CN104530195B - Simulate antigenic epitope and its application of ochratoxin A - Google Patents
Simulate antigenic epitope and its application of ochratoxin A Download PDFInfo
- Publication number
- CN104530195B CN104530195B CN201410550651.8A CN201410550651A CN104530195B CN 104530195 B CN104530195 B CN 104530195B CN 201410550651 A CN201410550651 A CN 201410550651A CN 104530195 B CN104530195 B CN 104530195B
- Authority
- CN
- China
- Prior art keywords
- ota
- ochratoxin
- antigenic epitope
- epitope
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to biological technical field, it is related to the antigenic epitope of ochratoxin A, its amino acid sequence is DGFQLHTPFSAK.OTA antigenic epitopes of the present invention can replace expensive and strong toxicity OTA standard items, and OTA immunology detection is applied to as competition antigen or solid-phase coating antigen, the antigenic epitope has the immune response characteristic similar to natural OTA molecules, and effect is very good.Harm of the OTA to health is reduced, cost has been saved, with very high application value.
Description
Technical field
The invention belongs to biological technical field, and in particular to ochratoxin A antigenic epitope and its application.
Background technology
Ochratoxin A (Ochratoxin A, OTA) is a kind of common mycotoxin, is aspergillus and Penicillium
The secondary metabolite that some strains are produced.Research shows that OTA is easily accumulated in tissue, and its first target organs acted on is kidney
Dirty, liver, belongs to strong kidney and hepatotoxin, and experiment shows animal intake by after the feed of this endotoxin contamination, it may occur that
Acute or chronic nosotoxicosis.In addition, according to reported in literature, OTA also has carcinogenic, teratogenesis and mutagenicity.OTA toxigenic bacterium strain is wide
It is present in generally in nature, can be detected in the tissue, blood in various crops, food, feed and the mankind and animal
OTA pollution.OTA is polluted and carries out the effective means that detection in time is prevention and controls it to endanger.
At present, OTA method mainly has high performance liquid chromatography, gas-chromatography, thin-layer chromatography and immunology in detection food
The methods such as detection, immunological detection method is with the advantage such as its sensitivity is high, easy to detect, with low cost in OTA detection
To being widely applied.However, during immunological detection method is set up, it is necessary to made using OTA standard items are raw material
Standby competition antigen or solid-phase coating antigen, OTA are not only expensive but also with extremely strong carcinogenicity, and testing staff is good for
Health and environment cause great threat, so as to constrain the application and popularization of immunological detection method to a certain extent.There is mirror
In this, people start to realize replacing for harmful small-molecule substance standard items using anti-idiotype and antigenic epitope technology
Generation, and make some progress.Being mainly characterized by of phage display peptide library technology can effectively filter out and target target body
The phage-displayed polypeptides of specific bond, the technology is exploring the interphase interaction binding site of acceptor and part, is seeking high parent
Using wide in terms of ligand molecular, exploration agnoprotein matter space structure epitope, the development of new generation vaccine with power bioactivity
It is general.
The present invention filters out energy and target molecule by using phage display peptide library technology from peptide storehouse（Anti- OTA monoclonals resist
Body）The polypeptide of specific binding（Antigenic epitope）, the antigenic epitope has similar to natural OTA molecules immune anti-
Characteristic is answered, by the OTA antigenic epitopes of acquisition, to replace expensive and strong toxicity OTA standard items, and competition is used as
Antigen or solid-phase coating antigen are applied to OTA immunology detection.
The content of the invention
The present invention, by target molecule solid-phase coating on ELISA Plate, puts into bacteriophage using anti-OTA monoclonal antibodies as target molecule
Random displaying dodecapeptide storehouse, carries out affine elutriation, obtains four kinds of OTA antigenic epitope.Their amino acid sequence is such as
Under：KLGFQLHQPSWP, FNLHQPIHNWPL, AQFFQLHSQAYS or DGFQLHTPFSAK.
