CN114195903B - Recombinant fusion protein and application thereof in preparing medicine for treating inflammatory bowel disease - Google Patents
Recombinant fusion protein and application thereof in preparing medicine for treating inflammatory bowel disease Download PDFInfo
- Publication number
- CN114195903B CN114195903B CN202111505237.1A CN202111505237A CN114195903B CN 114195903 B CN114195903 B CN 114195903B CN 202111505237 A CN202111505237 A CN 202111505237A CN 114195903 B CN114195903 B CN 114195903B
- Authority
- CN
- China
- Prior art keywords
- fusion protein
- pdap1
- recombinant fusion
- ydpe
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses a recombinant fusion protein and application thereof in preparing a medicament for treating inflammatory bowel disease, wherein the recombinant fusion protein has the amino acid sequence shown in SEQ ID NO: 1. The recombinant fusion protein is applied to preparing medicines for treating ulcerative colitis and/or Crohn's disease. Through amino acid mutation, PDAP1 is screened out YDPE The mutation can obviously improve the stability of the PDAP1 protein, and recombinant PDAP1 is adopted YDPE The protein enema treatment can obviously relieve the colon inflammation of mice and prompts the recombination of PDAP1 YDPE The protein has potential application value in the treatment of inflammatory bowel diseases.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to a recombinant fusion protein and application thereof in preparing a medicament for treating inflammatory bowel disease.
Background
Ulcerative colitis is a chronic inflammatory bowel disease of unknown etiology that affects primarily the colon and rectum. The prevalence of the incidence of ulcerative colitis increases year by year from a global perspective. At present, the prevalence rate of Chinese ulcerative colitis exceeds 11.6/10 ten thousand, and the peak age of onset is 20-49 years old. In addition, with the continuous progress and the prolonged course of ulcerative colitis, the risk of adverse prognosis of patients is also increasing, such as the obvious increase of colorectal cancer risk, structural intestinal injury, easier depression and anxiety, and the like. Ulcerative colitis is considered to be a progressive disease due to the risks of intestinal stenosis, intestinal motility disorders, anorectal dysfunction, carcinogenesis and the like, and the treatment strategy also shifts from symptomatic treatment to promotion of mucosal healing, and studies show that histological remission is associated with lower hospitalization, colonic resection and carcinogenesis risks.
At present, the treatment of ulcerative colitis mainly aims at inhibiting intestinal inflammation, however, the existing treatment means comprise aminosalicylic acid, glucocorticoid, immunosuppressant or biological agent and the like, and have unsatisfactory safety and effectiveness. The 10-year cumulative recurrence rate of ulcerative colitis patients is as high as 70-80%, nearly 50% of patients need hospitalization, the 5-year re-hospitalization rate is 50%, and the colectomy rate at 5 years and 10 years after diagnosis is 10-15%. Therefore, the development of a novel therapeutic drug for ulcerative colitis is of great significance.
Disclosure of Invention
The invention aims to provide a recombinant fusion protein and application thereof in preparing a medicament for treating inflammatory bowel disease.
The specific technical scheme comprises the following steps:
a recombinant fusion protein having the amino acid sequence as set forth in SEQ ID NO: 1.
A recombinant fusion protein consisting of the amino acid sequence as set forth in SEQ ID NO:2 is obtained by encoding the gene sequence shown in the specification.
A recombinant fusion protein, human PDAP1 YDPE The amino terminal of the recombinant fusion protein is fused with a 6 XHis tag, the carboxyl terminal of the recombinant fusion protein contains 4 amino acid mutations, and the mutated amino acid residues are K105Y, E106D, R109P and R110E.
The recombinant fusion protein is used for preparing a medicament for treating inflammatory bowel diseases.
A recombinant vector is prepared by mixing PDAP1 YDPE The fusion gene fragment was inserted into pET-22b (+) expression vector (Merck, NJ, USA) using restriction enzyme sites NdeI/EcoRI;
PDAP1 YDPE the fusion gene segment is shown as SEQ ID NO:2, respectively.
