CN102634487B - GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof - Google Patents
GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof Download PDFInfo
- Publication number
- CN102634487B CN102634487B CN201210086014.0A CN201210086014A CN102634487B CN 102634487 B CN102634487 B CN 102634487B CN 201210086014 A CN201210086014 A CN 201210086014A CN 102634487 B CN102634487 B CN 102634487B
- Authority
- CN
- China
- Prior art keywords
- gpc3
- monoclonal antibody
- antibody hybridoma
- hybridoma strain
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and a preparation method and application thereof, which belong to the technical field of cell engineering. The preservation code of the GPC3 monoclonal antibody hybridoma strain 8G6 is CGMCC (china general microbiological culture collection center) No.5427. The preparation method of the GPC3 monoclonal antibody hybridoma strain 8G6 includes: using GPC3 protein as immunogen to immunize a mouse; and fusing mouse splenocytes having serum titer more than 1:104 with SP2/0 myeloma cells, using an HATRPMI-1640 medium to screen fusion cells, and finally obtaining the hybridoma strain 8G6 by ELISA (enzyme-linked immunosorbent assay) and repeated limiting dilution. The GPC3 monoclonal antibody hybridoma strain 8G6 is high in yield of secretory antibodies, and is easy to survive, and the secreted monoclonal antibodies are high in titer, sensitive in reaction, easy to detect, low in production cost and widely applicable to detection of GPC3 protein expression.
Description
Technical field
The present invention relates to cell engineering field, be specifically related to GPC3 monoclonal antibody hybridoma cell strain 8G6 and its preparation method and application.
Background technology
Hepatocellular carcinoma (hepatocellular carcinoma, HCC) be one of modal malignant tumour in the world, serious harm human life is healthy, has report to show, in all diseases, hepatocellular carcinoma sickness rate occupies the 5th and case fatality rate is in the 3rd.According to estimates, the whole world has the 1000000 newfound HCC patients of surpassing every year, and approximately 1,000,000 people die of illness.Due to HCC early symptom with sign is not obvious or lack specificity, cause the early diagnostic rate of HCC lower, it is middle and advanced stage often that patient seeks medical advice, losing treatment machine meeting (studies show that, early metaphase HCC can operative treatment, postoperative 5 years survival rates of small liver cancer excision are nearly 62.9%, and after large Liver Cancer Operation, 5 years survival rates are only 34.6%).Meanwhile, because HCC is all little responsive to radiation and chemotherapy, prognosis is totally poor, and surgical operation comprises that liver transplantation is still the unique method for the treatment of recovery from illness liver cancer.Yet long-term survival rate is lower after high recurrence causes performing the operation with the high rate of transform, result for the treatment of is undesirable.When treatment there is no better healing strategy at present, the early diagnosis to high risk population's Effective selection and HCC, is the effective way that improves survival rate, reduces case fatality rate.And to the early discovery of small liver cancer and diagnosis, the tool advantage of biomarker.The most classical and putative in diagnosing cancer of liver is at present AFP, but its positive detection rate is only also 30 ~ 60%, and specificity is inadequate, can not meet the clinical early diagnosis to AFP negative HCC.The pathogenesis of liver cancer is the complex process of multifactor a, multi-step, thus so far still none specific parameters can apply clinically, generation, recurrence and transfer that can early discovery liver cancer by joint-detection many indexes, thus carry out early treatment.Therefore, find efficient diagnosis and treatment target, become emphasis, difficult point and the direction of HCC research.
