tumor marker HE4 time-resolved fluoroimmunoassay detection kit | |
| CN103215230B (en) | Hybridoma cell strain AFM1B7, monoclonal antibody thereof and aflatoxin M1 flow lag immunization time-resolved fluorescence quick test kit | |
| CN106478822A (en) | A kind of preparation method of Monopterus albus (Zuiew) aldehyde ketone reductase polyclonal antibody | |
| CN105017419A (en) | Anti-human NMP-22 monoclonal antibody and detection kit thereof | |
| CN103076453A (en) | P16 immune cell chemical reagent kit and polypeptide sequence in preparing same | |
| CN102634487B (en) | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof | |
| CN113740536A (en) | African swine fever virus p30 blocking ELISA antibody detection kit and application thereof | |
| CN101781656A (en) | Expression of odontoglossum ringspot virus (ORSV) coat protein gene and preparation method of antibody | |
| CN102936604A (en) | Human hcrcn81 pronucleus recombinant plasmid, protein and rabbit anti-human polyclonal antibody expressed by same and application | |
| CN101921337B (en) | Antibody against lactate dehydrogenase of plasmodium vivax, related preparation method, hybridoma cell strain and application | |
| CN103897051B (en) | A kind of clonorchis sinensis specificity PPMP type antigen | |
| CN102559605A (en) | Orf virus protein ORFV059 monoclonal antibody hybridoma A3 and monoclonal antibody | |
| CN103361317B (en) | Macaque IFN-gamma (interferon-gamma) monoclonal antibody hybridoma as well as preparation method and application thereof | |
| KR101080071B1 (en) | Rift valley fever competition ELISA using monoclonal antibodies against recombinant N protein | |
| CN103290020A (en) | Monoclonal antibody and polyclonal antibody to swine Foxp3 protein and application thereof | |
| CN107098980A (en) | A kind of fusion protein for detecting Detecting Rubella Virus Antibodies In Human Sera and preparation method thereof | |
| CN110484511B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
| CN103333251A (en) | Gamma-interferon sandwich ELISA detection method based on recombinant fusion antigen protein | |
| CN114163521A (en) | Monoclonal antibody for identifying hog cholera virus 2.1 subtype virulent strain and antibody thereof | |
| CN101363863A (en) | Test paper strip for detecting swine chain coccus type 2 antibody colloidal gold, method for making same and applications | |
| CN114717240B (en) | Preparation and application of clonorchis sinensis protein Cs144 | |
| CN104897834A (en) | Method for detecting toxoplasma acute infection and target protein thereof | |
| CN103087189A (en) | Method for obtaining polyclonal antibody of sheep independent growth factor 1B | |
| CN113121691B (en) | Preparation method and application of carp Toll-like receptor 2 polyclonal antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130220 |