Escherichia coli BL21 (DE 3) is transformed with the recombinant vector of the invention.
The invention relates to a medicine for treating ulcerative colitis, which contains the recombinant fusion protein.
A medicine for treating Crohn's disease contains the recombinant fusion protein.
A medicament for treating inflammatory bowel disease comprises the recombinant fusion protein of the invention.
The invention has the advantages that:
the invention screens PDAP1 through amino acid mutation YDPE The mutation can obviously improve the stability of the PDAP1 protein, and recombinant PDAP1 is adopted YDPE The protein enema treatment can obviously relieve the colon inflammation of mice and prompts the recombination of PDAP1 YDPE The protein has potential application value in the treatment of inflammatory bowel diseases.
Drawings
The accompanying drawings, which are included to provide a further understanding of the disclosure and are incorporated in and constitute a part of this specification, illustrate embodiments of the disclosure and together with the description serve to explain the disclosure, but do not constitute a limitation of the disclosure. In the drawings:
FIG. 1 shows pET-22b-PDAP1 YDPE A plasmid map;
FIG. 2 is a human PDAP1 YDPE SDS-PAGE picture of purity detection of recombinant fusion protein;
FIG. 3 shows the fusion protein PDAP1 pair using mouse colitis model YDPE A dosing schedule for pharmacodynamic testing;
FIG. 4 shows the application of PBS or fusion protein PDAP1 in mouse colitis model YDPE A colon map of the mice after treatment;
FIG. 5 shows the application of PBS or fusion protein PDAP1 in mouse colitis model YDPE Statistical plots of colon length of mice after treatment;
FIG. 6 shows the application of PBS or fusion protein PDAP1 in mouse colitis model YDPE A statistical graph of the expression level of the inflammatory factor in the colon tissues of the mice after treatment; in FIG. 6, ifng, il1b, il6, il8, il10, il17a and Tnf represent different inflammatory factors, respectively.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the following embodiments, and it is apparent that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Inflammatory Bowel Disease (IBD) is an idiopathic inflammatory disease of the intestinal tract that affects the ileum, rectum, and colon. The clinical manifestations are diarrhea, abdominal pain and even bloody stool. The disease includes Ulcerative Colitis (UC) and Crohn's Disease (CD). Ulcerative colitis is a continuous inflammation of the mucosal layer and submucosa of the colon, the disease usually affects the rectum first and gradually spreads to the whole colon, crohn's disease can affect the whole digestive tract and is a discontinuous whole-layer inflammation, and the most frequently affected parts are the terminal ileum, colon and perianal.
PDAP1 (PDGF-associated protein, platelet derived growth factor related protein);
DSS (Dextran sulfate sodium salt) is a polyanionic derivative of Dextran formed by the esterification reaction of Dextran and chlorosulfonic acid. Since the first report in 1985 that a DSS was used to prepare a mouse ulcerative colitis model, a great deal of research has been conducted to demonstrate that the DSS colitis model is similar to human ulcerative colitis. The histological features, clinical manifestations, disease sites and cytokine proliferation of the DSS colitis model are very similar to those of human ulcerative colitis.
UC (Ulcerative colitis) is a chronic inflammatory disease of the rectum and colon of unknown cause. The main clinical manifestations are diarrhea, mucopurulent bloody stool, abdominal pain and tenesmus. The disease condition is mild or severe, and the disease usually attacks repeatedly or passes through chronically for a long time.