Monophosphoinositideproteoglycans proteoglycans-3 (glypican-3, GPC3) be film Suleparoid polysaccharide protein, at fetus liver expressed in abundance, at adult human liver, do not express, reactivation usually when liver cancer occurs, that a developing important substance occurs HCC, the use Northern results of hybridization demonstration GPC3 genes such as Li Shenjing are not expressed in normal liver tissue, and in liver cancer tissue, be high expression level, and be proportionate with tumor size and liver cancer pathological grading, prompting GPC3 gene plays an important role in liver cancer genesis and development, relevant with the lesion degree of liver cancer.This illustrates that this gene is likely the specific marker gene of liver cancer tissue, can be used as the reference index of clinical early diagnosis, treatment and the judgement grade malignancy of liver cancer, has certain potential applicability in clinical practice.GPC3 is specificity overexpression in tumor tissues not only, also can in peripheral blood, be detected simultaneously, and the use ELISA methods such as Capurro record the C end fragment that has GPC3 in 53% liver cancer patient blood serum.And none positive in the normal healthy controls group that is 53 in sample size, in the liver cirrhosis patient control group that is 20 in sample size, only an example is positive, the higher specificity of prompting GPC3.The C2 end antibody: that the use such as Nakatsura are different is obtained similar result.The variation of its amount again with the existence of HCC focus whether, the severity close association (can reflect perioperative state and result for the treatment of, responsive compared with AFP) of the state of an illness.Especially GPC3 is specific expressed in AFP negative HCC, and joint-detection AFP and GPC3 can significantly improve diagnostic detection rate and the accuracy of HCC, so are considered to a kind of novel liver cancer marker that has potential.Meanwhile, research also shows that GPC3 has higher immunogenicity, in the developing of HCC, plays very important effect, likely becomes the novel targets of hepatoma-targeting treatment.
The antibody product that can detect at present GPG3 is more external companies as the product of BioMosaics, expensive, has limited the application of this albumen as clinical target checking and functional study aspect thereof.
Summary of the invention
The object of the invention is to, for above-mentioned deficiency of the prior art, provides GPC3(human phosphatidyl-inositol proteoglycan 3) monoclonal antibody hybridoma cell strain 8G6.
Another object of the present invention is to provide the preparation method of above-mentioned GPC3 monoclonal antibody hybridoma cell strain 8G6.
Another object of the present invention is to provide the application of above-mentioned GPC3 monoclonal antibody hybridoma cell strain 8G6.
The present invention is achieved through the following technical solutions above-mentioned purpose:
GPC3 monoclonal antibody hybridoma cell strain 8G6, Classification And Nomenclature is glypican-3 (GPC3) monoclonal antibody hybridoma cell strain 8G6, on November 04th, 2011, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number is CGMCC No.5427, preservation address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, the present invention of this cell strain is referred to as GPC3 monoclonal antibody hybridoma cell strain 8G6.
Monoclonal antibody by above-mentioned GPC3 monoclonal antibody hybridoma cell strain 8G6 secretion.
The preparation method of above-mentioned GPC3 monoclonal antibody hybridoma cell strain 8G6, step is as follows: take GPC3 albumen as immunogen immune BALB/c mouse, get serum titer at 1:10
4above mouse boosting cell and SP2/0 myeloma cell are merged, with the HAT RPMI-1640 Screening of Media fused cell containing 20wt% calf serum, with the coated elisa plate of GPC3 albumen, indirect elisa method screening fused cell culture supernatant, the selection the highest hybridoma cell strain of tiring carries out subcloning, with limiting dilution assay, be repeatedly cloned into 100% cell positive rate, finally obtain GPC3 monoclonal antibody hybridoma cell strain 8G6.
In aforesaid method, described GPC3 albumen is preferably recombinant protein, concrete preparation method is: the sequence shown in SEQ ID NO:1 ~ 2 of take is upstream and downstream primer, the cDNA of Huh7 (can be purchased from Chinese Academy of Sciences's Shanghai cell bank) cell total rna reverse transcription of take is template, PCR method amplification GPC3 gene, amplified production is used
ecor I and
sali is carried out double digestion, enzyme is cut product and is connected with the carrier PET-11b (can be purchased from Merck Chemicals company) through same double digestion, obtains recombinant vectors GPC3/PET-11b, transforms intestinal bacteria, IPTG abduction delivering, the purified GPC3 recombinant protein that obtains of expression product.
In aforesaid method, mouse boosting cell and SP2/0 myeloma cell are merged preferred use 50 wt % PEG-4000.
The application of the monoclonal antibody of GPC3 monoclonal antibody hybridoma cell strain 8G6 secretion of the present invention in detecting GPC3 protein expression.If for the technical fields such as immunohistochemistry detection of ELISA, time-resolved fluoroimmunoassay, chemoluminescence, western-blot, immunofluorescence and tissue.