The invention further relates to encode the nucleotide sequence of above-mentioned antigenic epitope amino acid sequence, correspond to respectively：
AAGCTTGGGTTTCAGTTGCATCAGCCTAGTTGGCCG、
TTTAATTTGCATCAGCCGATTCATAATTGGCCGCTG、GCTCAGTTTTTTTAGCTGCATTCGCAGGCGTATTCG、
GATGGTTTTCAGTTGCATACTCCTTTTTCTGCTAAG
Above-mentioned antigenic epitope（Polypeptide）In structure, capitalization English letter represents a kind of 20 known natural L-forms respectively
One kind of amino acid residue or its D- type isomers, i.e. C represents cysteine residues, and D represents asparagicacid residue, and P represents dried meat
Histidine residue, R represents arginine residues, and K represents lysine residue, and H represents histidine residues, and I represents isoleucine residues, V
Valine residue is represented, Y represents tyrosine residue, and S represents serine residue, and F represents phenylalanine residue, and E represents glutamic acid
Residue, M represents methionine residues, and G represents glycine residue, and L represents leucine residue, and Q represents glutamine residue, W generations
Table trp residue, N represents asparagine residue, and A represents alanine residue, and T represents threonine residues.
The OTA antigenic epitopes that the present invention is referred to（Polypeptide）Phage amplification, chemical synthesis or genetic engineering can be passed through
The mode of recombination expression is largely prepared.Phage amplification refers to displaying having OTA antigenic epitopes（Polypeptide）Phagocytosis
Body, by way of biology amplification, amount reproduction production displaying has OTA antigenic epitopes（Polypeptide）Bacteriophage particles.Change
The amino acid sequence that synthesis refers to foundation OTA antigenic epitopes is learned, Peptide systhesis is carried out by way of chemically synthesized polypeptide.
The mode of genetic engineering recombination expression refers to the gene by OTA antigenic epitopes are encoded, by being cloned into expression vector, with many
The form of peptide-fusion protein carries out a large amount of preparations of OTA antigenic epitopes.
The invention further relates to application of the OTA antigenic epitopes in immunology detection analysis.Immunology detection
Type includes MBP enzyme linked immuno-adsorbent assay, colloidal gold immunochromatographimethod, immunodotting hybridization etc. and is based on Ag-Ab specific reaction
Immune analysis detection type.
OTA antigenic epitopes of the present invention（KLGFQLHQPSWP, FNLHQPIHNWPL, AQFFQLHSQAYS or
DGFQLHTPFSAK）In use, the mimic epitope of synthesis can be analyzed for immunology detection, Phage amplification will be passed through
The displaying of acquisition has OTA antigenic epitopes（Polypeptide）Bacteriophage particles be directly used in analysis detection, it is of course also possible to will
OTA antigenic epitopes scale off instead of OTA standard items to carry out immunology detection analysis from bacteriophage.
Further relate to application of the OTA antigenic epitopes with solid phase antigen or competition antigen in immunology detection analysis.
Further relate to application of the OTA antigenic epitopes as solid phase antigen in colloidal gold immunochromatographimethod detection and analysis.
Foregoing OTA antigenic epitopes can replace expensive and strong toxicity OTA standard items, and be used as competition antigen
Or solid-phase coating antigen is applied to OTA immunology detection, the antigenic epitope has similar to natural OTA molecules be immunized
Response characteristic, effect is very good.
The beneficial effects of the invention are as follows：OTA antigenic epitopes of the present invention can replace expensive and strong toxicity OTA
Standard items, and as competition antigen or solid-phase coating antigen be applied to OTA immunology detection, the antigenic epitope have with
The similar immune response characteristic of natural OTA molecules, effect is very good.Reduce harm of the OTA to health, saved into
This, with very high application value.
Brief description of the drawings
The indirect competitive ELISA standard curve that Fig. 1 is set up with OTA antigenic epitopes.OTA antigenic epitopes Ph-1
（KLGFQLHQPSWP）、Ph-7（FNLHQPIHNWPL）、Ph-18（AQFFQLHSQAYS）, Ph-5 (DGFQLHTPFSAK) with it is anti-
The IC of OTA antibody50Value is respectively 553,495,509 pg/ml and 1.03 ng/ml.