PDAP1 is a protein consisting of 181 amino acids and having a molecular weight of about 28 kD. Early-stage research shows that in a DSS-induced colitis model, after intestinal epithelial cells knock out PDAP1 genes, colitis of a mouse is remarkably aggravated, and colitis cell infiltration, inflammatory factor release, colon permeability, intestinal epithelial cell apoptosis and the like are remarkably increased, which shows that PDAP1 plays an important role in the UC injury repair process. Researches also find that the recombinant wild PDAP1 protein is extremely easy to degrade and has poor stability. The mass spectrum analysis finds the unstable site of the PDAP1 protein, and the PDAP1 is screened by amino acid mutation YDPE The mutation can obviously improve the stability of the PDAP1 protein, and recombinant PDAP1 is adopted YDPE The protein enema treatment can obviously relieve the colitis of mice and prompt the recombination of PDAP1 YDPE The protein has potential application value in UC treatment.
The invention obtains the human PDAP1 by a genetic engineering method YDPE The amino terminal of the fusion protein is fused with a 6 XHis tag, the carboxyl terminal of the fusion protein contains 4 amino acid mutations, and the mutated amino acid residues are K105Y, E106D, R109P and R110E. The obtained recombinant fusion protein is applied to the preparation of medicines for treating inflammatory bowel diseases.
The invention obtains PDAP1 through whole gene synthesis YDPE Fusion gene fragment havingThe body includes: designing, synthesizing and assembling single-stranded oligonucleotide sequences; cloning the assembled whole gene sequence to pET-22b (+) vector; the correctness of the sequence was verified by Sanger sequencing and enzymatic cleavage. PDAP1 YDPE The gene sequence of the fusion gene fragment is shown as SEQ ID NO:2 is shown in the specification; the amino acid sequence is shown as SEQ ID NO:1 is shown.
Example 1: fusion protein PDAP1 YDPE Preparation of
Obtaining PDAP1 by Whole Gene Synthesis YDPE The fusion gene fragment was inserted into pET-22b (+) expression vector (Merck, NJ, USA) using restriction enzyme cleavage sites NdeI/EcoRI, and recombinant vector pET-22b-PDAP1 YDPE The map is shown in FIG. 1. After the recombinant expression vector is transformed into Escherichia coli strain BL21 (DE 3), positive clones are screened in a fixed culture medium of ampicillin, the success of vector construction is confirmed by sequencing, and the strain is designated as pET-22b-PDAP1 YDPE /BL21。
Inoculation with 10. Mu.L of pET-22b-PDAP1 YDPE The cells were cultured overnight at 37 ℃ in LB medium containing 10mL of ampicillin (50. Mu.g/mL) with shaking. Transfer 10mL of cultured overnight pET-22b-PDAP1 YDPE The suspension was shake-cultured at 37 ℃ for about 4 to 6 hours (OD 600= 0.6) in 1L LB medium containing ampicillin (50. Mu.g/mL), and then 1mL of 100mM IPTG was added thereto, and shake-cultured at 18 ℃ for 15 hours. The cells were collected by centrifugation at 6000rpm for 20min, and washed once with Ni-A solution (20mM sodium phosphate,0.5M NaCl,5mM imidazole, pH 7.4) in a resuspension manner, and frozen at-80 ℃. The bacterial sludge is melted at room temperature, 35mL of Ni-NTA solution containing protease inhibitor is added, and the mixture is shaken for resuspension. Cells were sonicated in ice bath 300w,5s/10s,30min. Centrifuging at 12000g and 4 deg.C for 15min, and collecting supernatant. Adopts a fast protein liquid phase chromatographic system AKTA FPLC (GE), ni Sepharose TM Protein purification was performed by Fast Flow prepacked column (GE) at a Flow rate of 2mL/min, gradient elution was performed using Ni-B solution (20mM sodium phosphate,0.5M NaCl,0.5M imidazole, pH 7.4), and the components and purity of the eluted peaks were identified by SDS-PAGE. After the target protein is ultrafiltered and concentrated, superdex 75column (GE) is adopted for further purification, and the purity of the target protein peak is identified by SDS-PAGE.
FIG. 2 shows recombinant PDAP1 YDPE SDS-PAGE patterns of protein purity identification. From FIG. 1 and FIG. 2It is known that the construction of the expression fusion protein PDAP1 has been successful YDPE And realizes the expression and purification of the fusion protein PDAP1 in host cells YDPE Its purity can be up to 95%.