As a kind of application method, the monoclonal antibody of hybridoma cell strain 8G6 secretion of the present invention can be prepared into a kind of GPC3 immunity detection reagent.
Compared with prior art, the present invention has following beneficial effect:
GPC3 monoclonal antibody hybridoma cell strain 8G6 secretory antibody output of the present invention is high, and easily survival, secreted antibody titer is high, be quick on the draw and be easy to detect, can be widely used in the detection of GPC3 protein expression, in hepatocellular carcinoma early detection, there is outstanding advantage, and reduced the production cost of GPC3 antibody, be conducive to clinical target checking and the functional study thereof of GPC3.
Accompanying drawing explanation
Fig. 1. GPC3 N end group is because being GPC3 72-369 bp fragment amplification product electrophoresis result and recombinant vectors GPC3/PET-11b double digestion qualification result, wherein 1 is the PCR result of GPC3 gene fragment, 2 is marker, DL2000,3 is GPC3/PET-11b double digestion result, and 4 is GPC3/PET-11b recombinant plasmid.
SDS-PAGE electrophoresis (12%) result of Fig. 2 .GPC3 recombinant protein IPTG abduction delivering, m:marker wherein, 1 and 3:GPC3/PET-11b/Rosetta induction before; 2 and 4:GPC3/PET-11b/Rosetta1 induction after.
Fig. 3. SDS-PAGE electrophoresis (12%) result after GPC3 recombinant protein thalline is ultrasonic.The ultrasonic supernatant of 1,3:GPC3/PET-11b/Rosetta; 2,4:GPC3/PET-11b/Rosetta1 ultrasound precipitation.
Fig. 4. SDS-PAGE electrophoresis (12%) result of GPC3 recombinant protein purification.M:marker wherein; 1,2: purifying protein.
Fig. 5. monoclonal antibody 8G6 of the present invention is to the results of comparison under the result of liver cancer cell Huh7 immunofluorescence dyeing and common light microscopic (200 times of microscope magnifications).
Embodiment
Below in conjunction with specific embodiment, further explain the present invention; should understand; these embodiment are only for illustrating the present invention; and protection scope of the present invention is not carried out to any type of restriction; any change that those of ordinary skills made for the present invention easily realize do not deviating under the prerequisite of technical solution of the present invention, within all will fall into claim protection domain of the present invention.
embodiment 1 preparation GPC3 recombinant protein
1. the structure of GPC3/PET-11b recombinant vectors
According to the people GPC3mRNA(NM_001164619 providing in GenBank) sequence, remove N end signal peptide, for the 72-369 base design pair of primers of sequence, upstream primer: 5'TAATGAATTCATGCAGCCCCCGCCGCC 3'(SEQ ID NO:1) downstream primer: 5'AGCGGTCGACTCACTTGGCATGGCGAACAACAA 3'(SEQ ID NO:2).At the 5' of two primers end, introduce respectively
ecor I and
sali restriction enzyme site, by conventional PCR method, take Huh7(purchased from Chinese Academy of Sciences's Shanghai cell bank) cDNA of cell total rna reverse transcription as template transfer GPC3 N end group because of, agarose gel electrophoresis shows, successfully obtained GPC3 N end group because of, fragment length with expect consistent (Fig. 1).
Prokaryotic expression carrier PET-11b(is purchased from Merck Chemicals company) and the GPC3 gene fragment after sepharose purifying, use
ecor I and
sali double digestion is processed, and enzyme is cut the purified rear connection of product, obtains recombinant plasmid GPC3/PET-11b, and recombinant plasmid is identified (Fig. 1) through double digestion, recombinant plasmid is sent to company's order-checking simultaneously, and sequencing result shows that GPC3 fragment and the implementation sequence of restructuring is in full accord.