Embodiment
The affine elutriation and its identification of the OTA antigenic epitopes of embodiment 1.
1）The affine elutriation of OTA antigenic epitopes：Specific method is：Anti- OTA is diluted with 10 mM PBS (pH 7.4)
Monoclonal antibody, and 96 hole elisa Plates, 4 DEG C of overnight incubations are coated with the μ g/mL of final concentration 100.Second day with TBST (50 mM
NaCl, pH 7.5 include 0.1% Tween-20 (v/v)) washing 10 times after, add 300 μ l confining liquids（3% BSA-PBS）
4 DEG C are incubated 2 hours.Confining liquid is abandoned after 2 hours, is washed with TBST 5 times, 100 μ l phage peptide libraries are added per hole（Phage display technology
Show dodecapeptide storehouse, purchased from NEB companies, with 10 times of dilution bacteriophage stostes of TBS, about 1.0 × 1011pfu）, 22-26 DEG C of vibration is instead
Answer 1 hour.Uncombined bacteriophage is discarded, is washed with TBST 10 times, with reference to upper bacteriophage with 0.2 M Glycine-HCl
(pH 2.2) is eluted, and is neutralized immediately with the M Tris-HCl (pH 9.1) of 15 μ l 1.10 μ l wash-out bacteriophages are taken to survey drop
Degree, remaining E. coli ER2738 bacterial strain that logarithm early stage is grown to for infecting 20 mL is expanded.Use PEG/ within 3rd day
NaCl deposition and purification bacteriophages, and determine the titre of bacteriophage after amplification.
In the panning process of second, third wheel, coated anti-OTA MAb concentrations are respectively 75 μ g/mL and 50
μ g/mL, TBST concentration used is 0.25% and 0.5%, and remaining step is ibid.
2）The identification of positive phage clones：The random picking from the flat board that phage titre is determined after third round elutriation
20 bacteriophage spots, carry out the amplification of bacteriophage, using Immunofluorescent antibody detection method（Indirect Enzyme
Linked immunoasorbent assay, I-ELISA）The identification of positive phage clones is carried out, specific method is：It is first
First, anti-OTA monoclonal antibodies are diluted with 10 mM PBS (pH 7.4), 10 μ g/mL are coated with 96 hole elisa Plates, and 4 DEG C were incubated
Night.After second day is washed 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)), with containing 3% skimmed milk power
PBS closed, 37 DEG C be incubated 1 hour；Put into 100 μ l bacteriophages spots amplification liquid（1.0×1011pfu）, with original phagocytosis
Body peptide storehouse is as negative control, and 37 DEG C are incubated 1 hour；Add 1:The HRP of 5000 times of dilutions marks anti-M13 bacteriophages secondary antibody 100
μ l, 37 DEG C are incubated 1 hour；Add 100 μ l tmb substrate liquid, lucifuge colour developing 5min, ELIASA（Thermo Scientific
Multiskan FC）Read the absorption value at 450 nm.Choose OD450Phage clone of 2 times more than negative control is positive gram
It is grand.
3) identification of OTA antigenic epitopes：OTA antigenic epitopes are carried out using the method for indirect competitive ELISA
Identify, specific method is：Anti- OTA monoclonal antibodies, 10 μ g/mL coated elisa plates, 4 are diluted with 10 mM PBS (pH 7.4)
DEG C be incubated overnight；After second day is washed 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)), with containing 3%
The PBS of skimmed milk power is closed, and 37 DEG C are incubated 1 hour；Put into the bacteriophage gram that 50 μ l are accredited as the positive through indirect ELISA
It is grand（1.0×1011pfu）With 50 μ l OTA standard items（Concentration range is 0-20 ng/ml）, 37 DEG C are incubated 1 hour；Add 1:
The μ l of anti-M13 bacteriophages secondary antibody 100 of 5000 dilution HRP marks, 37 DEG C are incubated 1 hour；Add 100 μ l tmb substrate liquid, lucifuge
Develop the color 5min, reads OD450, anti-OTA monoclonal antibodies, and the bacteriophage that can be blocked by OTA standard items can be combined, is accredited as
OTA antigenic epitope.