Example 2: fusion protein PDAP1 YDPE Pharmacodynamic assays in a mouse model of acute inflammation
DSS (Dextran sulfate sodium salt) is a polyanionic derivative of Dextran formed by the esterification reaction of Dextran and chlorosulfonic acid. Since the first report in 1985 that a DSS was used to prepare a mouse ulcerative colitis model, a great deal of research has been conducted to demonstrate that the DSS colitis model is similar to human ulcerative colitis. The histological features, clinical manifestations, disease sites and cytokine proliferation of the DSS colitis model are very similar to those of human ulcerative colitis. In this study, 2.5% DSS aqueous solution was used to induce colitis in C57BL/6 mice. C57BL/6 mice weighing approximately 22 grams were randomly divided into 2 groups of 9 mice each. The administration schedule is shown in FIG. 3, the mice drinking water was 2.5% DSS aqueous solution on days 1 to 5, the mice were given normal drinking water on days 6 to 10, and the treatment group was given 100. Mu.L of the fusion protein PDAP1 YDPE (2.5 mg/mL) enema treatment, 100. Mu.L PBS enema was given to the control group, and each mouse was enema 1 time per day. After day 11 anesthesia the mice were bled and sacrificed and colon length was measured and qPCR detected the level of inflammatory factor expression in the colon tissue.
The experimental results are as follows: as shown in FIGS. 4 and 5, the fusion protein PDAP1 YDPE The colon length of the treatment group is obviously larger than that of the PBS control group; as shown in FIG. 6, the fusion protein PDAP1 YDPE The expression level of proinflammatory factors in the treatment group is obviously lower than that in the PBS control group. The above results show that the fusion protein PDAP1 YDPE Has obvious curative effect.
The preferred embodiments of the present disclosure are described in detail above with reference to the accompanying drawings, however, the present disclosure is not limited to the specific details in the above embodiments, and various simple modifications may be made to the technical solution of the present disclosure within the technical idea of the present disclosure, and these simple modifications all belong to the protection scope of the present disclosure.
It should be noted that, in the above embodiments, the various features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various possible combinations will not be further described in the present disclosure.
In addition, any combination of various embodiments of the present disclosure may be made, and the same should be considered as the disclosure of the present disclosure, as long as it does not depart from the spirit of the present disclosure.
Nucleotide sequence list electronic file
<110> China people liberation military and military medical university
<120> recombinant fusion protein and application thereof in preparing medicines for treating inflammatory bowel diseases