2. the expression of GPC3 recombinant protein
Recombinant plasmid GPC3/PET-11b is transformed to intestinal bacteria, the recombinant expressed bacterium of GPC3/PET-11b is cultivated in the LB substratum containing 100 μ g/mL ammonia joint penicillin, when A600 reaches 0.6 left and right, the IPTG that adds final concentration 1 mmol/L, in 37 ℃ of induction 3 h, bacterium liquid after induction is in 4 ℃, centrifugal 10 min of 8000 rpm, collect thalline, binding buffer liquid (Binding Buffer) washing once, wet bacterium precipitation is resuspended with binding buffer liquid, be placed in ice bath, centrifugal 20 min of 12000 rpm after carrying out ultrasonic bacteria breaking, upper cleer and peaceful precipitation is carried out respectively SDS-PAGE electrophoresis, result shows, the fusion protein molecule amount of expressing be about 25 KDa(see Fig. 22 and 4), for inclusion body is expressed (Fig. 3), this fusion rotein is GPC3 recombinant protein.
3. the purifying of GPC3 recombinant protein is with quantitative
Collect the bacterium after induction, PBS washs once, the binding buffer liquid vibration washing of 8mol/L urea for wet bacterium precipitation, and centrifugal 20 min of 12000 rpm, supernatant is protein sample to be purified.
His6-Ni Superflow Resin filler (purchased from clonetech company) is loaded in purification column, purification column is connected with Akta purifying instrument, with level pad (the method preparation providing according to product description) 5 column volumes of balance, protein sample to be purified is with the speed loading of 1. 5 mL/min, after loading, with level pad, be washed till baseline, with albumen elution buffer wash-out, collect protein peak, elutriant is 4 ℃ of gradient dialysis in the binding buffer liquid containing 6 mol, 4 mol, 2 mol, 1 mol, 0 mol urea.SDS-PAGE electrophoretic analysis demonstration, GPC3 recombinant protein, after His affinity purification, has single band (see figure 4) in molecular weight 25 kDa left and right, conforms to desired value, and it is 0.12 mg/mL that Bradford method is measured protein concentration.
the preparation of embodiment 2 mouse-anti people GPC3 monoclonal antibodies
1. the foundation of hybridoma cell strain
(1) mouse immune
The GPC3 recombinant protein of getting purifying mixes with 250 μ L Bentonite adjuvants, amount subcutaneous abdomen multi-point injection BALB/c mouse with 100 μ g/500 μ L, the three weeks amount subcutaneous abdomen multi-point injection BALB/c mouse with 100 μ g/500 μ L in interval, from immunity for the third time, second week tail vein after each immunity gathers Mouse Blood, indirect ELISA method detects serum titer and reaches the above rear fusion of preparing of 1:50000, merge first 3 days, tail vein injection booster immunization once, antigen dose 100 μ g.
(2) immune serum titration
Adopting indirect elisa method to measure immune serum tires.Get 30 μ gGPC3 recombinant proteins and be dissolved in 10 mL 0.05 M pH9.6 carbonate buffer solutions, coated micro-96 orifice plates of polystyrene, 100 μ L/ holes, 4 ℃ are spent the night.Next day, use PBS(to contain 0.1% (V/V) Tween-20) wash plate three times, with 10 mM PBS, contain 10% new-born calf serum confining liquid 200 μ L/ holes, 37 ℃ of sealing 1 h, use PBS(to contain 0.1% (V/V) Tween-20) wash plate three times, mouse was in immune latter 15 days for the third time tail vein bloods, and mouse immune serum is with containing 2% new-born calf serum 10 mM PBS with 10
-1～10
-8doubly dilution, add 96 orifice plates, 100 37 ℃ 1, μ L/ hole h, PBS(contains 0.1% (V/V) Tween-20) wash after plate three times, add 1:10000 doubly to dilute horseradish peroxidase-labeled goat anti-mouse igg (Sigma, INC.), 100 37 ℃ 1, μ L/ hole h, the same washing after plate, TMB colour developing, 100 μ L/ holes, room temperature lucifuge 20 min, add 50 μ L/ hole 2M H
2sO
2termination reaction, surveys 450 nm absorption values, usings before immunity mice serum as negative control, so that measured value and control value are must be than>=2.1 positive, judges tiring of immune serum.