The sequencing of the OTA antigenic epitope encoding genes of embodiment 2. and its determination of amino acid sequence
Show that the bacteriophage for there are OTA antigenic epitopes is expanded by being identified by indirect competitive ELISA, extract phagocytosis
The DNA sequencing template of body.Simplified process is as follows：Phage amplification is carried out, after first step centrifugation, by 800 μ l containing on bacteriophage
It is transferred to a new centrifuge tube clearly.Add 200 μ l PEG/NaCl precipitating phages.Precipitation is resuspended in 100 μ l iodide after centrifugation
Buffer solution (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI), adds 250 μ l absolute ethyl alcohols precipitation
DNA, precipitation is washed after centrifugation with 70% ethanol again（DNA sequencing template）.Precipitation is finally resuspended in 20 μ l aqua sterilisas, takes 2 μ l to enter
Row agarose gel electrophoresis are analyzed；5 μ L bacteriophages templates are taken to carry out DNA sequencing, its -96 gIII sequencing primer is：5’-HOCCC TCA TAG TTA GCG TAA CG-3’.OTA antigenic epitopes can be obtained according to DNA sequencing result and password sublist
Amino acid sequence.Their amino acid sequence is as follows：KLGFQLHQPSWP, FNLHQPIHNWPL, AQFFQLHSQAYS or
DGFQLHTPFSAK。
Application of the OTA antigenic epitopes of embodiment 3. as competition antigen in ELISA
(1) sample extraction
Weigh 5g samples（Cereal and its relevant food）, add 25 milliliter of 60 % methanol-PBS solution, 200 rpm
Vibration 5 minutes；After extract solution is filtered with No. 1 filter paper of whatman, 1 milliliter of filtrate is taken to add 4 milliliters of PBS（Phosphate
Buffer solution, pH=7.2）After mixing, as sample extracting solution is stand-by.
（2）Coating and closing
With the anti-OTA monoclonal antibodies of 10 mM PBS (pH 7.4) dilutions, 10 μ g/mL coated elisa plates, 4 DEG C were incubated
Night.After second day is washed 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)), with containing 3% skimmed milk power
PBS closed, it is stand-by with PBST board-washings 6 times after 37 DEG C are incubated 1 hour.
（3）The foundation of standard curve
Take out through step（2）The lath handled well, putting into 50 μ l displayings respectively per hole has biting for OTA antigenic epitopes
Thalline（1.0×1011pfu）With a series of 50 μ l OTA standard items of various concentrations, 37 DEG C are incubated 1 hour.Add 1:5000
The anti-M13 bacteriophages secondary antibody of HRP marks is diluted, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450.It is dense with OTA
Degree logarithm is abscissa, Percentage bound（Add the OD in OTA hole450/ do not add OTA hole OD450×100%）For ordinate, build
Vertical indirect competition standard curve.As a result show that standard curve is S-type, linear dependence is preferable（Fig. 1）.Such as Fig. 1, with OTA antigens
The indirect competitive ELISA standard curve that mimic epitope is set up.OTA antigenic epitopes Ph-1（KLGFQLHQPSWP）、Ph-7
（FNLHQPIHNWPL）、Ph-18（AQFFQLHSQAYS）, Ph-5 (DGFQLHTPFSAK) and anti-OTA antibody IC50 values difference
For 553,495,509 pg/ml and 1.03 ng/ml.
（4）The detection of sample
Take out through step（2）The lath handled well, putting into 50 μ l displayings respectively per hole has biting for OTA antigenic epitopes
Thalline（1.0×1011pfu）With testing sample extract solution, 37 DEG C are incubated 1 hour.Add 1:The anti-M13 of 5000 dilution HRP marks
Bacteriophage secondary antibody, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450, calculations incorporated rate, and it is bent according to standard
Line, retrodicts out the content of OTA in sample.
Application of the OTA antigenic epitopes of embodiment 4. as solid phase antigen in ELISA
(1) sample extraction
Weigh 5g samples（Cereal and its relevant food）, add 25 milliliter of 60 % methanol-PBS solution, 200 rpm
Vibration 5 minutes；After extract solution is filtered with No. 1 filter paper of whatman, 1 milliliter of filtrate is taken to add 4 milliliters of PBS（Phosphate
Buffer solution, pH=7.2）After mixing, as sample extracting solution is stand-by.
（2）Coating and closing
Diluting displaying with 10 mM PBS (pH 7.4) has the bacteriophage of OTA antigenic epitopes（2.0×1011pfu）,
100 microlitres are coated in ELISA Plate, 4 DEG C of overnight incubations.Second day with PBST (10 mM PBS, 0.05% Tween-20 (v/
V) after) washing 3 times, closed, after 37 DEG C of incubations 1 hour, treated for 6 times with PBST board-washings with the PBS containing 3% skimmed milk power
With.
（3）The foundation of standard curve
Take out through step（2）The lath handled well, the anti-OTA monoclonal antibodies of 50 μ l are put into per hole respectively（0.5 ng/
ml）With a series of 50 μ l OTA standard items of various concentrations, 37 DEG C are incubated 1 hour.Add 1:The sheep of 2000 dilution HRP marks
Anti- mouse IgG secondary antibodies, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450.Using OTA log concentrations as abscissa, knot
Conjunction rate（Add the OD in OTA hole450/ do not add OTA hole OD450×100%）For ordinate, indirect competition standard is set up bent
Line.
（4）The detection of sample
Take out through step（2）The lath handled well, the anti-OTA monoclonal antibodies of 50 μ l are put into per hole respectively（0.5 ng/
ml）With a series of 50 μ l OTA standard items of various concentrations, 37 DEG C are incubated 1 hour.Add 1:The sheep of 2000 dilution HRP marks
Anti- mouse IgG secondary antibodies, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450.Using OTA log concentrations as abscissa, knot
Conjunction rate（Add the OD in OTA hole450/ do not add OTA hole OD450×100%）For ordinate, indirect competition standard is set up bent
Line.
Application of the OTA antigenic epitopes of embodiment 5. as solid phase antigen in highly-pathogenic avian influenza
(1) sample extraction
Weigh 5g samples（Cereal and its relevant food）, add 25 milliliter of 60 % methanol-PBS solution, 200 rpm
Vibration 5 minutes；After extract solution is filtered with No. 1 filter paper of whatman, 1 milliliter of filtrate is taken to add 4 milliliters of PBS（Phosphate
Buffer solution, pH=7.2）After mixing, as sample extracting solution is stand-by.
（2）Bacteriophage and the dot matrix of control line
Diluting displaying with 10 mM PBS (pH 7.4) has the bacteriophage of OTA antigenic epitopes（2.0×1011pfu）,
Bacteriophage is lined on nitrocellulose filter with dot matrix instrument or micropipettor（Aperture 0.2-0.45 microns）, it is used as detection
Line；The sheep anti-mouse igg secondary antibody that 0.5 mg/ml HRP is marked, same cellulose nitrate is lined with dot matrix instrument or micropipette
On plain film（Positioned at the top of detection line, distance is more than 5 millimeters）, it is used as control line.
（3）Colloid gold label OTA antibody
Colloidal gold solution is added dropwise in OTA antibody（pH=8.2）In, stirred in drop, after 30 minutes, take 1% PEG to add
Enter in above-mentioned solution, continue to add 10% BSA solution of 1/10th volumes after stirring 15 minutes, after stirring 15 minutes, stand
30 minutes, supernatant is removed after centrifugation, the OTA antibody-solutions of colloid gold label are obtained.
（4）The assembling of colloidal-gold detecting-card
The OTA antibody point of colloid gold label is sprayed in glue gold pad（1.0 mcg/ml）, by sample pad, glue gold pad, point
The nitrocellulose filter and absorption paper of battle array detection line and control line are assembled, and are cut into test strips, is fitted into detect block in it is stand-by.
（5）The detection of sample
Sample extracting solution is added in sample pad, 10 minutes are stood, if containing OTA and detecting examination more than collaurum in sample
The detection threshold value of paper, then detection line region is not developed the color, and control line region is developed the color；If not containing OTA in sample and less than colloid
The detection threshold value of golden Test paper, then detection line region colour developing, control line region is also developed the color.If control line region is not developed the color, table
Bright test strips failure.
A large amount of preparations of the OTA antigenic epitopes of embodiment 6
（1）In the way of Phage amplification
It will show that the bacteriophage for having OTA antigenic epitopes is added to 20 ml to be inoculated with ER 2738 culture, 37
Spend the h of 220 rpm shaken cultivations 4.5.Culture is transferred in another centrifuge tube, 4 DEG C of 10000 rpm centrifuges 10 min, will be upper
The clear % of top 80 is transferred in a fresh tube, is added at the PEG/NaCl of 1/6 volume, 4 DEG C and is stood 120 min.4℃ 10000
Rpm centrifugations PEG/NaCL stands the min of solution 15.Supernatant is abandoned, residual supernatant is sucked after of short duration centrifugation.1mL TBS are added to enter
Row is resuspended, as Phage amplification liquid.
（2）Prepared in the way of OTA antigenic epitopes-fusion protein
A.PCR expands the external source encoding gene of OTA antigenic epitopes
PCR reaction systems： (50 µL)
10 × Pyrobest Buffer (Mg2+ plus) 5µL
dNTP Mixture (each for 2.5 mM) 4µL
M13KE insert extension primer (10 mM） 1µL
-96 gIII sequencing primer (10 mM) 1µL
The μ L of phage DNA template 1
Pyrobest DNA Polymerase 0.5µL
Sterilize the μ L of ddH2O 37.5
PCR reaction conditions：95 DEG C of 5 min, then 95 DEG C of 30 sec, 55 DEG C of 30 sec, 72 DEG C of 40sec,
72 DEG C of 10 min totally 30 cycles
PCR products are purified using PCR products QIAquick Gel Extraction Kit, trace dna quantitative instrument is quantified.OTA antigens of the present invention
The coding gene sequence of mimic epitope is corresponded to respectively：
AAGCTTGGGTTTCAGTTGCATCAGCCTAGTTGGCCG、
TTTAATTTGCATCAGCCGATTCATAATTGGCCGCTG、GCTCAGTTTTTTTAGCTGCATTCGCAGGCGTATTCG、
GATGGTTTTCAGTTGCATACTCCTTTTTCTGCTAAG
B. the double digestion of external source encoding gene and expression vector
The external source code gene of ACC65I and Eag I enzymes and expression vector is respectively adopted（PMAl-pIII, NEB company,
MBP fusion proteins can be expressed）Carry out double digestion.
C. after digestion product connection and conversion
By plasmid pMal-PIII and purpose fragment with 1: 10（Mol ratio）Mix, 12 h connected in 16 DEG C of water-baths,
Take 10 μ L connection products to add in 100 μ L competent cells TB1, fully mix.After the min of ice bath 30,42 DEG C of water-bath heat shocks
90 s, add 600 μ L LB liquid mediums immediately after the min of ice bath 5,37 DEG C, and 200 rpm cultivate 1 h, 10000 rpm from
The min of the heart 2, sucks supernatant and leaves and takes about 200 μ L, be coated on LB-A solids（Ampr）In culture medium, 37 DEG C of incubated overnights are obtained
Positive colony.
The expression of OTA antigenic epitope-MBP fusion proteins
By the positive clone molecule of above-mentioned acquisition, a single bacterium colony is chosen from flat board and is inoculated in 5 mL LB-A, 0.2% sucrose,
37 DEG C, 220 r/min, shaken cultivation is stayed overnight, and overnight culture is pressed into 1 % inoculum concentrations（v/v）It is inoculated in 50 mL LB-A, 0.2
In % sucrose culture mediums, 3 bottles, 37 DEG C, 220 r/min shaken cultivations, when culture bacterial concentration OD600 reaches 0.6 are inoculated with respectively
When, IPTG to final concentration of 0.2 mmol/L, 220 r/min shaken cultivations, by inducer are added into three bottles of cultures（PEG
Solution）In 4 DEG C, 4000 g, 20 min of centrifugation collect bacterial sediment, abandon supernatant.Cell is resuspended in the mM Tris- of 400 mL 30
HCl, 20% sucrose, pH 8.0 (80 mL/g wet cell weights) adds EDTA to 1 mM, and 5-10 min, 8000 are shaken at room temperature
G, centrifuges 20 min by 4 DEG C, abandons supernatant, and precipitation is resuspended in 5 mM MgSO4 of 400 ml precoolings, 10 min, 8000 are shaken on ice
G, 4 DEG C, centrifuges 20 min, retains supernatant, the M Tris-HCl, pH 7.4 of 8 mL 1 is added into supernatant, obtain OTA antigens
Mimic epitope-MBP fusion proteins.
SEQUENCE LISTING
<110>University Of Nanchang
<120>Simulate antigenic epitope and its application of ochratoxin A
<130> 1
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 12
<212> PRT
<213>Artificial sequence
<400> 1
Lys Leu Gly Phe Gln Leu His Gln Pro Ser Trp Pro
1 5 10
<210> 2
<211> 12
<212> PRT
<213>Artificial sequence
<400> 2
Phe Asn Leu His Gln Pro Ile His Asn Trp Pro Leu
1 5 10
<210> 3
<211> 12
<212> PRT
<213>Artificial sequence
<400> 3
Ala Gln Phe Phe Gln Leu His Ser Gln Ala Tyr Ser
1 5 10
<210> 4
<211> 12
<212> PRT
<213>Artificial sequence
<400> 4
Asp Gly Phe Gln Leu His Thr Pro Phe Ser Ala Lys
1 5 10
<210> 5
<211> 36
<212> DNA
<213>Artificial sequence
<400> 5
aagcttgggt ttcagttgca tcagcctagt tggccg 36
<210> 6
<211> 36
<212> DNA
<213>Artificial sequence
<400> 6
tttaatttgc atcagccgat tcataattgg ccgctg 36
<210> 7
<211> 36
<212> DNA
<213>Artificial sequence
<400> 7
gctcagtttt tttagctgca ttcgcaggcg tattcg 36
<210> 8
<211> 36
<212> DNA
<213>Artificial sequence
<400> 8
gatggttttc agttgcatac tcctttttct gctaag 36
Claims (7)
1. simulate the antigenic epitope of ochratoxin A, it is characterised in that amino acid sequence is：DGFQLHTPFSAK.
2. encode the nucleotides of antigenic epitope amino acid sequence described in claim 1.
3. nucleotides as claimed in claim 2, sequence is corresponded to：
GATGGTTTTCAGTTGCATACTCCTTTTTCTGCTAAG。
4. the preparation method of antigenic epitope as claimed in claim 1, it is characterised in that pass through Phage amplification, chemical synthesis
Or the mode of genetic engineering recombination expression is largely prepared；The Phage amplification refers to have ochratoxin A to resist displaying
The bacteriophage of former mimic epitope, by way of biology amplification, amount reproduction production displaying has ochratoxin A antigen simulation table
The bacteriophage particles of position；The chemical synthesis refers to according to mimic epitope mimic epitope amino acid sequence, passes through chemically synthesized polypeptide
Mode carry out Peptide systhesis；The mode of genetic engineering recombination expression refers to the gene of coding simulation epitope, by gram
The grand a large amount of preparations for carrying out ochratoxin A antigenic epitope to expression vector in the form of polypeptide-fusion protein.
5. the ochratoxin A in detection food as immunology detection analytical reagent of antigenic epitope described in claim 1
Application.
6. application as claimed in claim 5, it is characterised in that ochratoxin A antigenic epitope is anti-with solid phase antigen or competition
Original shape formula as immunology detection analytical reagent detection food in ochratoxin A application.
7. such as application as claimed in claim 5, it is characterised in that ochratoxin A antigenic epitope is made in solid phase antigen form
The application of reagent ochratoxin A in detection food is tested and analyzed for colloidal gold immunochromatographimethod.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410550651.8A CN104530195B (en) | 2013-03-06 | 2013-03-06 | Simulate antigenic epitope and its application of ochratoxin A |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310071736.3A CN103145808B (en) | 2013-03-06 | 2013-03-06 | Antigen mimic epitope of ochratoxin A and application thereof |
| CN201410550651.8A CN104530195B (en) | 2013-03-06 | 2013-03-06 | Simulate antigenic epitope and its application of ochratoxin A |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310071736.3A Division CN103145808B (en) | 2013-03-06 | 2013-03-06 | Antigen mimic epitope of ochratoxin A and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104530195A CN104530195A (en) | 2015-04-22 |
| CN104530195B true CN104530195B (en) | 2017-07-28 |
Family
ID=52845859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410550651.8A Expired - Fee Related CN104530195B (en) | 2013-03-06 | 2013-03-06 | Simulate antigenic epitope and its application of ochratoxin A |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104530195B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116655740B (en) * | 2023-05-26 | 2023-12-08 | 海南大学 | Antigen mimic peptide of ochratoxin A, encoding nucleic acid molecule and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101633932A (en) * | 2009-05-31 | 2010-01-27 | 江西科技师范学院 | Preparation method and application of high-density molecular simulation epitope peptide of ochratoxin A |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020137159A1 (en) * | 2000-08-31 | 2002-09-26 | Si Lok | Human phermone polypeptides |
-
2013
- 2013-03-06 CN CN201410550651.8A patent/CN104530195B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101633932A (en) * | 2009-05-31 | 2010-01-27 | 江西科技师范学院 | Preparation method and application of high-density molecular simulation epitope peptide of ochratoxin A |
Non-Patent Citations (2)
| Title |
|---|
| 利用噬菌体随机肽库筛选抗原模拟表位的研究进展;裴亚峰等;《河南农业科学》;20121015;第41卷(第10期);第15页左栏倒数第1段 * |
| 随机肽库筛选赭曲霉毒素A模拟表位及其应用;刘仁荣等;《中国公共卫生》;20050810;第21卷(第8期);摘要、第944-945页材料与方法部分，第946页讨论部分，表2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104530195A (en) | 2015-04-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104530194B (en) | Antigenic epitope for ochratoxin A and its application | |
| CN103848895B (en) | The linear dodecapeptide antigenic epitope of aflatoxin B1 and its application | |
| CN104327166B (en) | The dodecapeptide antigenic epitope of ochratoxin A and its application | |
| CN104530195B (en) | Simulate antigenic epitope and its application of ochratoxin A | |
| CN103044527B (en) | Antigenic mimic epitope of gentamycin and application thereof | |
| CN103145808B (en) | Antigen mimic epitope of ochratoxin A and application thereof | |
| CN108387740A (en) | A kind of epitope peptide, preparation method and the application of simulation Enrofloxacin | |
| CN104311637B (en) | Simulation fumonisins B1Antigenic epitope and its application | |
| CN104356207B (en) | Fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN104311634B (en) | Aflatoxin B1Antigenic epitope AM 1 and its application | |
| CN103044526B (en) | Antigenic mimic epitope of vardenafil and application thereof | |
| CN104356208B (en) | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN104311638B (en) | Fumonisins B can be simulated1Antigenic epitope and its application | |
| CN104311635B (en) | For fumonisins B1Antigenic epitope and its application | |
| CN103848896B (en) | The antigenic epitope Ph5 of bisphenol-A and application thereof | |
| CN104788543B (en) | A kind of zearalenone antibody analog and its application based on polypeptide | |
| CN104311636B (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN103848898B (en) | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof | |
| CN103848897B (en) | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof | |
| CN104119425B (en) | The antigenic epitope of simulation norfloxacin and application thereof | |
| CN108358996A (en) | A kind of epitope peptide, preparation method and the application of simulation diethylstilbestrol | |
| CN108373495A (en) | A kind of epitope peptide, preparation method and the application of simulation dienestrol | |
| CN103342739B (en) | Antigenic mimic epitope of fumonisin B1 and application thereof | |
| CN103848899B (en) | The antigenic epitope Ph15 of bisphenol-A and application thereof | |
| CN103965290B (en) | The heptapeptide antigenic epitope of norfloxacin and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170728 |