<160>2
<210> 1
<211>189
<212> PRT
<213> amino acid sequence, PDAP1YDPE recombinant fusion protein
<400> 1
1 Met His His His His His His Met Pro Lys Gly Gly Arg Lys Gly Gly His Lys Gly Arg 20
21 Ala Arg Gln Tyr Thr Ser Pro Glu Glu Ile Asp Ala Gln Leu Gln Ala Glu Lys Gln Lys 40
41 Ala Arg Glu Glu Glu Glu Gln Lys Glu Gly Gly Asp Gly Ala Ala Gly Asp Pro Lys Lys 60
61 Glu Lys Lys Ser Leu Asp Ser Asp Glu Ser Glu Asp Glu Glu Asp Asp Tyr Gln Gln Lys 80
81 Arg Lys Gly Val Glu Gly Leu Ile Asp Ile Glu Asn Pro Asn Arg Val Ala Gln Thr Thr 100
101 Lys Lys Val Thr Gln Leu Asp Leu Asp Gly Pro Tyr Asp Leu Ser Pro Glu Glu Arg Glu 120
121 Glu Ile Glu Lys Gln Lys Ala Lys Glu Arg Tyr Met Lys Met His Leu Ala Gly Lys Thr 140
141 Glu Gln Ala Lys Ala Asp Leu Ala Arg Leu Ala Ile Ile Arg Lys Gln Arg Glu Glu Ala 160
161 Ala Arg Lys Lys Glu Glu Glu Arg Lys Ala Lys Asp Asp Ala Thr Leu Ser Gly Lys Arg 180
181 Met Gln Ser Leu Ser Leu Asn Lys 189
<210>2
<211>567
<212>DNA
<213> DNA sequence, PDAP1YDPE recombinant fusion protein
<400>2
ATGCATCATCATCATCACCACATGCCGAAAGGTGGCCGTAAAGGTGGTCATAAAGGTCGTGCACGCCAGTATACCAGCCCGGAAGAAATTGATGCACAGC 100
TGCAGGCAGAAAAACAGAAAGCCCGCGAAGAAGAAGAACAGAAAGAAGGCGGCGATGGTGCCGCCGGCGATCCTAAAAAAGAAAAGAAAAGCCTGGATAG 200
CGATGAAAGCGAAGATGAAGAAGATGATTATCAGCAGAAACGTAAAGGCGTTGAAGGCCTGATTGATATTGAAAATCCGAATCGTGTTGCCCAGACCACC 300
AAAAAAGTTACCCAGCTGGATCTGGATGGCCCGTATGATCTGAGCCCCGAGGAACGTGAAGAAATTGAAAAACAGAAGGCCAAAGAACGTTATATGAAAA 400
TGCATCTGGCAGGTAAAACCGAACAGGCAAAAGCCGATCTGGCACGTCTGGCAATTATTCGTAAACAGCGTGAAGAAGCCGCACGCAAAAAAGAAGAAGA 500
ACGTAAAGCAAAAGACGATGCAACCCTGAGCGGCAAACGTATGCAGAGTCTGAGTCTGAATAAGTAA 567
Claims (9)
1. A recombinant fusion protein, characterized in that its amino acid sequence is as set forth in SEQ ID NO:1 is shown.
2. A recombinant fusion protein consisting of the amino acid sequence set forth in SEQ ID NO:2 is obtained by encoding the gene sequence shown in the specification.
3. The recombinant fusion protein of claim 1, which is human PDAP1 YDPE The amino terminal of the recombinant fusion protein is fused with a 6' His tag, the carboxyl terminal of the recombinant fusion protein contains 4 amino acid mutations, and the mutated amino acid residues are K105Y, E106D, R109P and R110E.
4. Use of a recombinant fusion protein according to any one of claims 1 to 3 for the manufacture of a medicament for the treatment of inflammatory bowel disease.
5. A recombinant vector comprising PDAP1 YDPE The fusion gene fragment is inserted into a pET-22b (+) expression vector by utilizing restriction enzyme cutting sites NdeI/EcoRI;
PDAP1 YDPE the fusion gene segment is shown as SEQ ID NO:2, respectively.
6. An Escherichia coli BL21 (DE 3) transformed with the recombinant vector of claim 5.
7. A medicament for the treatment of ulcerative colitis, comprising the recombinant fusion protein of any one of claims 1-3.
8. A pharmaceutical agent for treating Crohn's disease, comprising the recombinant fusion protein according to any one of claims 1 to 3.