(3) preparation of hybridoma
Get serum titer and be greater than 1:10
4mouse, merge first 3 days, after getting recombinant antigen and isopyknic PBS and mixing, with the amount abdominal injection BALB/c mouse to be merged of every 100 μ g/500 μ L, carry out booster immunization.The aseptic mouse spleen of getting, making splenocyte suspension mixes in the ratio of 10:1 with the murine myeloma cell strain SP20 of logarithmic phase, centrifugal 5 min of 500 * g room temperature, abandon supernatant, with finger, flick centrifuge tube bottom, make to precipitate loose, centrifuge tube is placed in 37 ℃ of water-baths, by the 50% polyoxyethylene glycol (PEG at 37 ℃ of water bath heat preservations, MW4000, Sigma company) with dropper is one after another drop of, add in centrifuge tube, while dripping, shake centrifuge tube, in 1 min, drip off, drip off rear standing 2 min, serum-free 1640 substratum 1 mL that added 37 ℃ of preheatings every 1 minute, 2 mL, 3 mL, 4 mL, 5 mL and 10 mL stop the effect of polyoxyethylene glycol, centrifugal 5 min of cell mixture 500 * g room temperature, abandon supernatant, add HAT nutrient solution (xanthoglobulin (H), aminopterin-induced syndrome (A) and thymidine (T) (HAT, Sigma company)) re-suspended cell gently, cell is divided to 96 orifice plates, every hole 200 μ L.Cultivate after three days, observation of cell merges situation, change half HAT nutrient solution, the continuous a few days, until there is clone to form, changes HT nutrient solution (xanthoglobulin (H) and thymidine (T) (HT, Sigma company)) and cultivate three days, by indirect ELISA method, filter out the hybridoma (be greater than 2.1 with the ratio with negative serum A 450 and be judged to the positive) that can react with GPC3 recombinant protein, change 1640 perfect mediums.
(4) hybridoma of the anti-human GPC3 monoclonal antibody of screening secretion
Indirect elisa method screening cells and supernatant, the positive colony hybridoma that selection is tired higher carries out subcloning, and with the continuous cloning of limiting dilution assay 2 ~ 3 times, until to 100% cell positive rate, finally obtain 13 strains of stably excreting resisting GPC 3 cell strain of monoclonal antibody.The method that Applicative time is differentiated is matched antibody screening, and hybridoma cell strain 8G6 antibody response fluorescent value is the highest, liquid nitrogen cryopreservation after positive rate after cloning is reached to 100% cell amplification and cultivates.
(5) preparation of ascites and purifying
By hybridoma cell strain 8G6 with 1 * 10
6the BALB/c female mice abdominal cavity in/pretreated 8 ~ 10 week age of amount filling liquid paraffin only, breeding observing extracts ascites when mouse web portion expands after 6 ~ 7 days.After 7 ~ 10 days, gather mouse ascites, 12000 rpm, centrifugal 10 min collect supernatant, with ProteinGharose(purchased from GE company) carry out purifying: ProteinG filler is loaded in purification column, purification column is connected with Akta purifying instrument, with level pad (the method preparation providing to specifications) 5 column volumes of balance, ascites to be purified with after 10 times of level pad dilutions with 1.5 mL/min speed loadings, after loading, with level pad, be washed till baseline, with elution buffer wash-out antibody, collect antibody peak, the antibody of wash-out is used Tris-HCl (pH9.0) neutralization immediately.Bradford method is measured antibody concentration.Antibody purification is in-20 ℃ of preservations.
(6) CHARACTERISTICS IDENTIFICATION of monoclonal antibody
The identified by immunofluorescence of antibody: GPC3 expresses positive liver cancer cell Huh7 (purchased from Chinese Academy of Sciences's Shanghai cell bank) and cultivates after for some time, collecting cell after trysinization, be laid on grow overnight on sheet glass, PBS washed cell, use the paraformaldehyde fixed cell of precooling, the resisting GPC 3 monoclonal antibody 8G6(1:10 dilution that adds respectively hybridoma cell strain 8G6 to prepare), hatch 1h for 37 ℃, with the negative contrast of PBS.After PBS develops a film, 1:1000 adds fluorescent mark sheep anti mouse two anti-(Sigma company), hatches 1h for 37 ℃, and after PBS develops a film, fluorescence microscopy Microscopic observation, all observes green fluorescence through the cell of resisting GPC 3 monoclonal antibody 8G6 dyeing, as shown in Figure 5.Resisting GPC 3 monoclonal antibody 8G6 prepared by result proof hybridoma 8G6 can identify natural people GPC3 albumen.
SEQUENCE LISTING
<110> Nanfang Medical Univ
<120> GPC3 monoclonal antibody hybridoma cell strain 8G6 and its preparation method and application
<130>
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 27
<212> DNA
<213> artificial sequence
<400> 1
taatgaattc atgcagcccc cgccgcc 27
<210> 2
<211> 33
<212> DNA
<213> artificial sequence
<400> 2
agcggtcgac tcacttggca tggcgaacaa caa 33
Claims (4)
1.GPC3 monoclonal antibody hybridoma cell strain 8G6, is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on November 04th, 2011, and deposit number is CGMCC No.5427.
2. the monoclonal antibody that described in claim 1, GPC3 monoclonal antibody hybridoma cell strain 8G6 secretes.
3. described in claim 2, the monoclonal antibody of GPC3 monoclonal antibody hybridoma cell strain 8G6 secretion detects the application in GPC3 protein expression test kit in preparation.
4. a GPC3 immunity detection reagent, is characterized in that comprising the monoclonal antibody of GPC3 monoclonal antibody hybridoma cell strain 8G6 secretion described in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210086014.0A CN102634487B (en) | 2012-03-28 | 2012-03-28 | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210086014.0A CN102634487B (en) | 2012-03-28 | 2012-03-28 | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102634487A CN102634487A (en) | 2012-08-15 |
| CN102634487B true CN102634487B (en) | 2014-08-27 |
Family
ID=46619066
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210086014.0A Active CN102634487B (en) | 2012-03-28 | 2012-03-28 | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102634487B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104610441B (en) * | 2015-03-04 | 2018-02-13 | 首都医科大学 | For preparing artificial semiantigen, preparation method and the monoclonal antibody of acquisition of glypican-3 (GPC3) monoclonal antibody |
| CN111040999B (en) * | 2019-12-31 | 2022-05-06 | 南京拂晓生物科技有限公司 | Recombinant CHO cell strain for stably expressing GPC3 and application thereof |
| CN111175520A (en) * | 2020-01-15 | 2020-05-19 | 河北省科学院生物研究所 | Glyphican-3 double-antibody sandwich method detection kit and detection method |
| CN111378628B (en) * | 2020-04-08 | 2021-07-23 | 扬州大学 | Hybridoma cell strain secreting mycobacterium tuberculosis ESAT6 protein specific antibody, antibody and application thereof |
| CN112608907B (en) * | 2020-12-18 | 2023-01-17 | 十堰市太和医院（湖北医药学院附属医院） | Phosphatidylinoglycan 3 monoclonal antibody, hybridoma cell strain and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101377506A (en) * | 2008-04-16 | 2009-03-04 | 北京科美东雅生物技术有限公司 | Monophosphoinositide proteoglycans-3 chemiluminescence immune analysis determination reagent kit and preparing method thereof |
| CN101633693A (en) * | 2009-08-24 | 2010-01-27 | 中国人民解放军第二军医大学 | Monoclonal antibody for resisting GPC3 |
| CN102180969A (en) * | 2011-01-30 | 2011-09-14 | 中国人民解放军军事医学科学院微生物流行病研究所 | Monoclonal antibody with liver cancer resisting activity and application thereof |
-
2012
- 2012-03-28 CN CN201210086014.0A patent/CN102634487B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101377506A (en) * | 2008-04-16 | 2009-03-04 | 北京科美东雅生物技术有限公司 | Monophosphoinositide proteoglycans-3 chemiluminescence immune analysis determination reagent kit and preparing method thereof |
| CN101633693A (en) * | 2009-08-24 | 2010-01-27 | 中国人民解放军第二军医大学 | Monoclonal antibody for resisting GPC3 |
| CN102180969A (en) * | 2011-01-30 | 2011-09-14 | 中国人民解放军军事医学科学院微生物流行病研究所 | Monoclonal antibody with liver cancer resisting activity and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102634487A (en) | 2012-08-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102634486B (en) | GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof | |
| CN102634487B (en) | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof | |
| CN105087497A (en) | Hybridoma cell strain ZJEB8-01, Ebola-virus GP albumen resistant monoclonal antibody, and preparation and application of Ebola-virus GP albumen resistant monoclonal antibody | |
| CN102180969B (en) | Monoclonal antibody with liver cancer resisting activity and application thereof | |
| CN103694355A (en) | Recombinant antibody of anti-human cardiac troponin I as well as construction method and application thereof | |
| CN105112375A (en) | Hybridoma cell strain ZJED0-02, anti-Ebola virus GP (glycoprotein) monoclonal antibody and their preparation and application | |
| CN101525614A (en) | Human oophoroma tumor marker HE4 enzymoimmunoassay kit | |
| CN105017419A (en) | Anti-human NMP-22 monoclonal antibody and detection kit thereof | |
| CN108467432A (en) | The monoclonal antibody and its cell strain, preparation method and application of anti-E-cadherin albumen | |
| CN103451187B (en) | The preparation method of restructuring neutrophil gelatinase-associated lipocalin and this protein antibodies | |
| CN102776153A (en) | Mouse anti-human neutrophil gelatinase-associated lipocalin (NGAL) monoclonal antibodies and hybridoma cell strains and application thereof | |
| CN103923212A (en) | EHD2 antibody and application of EHD2 antibody to preparation of immunohistochemical detection reagent for breast cancer | |
| CN109306007B (en) | Anti-porcine reproductive and respiratory syndrome virus nsp4 protein gene engineering antibody and application thereof | |
| CN103215292A (en) | Human Pcid2 protein soluble expression method, anti-human Pcid2 protein monoclonal antibody 2D7-F11, and hybridoma cell line secreting antibody | |
| CN102221615A (en) | Double-antibody sandwich ELISA method based on Angiogenin detection | |
| CN102329378B (en) | HCV (hepatitis C virus) core antigen and antibody thereof as well as hybridoma cell lines secreting antibody | |
| CN103937871A (en) | Application of SRRP35 gene and expression product thereof to cancer diagnosis and treatment | |
| CN104945496B (en) | A kind of polypeptide and its application in the preparation and purification antibody special to EHD2 | |
| CN103288954A (en) | Monoclonal antibody with rock bream iridovirus ORF049L recombinant proteins and preparation method thereof | |
| CN101974088A (en) | Breast globin monoclonal antibody and application thereof in breast cancer diagnosis | |
| CN104945506A (en) | Immunohistochemical reagent for mammary cancer diagnosis and prognosis judgment | |
| CN104530211B (en) | A kind of tumor associated antigen MAGE-D4 restructuring truncated proteins and preparation method and applications | |
| CN102234632B (en) | Hybrid tumor DY01 of monoclonal antibody of human ubiquitin-conjugating enzyme UbcH10, and monoclonal antibody | |
| CN117801108B (en) | Anti-human MDM2 protein monoclonal antibody, hybridoma cell strain and application thereof | |
| CN102234633B (en) | Human ubiquitin-conjugating enzyme UbcH10 monoclonal antibody hybrid tumor DY02 and monoclonal antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xu Weiwen Inventor after: Ma Ruijuan Inventor after: Wang Suihai Inventor after: Li Ming Inventor before: Ma Ruijuan Inventor before: Xu Weiwen Inventor before: Li Ming |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: MA RUIJUAN XU WEIWEN LI MING TO: XU WEIWEN MA RUIJUAN WANG SUIHAI LI MING |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20170830 Address after: Nanxiang three road, Science City high tech Industrial Development Zone, Guangzhou city Guangdong province 510670 11 Building No. 5 Patentee after: Guangzhou Da Rui Biotechnology Ltd. Address before: 510515 Baiyun District, Guangdong, Guangzhou, Sha Tai Road, No. 1023 Patentee before: Southern Medical University |
|
| TR01 | Transfer of patent right |