9. A medicament for treating inflammatory bowel disease, comprising the recombinant fusion protein according to any one of claims 1 to 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111505237.1A CN114195903B (en) | 2021-12-10 | 2021-12-10 | Recombinant fusion protein and application thereof in preparing medicine for treating inflammatory bowel disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111505237.1A CN114195903B (en) | 2021-12-10 | 2021-12-10 | Recombinant fusion protein and application thereof in preparing medicine for treating inflammatory bowel disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114195903A CN114195903A (en) | 2022-03-18 |
| CN114195903B true CN114195903B (en) | 2023-02-03 |
Family
ID=80652035
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111505237.1A Active CN114195903B (en) | 2021-12-10 | 2021-12-10 | Recombinant fusion protein and application thereof in preparing medicine for treating inflammatory bowel disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114195903B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113563455A (en) * | 2015-06-19 | 2021-10-29 | 伊玛提克斯生物技术有限公司 | Novel peptides and peptide compositions for immunotherapy and methods for the generation of scaffolds for pancreatic and other cancers |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090233270A9 (en) * | 2000-08-02 | 2009-09-17 | St Croix Brad | Secreted and cytoplasmic tumor endothelial markers |
-
2021
- 2021-12-10 CN CN202111505237.1A patent/CN114195903B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113563455A (en) * | 2015-06-19 | 2021-10-29 | 伊玛提克斯生物技术有限公司 | Novel peptides and peptide compositions for immunotherapy and methods for the generation of scaffolds for pancreatic and other cancers |
Non-Patent Citations (3)
| Title |
|---|
| miR-486-3p通过调控血小板衍生生长因子相关蛋白1抑制卵巢癌细胞增殖的研究;孙冰纯;《中国计划生育和妇产科》;20191231;第11卷(第7期);第77-81页 * |
| PDGFA-associated protein 1 is a novel target of c-Myc and contributes to colorectal cancer initiation and progression;Hong-Yong Cui等;《Cancer Communication》;20220618;第42卷(第8期);第750-767页 * |
| PDGFA-associated protein 1 protects mature lymphocytes from stress-induced cell death and promotes antibody gene diversification;Verónica Delgado-Benito等;《J. Exp. Med.》;20201231;第217卷(第10期);第1-28页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114195903A (en) | 2022-03-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2021203492A1 (en) | Nucleic acid vaccines | |
| CN101921329B (en) | Alpha interferon mutant and polyethylene glycol derivative thereof | |
| JP2001527524A (en) | Human breast tumor specific protein | |
| US5834192A (en) | Human cachexia associated protein | |
| WO2017193956A1 (en) | Bispecific antigen-binding construct and preparation method and use thereof | |
| WO1999067382A2 (en) | Angiopoietin-like growth factor sequences | |
| CN110090295B (en) | Application of Ephrin-B1 in preparation of medicine for treating inflammatory bowel disease | |
| CN102370979B (en) | Building method for autovaccine by aiming at human TNF(Tumor Necrosis Factor)-alpha molecule | |
| PT767796E (en) | CHEMICAL PROTEIN | |
| CN114195903B (en) | Recombinant fusion protein and application thereof in preparing medicine for treating inflammatory bowel disease | |
| US20240041988A1 (en) | Use of elapidae postsynaptic neurotoxin in the treatment of over expression of inflammatory cytokines related diseases | |
| JP2000507817A (en) | Human cell death-related protein | |
| EP2768850B1 (en) | Novel peptides | |
| CN109157656B (en) | Double-target tumor vaccine and preparation method and application thereof | |
| CN112587654B (en) | Application of mesencephalon astrocyte-derived neurotrophic factor in treatment of ulcerative colitis | |
| AU722904B2 (en) | Novel polynucleotides PANC1A and PANC1B associated with pancreatic cancer | |
| JP2000500350A (en) | Novel human ubiquitin conjugate enzyme | |
| US5840544A (en) | DNA encoding rantes homolog from prostate | |
| US5747319A (en) | Human mRNA editing enzyme | |
| KR101651330B1 (en) | Methods of TAT-A20 fusion protein with good cell penetration and use thereof | |
| CN103865899B (en) | There is VEGFR 2the fusion toxin of/KDR receptor-specific and encoding gene thereof and application | |
| CN111961687A (en) | Drug target expression and purification method aiming at hypertension | |
| CN105367663A (en) | Long-acting interleukin-1 receptor antagonist recombinant fusion protein and a preparation method and application thereof | |
| US5856128A (en) | Human nucleic acid binding protein | |
| WO2000069910A1 (en) | Chemokine-like factors having cell chemokinesis function and proliferation-stimulating activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |