CN103848897B - The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof - Google Patents
The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof Download PDFInfo
- Publication number
- CN103848897B CN103848897B CN201410053094.9A CN201410053094A CN103848897B CN 103848897 B CN103848897 B CN 103848897B CN 201410053094 A CN201410053094 A CN 201410053094A CN 103848897 B CN103848897 B CN 103848897B
- Authority
- CN
- China
- Prior art keywords
- dihydroxyphenyl propane
- antigenic epitope
- phage
- antigen
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to biological technical field, relate to the antigenic epitope of dihydroxyphenyl propane, its aminoacid sequence is YPPHNWDYSGAA.Dihydroxyphenyl propane antigenic epitope of the present invention can the expensive and dihydroxyphenyl propane standard substance of strong toxicity of fictitious hosts, and the immunology detection of dihydroxyphenyl propane is applied to as competition antigen or solid-phase coating antigen, the mimic epitopes of this antigen has the immune response characteristic with natural dihydroxyphenyl propane molecular mimicry, and effect is very good.Decrease the harm of Effects of Bisphenol A on Human body health, saved cost, there is very high using value.
Description
Technical field
The invention belongs to biological technical field, be specifically related to dihydroxyphenyl propane antigenic epitope and application thereof.
Technical background
Dihydroxyphenyl propane (BisphenolA, BPA) is a kind of chemical materials, is used for producing breakage-proof plastics.Data shows, dihydroxyphenyl propane belongs to cytotoxic chemical thing.Animal experiment finds that dihydroxyphenyl propane has the estrogenic effect of simulation, even if very low dosage also can make, animal produces female sexual prematurity, sperm count declines, the effect of prostate gland growth.In addition, according to the literature, dihydroxyphenyl propane has certain embryotoxicity and teratogenecity.Dihydroxyphenyl propane can cause endocrine disturbance, and threaten the health of fetus and children, the obesity that cancer and metabolic disturbance cause also is considered to relevant therewith.In human habitat, dihydroxyphenyl propane is ubiquitous, and from drink bottle, medicine equipment to food product pack inside, a lot of plastics all contain dihydroxyphenyl propane.Even if carrying out detecting to dihydroxyphenyl propane is its effective means endangered of prevention and corntrol.
Liquid phase chromatography, vapor-phase chromatography, spectroscopic analysis, electrochemical methods, immunology detection etc. are had at present to the detection method of dihydroxyphenyl propane.Although aforesaid method is sensitive, accurate, reliable, required equipment is expensive and working cost is high, carries out on a large scale in being difficult to work in unit of primary level.The advantages such as immunological detection method is highly sensitive with it, easy to detect, with low cost are used widely in the detection of dihydroxyphenyl propane.But the method must use standard substance, not only increases testing cost, and testing staff and environment are easily worked the mischief, constrain application and the popularization of immunological method to a certain extent.In view of this, people start to adopt antiidiotypic antibody and antigenic epitope technology to realize substituting of harmful small-molecule substance standard substance, and make some progress.The principal feature of phage display peptide library technology effectively to filter out the phage-displayed polypeptides with target target body specific combination, this technology exploring the interphase interaction binding site of acceptor and part, seek the bioactive ligand molecular of high-affinity, explore agnoprotein matter space structure epi-position, be widely used in the development of new generation vaccine etc.
This aspect by using phage display peptide library technology, filter out from peptide storehouse can with the polypeptide (antigenic epitope) of target molecule (anti-bisphenol A monoclonal antibody) specific binding.This antigenic epitope has the immune response characteristic with natural dihydroxyphenyl propane molecular mimicry, by the dihydroxyphenyl propane antigenic epitope obtained, expensive and the dihydroxyphenyl propane standard substance of strong toxicity of one fictitious hosts, and the immunology detection of dihydroxyphenyl propane is applied to as competition antigen or solid-phase coating antigen.
Summary of the invention
The object of the present invention is to provide antigenic epitope and the application thereof of dihydroxyphenyl propane.
The present invention take anti-bisphenol A monoclonal antibody as target molecule, by target molecule solid-phase coating on enzyme plate, drops into phage random and shows dodecapeptide storehouse, carry out affine elutriation, obtain the antigenic epitope Ph1 of dihydroxyphenyl propane.Aminoacid sequence is as follows: YPPHNWDYSGAA.
The invention still further relates to the nucleotide sequence of above-mentioned antigenic epitope aminoacid sequence of encoding, correspond to respectively: TATCCTCCTCATAATTGGGATTATTCGGGTGCGGCT.
In above-mentioned antigenic epitope (polypeptide) structure, capitalization English letter represents the one of 21 kinds of known natural L-form amino-acid residues or its D-type isomer respectively, namely C represents cysteine residues, D represents asparagicacid residue, P represents proline residue, R represents arginine residues, K represents lysine residue, H represents histidine residues, I represents isoleucine residues, V represents valine residue, Y represents tyrosine residues, S represents serine residue, F represents phenylalanine residue, E represents glutaminic acid residue, M represents methionine residues, G represents glycine residue, L represents leucine residue, Q represents glutamine residue, W representative color histidine residue, N represents asparagine residue, A represents alanine residue, T represents threonine residues.
The preparation method of described antigenic epitope, the mode recombinant expressed by Phage amplification, chemosynthesis or genetically engineered is prepared in a large number; Described Phage amplification refers to will show the phage having dihydroxyphenyl propane antigenic epitope, the mode increased by biology, and amount reproduction produces the bacteriophage particles shown and have dihydroxyphenyl propane antigenic epitope; Described chemosynthesis refers to, according to mimic epitopes mimic epitopes aminoacid sequence, carry out Peptide systhesis by the mode of chemically synthesized polypeptide; The recombinant expressed mode of described genetically engineered refers to the gene of coding simulation epi-position, by being cloned into expression vector, carries out a large amount of preparations of dihydroxyphenyl propane antigenic epitope with the form of polypeptide-fusion rotein.
The invention still further relates to the application of described dihydroxyphenyl propane antigenic epitope in immunology detection is analyzed.The type of immunology detection comprises the immune analysis type of detection based on Ag-Ab specific reaction such as MBP enzyme linked immuno-adsorbent assay, colloidal gold immunochromatographimethod, immunodotting hybridization.
Dihydroxyphenyl propane antigenic epitope (YPPHNWDYSGAA) of the present invention is when applying, the mimic epitopes of synthesis can be used for immunology detection analysis, the bacteriophage particles of dihydroxyphenyl propane antigenic epitope (polypeptide) displaying obtained by Phage amplification is had to be directly used in analyzing and testing, certainly, also dihydroxyphenyl propane antigenic epitope can be scaled off replacement dihydroxyphenyl propane standard substance to carry out immunology detection analysis from phage.
Also relate to the application in immunology detection is analyzed with solid phase antigen or competition antigen of dihydroxyphenyl propane antigenic epitope.
Also relate to dihydroxyphenyl propane antigenic epitope and detect the application in analyzing as solid phase antigen at colloidal gold immunochromatographimethod.
Aforementioned dihydroxyphenyl propane antigenic epitope can replace the expensive and dihydroxyphenyl propane standard substance of strong toxicity, and the immunology detection of dihydroxyphenyl propane is applied to as competition antigen or solid-phase coating antigen, this antigenic epitope has the immune response characteristic of natural dihydroxyphenyl propane molecular mimicry, and effect is very good.
The invention has the beneficial effects as follows: dihydroxyphenyl propane antigenic epitope of the present invention can replace the expensive and dihydroxyphenyl propane standard substance of strong toxicity, and the immunology detection of dihydroxyphenyl propane is applied to as competition antigen or solid-phase coating antigen, this antigenic epitope has the immune response characteristic with natural dihydroxyphenyl propane molecular mimicry, and effect is very good.Decrease the harm of Effects of Bisphenol A on Human body health, saved cost, there is very high using value.
Accompanying drawing explanation
The indirect competitive ELISA typical curve that Fig. 1 sets up with dihydroxyphenyl propane antigenic epitope.Dihydroxyphenyl propane antigenic epitope Ph-1(YPPHNWDYSGAA) be respectively 30.3pg/ml with the IC50 value of anti-bisphenol A antibody.
Embodiment
The affine elutriation of embodiment 1. dihydroxyphenyl propane antigenic epitope and qualification thereof
The affine elutriation of dihydroxyphenyl propane antigenic epitope: concrete grammar is: with 10mMPBS(pH7.4) dilute anti-bisphenol A monoclonal antibody, and wrap by 96 hole enzyme plates with final concentration 75 μ g/mL, 4 DEG C of overnight incubation.Within second day, comprise 0.1%Tween-20(v/v with TBST(50mMNaCl, pH7.5)) add 300 μ L confining liquid (3%BSA-PBS) 4 DEG C and hatch 2 hours after washing 10 times.Abandon confining liquid after two hours, doubly dilute phage stoste with TBS10, about 1.0 × 10
11pfu).25 DEG C shake reaction 2 hours.Discard unconjugated phage, wash 10 times with TBST, in conjunction with on phage 0.2MGlycine-HCl(pH2.2) wash-out, and use 15 μ L1MTris-HCl(pH9.1 immediately) neutralization.Get 10 μ L wash-out bacteriophages survey titres, remaining for infect 20mL grow to logarithm early stage E.ColiER2738 bacterial strain increase.3rd day with PEG/NaCl deposition and purification phage, and the titre of phage after measuring amplification.
In the panning process that second, third is taken turns, the anti-bisphenol A monoclonal antibody concentration of bag quilt is respectively 50 μ g/mL and 25 μ g/mL, and TBST concentration used is 0.3% and 1.0%, and all the other steps are the same.
2) qualification of positive phage clones: measure random picking 20 phage spots the flat board of phage titre after third round elutriation, carry out the amplification of phage, adopt Immunofluorescent antibody detection method (IndirectEnzymeLinkedimmunoasorbentassay, I-ELISA) qualification of positive phage clones is carried out, concrete grammar is: first, with 10mMPBS(pH7.4) dilute anti-bisphenol A monoclonal antibody, 10 μ g/mL, wrap by 96 hole enzyme plates, 4 DEG C of overnight incubation.Second day with PBST(10mMPBS, 0.05%Tween-20(v/v)) after washing 3 times, close with the PBS containing 3% skim-milk, hatch 1 hour for 37 DEG C; Drop into 100 μ L phage spot amplification liquid (1.0 × 10
11pfu), using naive phage peptide storehouse as negative control, hatch 1 hour for 37 DEG C; Add the HRP that 1:5000 doubly dilutes and mark the anti-100 μ L of anti-M13 phage two, hatch 1 hour for 37 DEG C; Add 100 μ LTMB substrate solutions, lucifuge colour developing 5min, microplate reader (ThermoScientificMultiskanFC) reads the absorption value at 450nm place.Choosing the phage clone that OD450 is greater than negative control 2 times is positive colony.
3) qualification of dihydroxyphenyl propane antigenic epitope: adopt the method for indirect competitive ELISA to carry out the qualification of dihydroxyphenyl propane antigenic epitope, concrete grammar is: with 10mMPBS(pH7.4) dilute anti-bisphenol A monoclonal antibody, 10 μ g/mL coated elisa plates, 4 DEG C of overnight incubation; Second day with PBST(10mMPBS, 0.05%Tween-20(v/v)) after washing 3 times, close with the PBS containing 3% skim-milk, hatch 1 hour for 37 DEG C; Drop into 50 μ L and be accredited as positive phage clone (1.0 × 10 through indirect ELISA
11pfu) and 50 μ L dihydroxyphenyl propane standard substance (concentration range is 0-2ng/mL), hatch 1 hour for 37 DEG C; Add the HRP that 1:5000 doubly dilutes and mark the anti-100 μ L of anti-M13 phage two, hatch 1 hour for 37 DEG C; Add 100 μ LTMB substrate solutions, lucifuge colour developing 5min, reads OD450, can in conjunction with anti-bisphenol A monoclonal antibody, and can the phage that blocks by dihydroxyphenyl propane standard substance, be accredited as the antigenic epitope of dihydroxyphenyl propane.
The order-checking of case study on implementation 2. dihydroxyphenyl propane antigenic epitope encoding gene and the determination of aminoacid sequence thereof
Embodiment 1 is shown have the phage of dihydroxyphenyl propane antigenic epitope to increase through indirect competitive ELISA qualification, extracts the DNA sequencing template of phage.Simplified process is as follows: carry out Phage amplification, after centrifugal at first, 800 μ L is proceeded to a new centrifuge tube containing phage supernatant.Add 200 μ LPEG/NaCl precipitating phage.After centrifugal, precipitation is resuspended in 100 μ L iodide damping fluid (10mMTris-HCl(pH8.0), 1mMEDTA, 4MNaCl), add 250 μ L dehydrated alcohol precipitation DNA, again by 70% washing with alcohol precipitation (DNA sequencing template) after centrifugal.Precipitation is finally resuspended in 20 μ L aqua sterilisas, gets 2 μ L and carries out agarose gel electrophoresis analysis; Get 5 μ L phage templates and carry out DNA sequencing, its-96g III sequencing primer is: 5 '-HOCCCTCATAGTTAGCGTAACG-3 '.The aminoacid sequence Ph1 of dihydroxyphenyl propane antigenic epitope can be obtained according to DNA sequencing result and password sublist.Aminoacid sequence is as follows: YPPHNWDYSGAA.
Case study on implementation 3 dihydroxyphenyl propane antigenic epitope is as the application of competition antigen in ELISA
(1) sample extraction
Take 5g sample (cereal and relevant food thereof), add the methyl alcohol-PBS solution of 25 milliliter 60%, 200rpm shakes 5min; After extracting solution whatman1 filter paper is filtered, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mixing after, be sample extracting solution, stand-by.
(2) wrap by and close
With 10mMPBS(pH7.4) dilute anti-bisphenol A monoclonal antibody, 10 μ g/mL coated elisa plates, 4 DEG C of overnight incubation.Second day with PBST(10mMPBS, 0.05%Tween-20(v/v)) after washing 3 times, close with the PBS containing 3% skim-milk, 37 DEG C hatch 1 hour after, wash plate 6 times with PBST stand-by.
(3) foundation of typical curve
Take out the lath handled well through step (2), every hole is dropped into 50 μ L respectively and is shown the phage (1.0 × 10 having dihydroxyphenyl propane antigenic epitope
11pfu) and 50 μ L dihydroxyphenyl propane standard substance of a series of different concns, 1 hour is hatched for 37 DEG C.The anti-M13 phage two adding 1:5000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD450 is read.With bisphenol A concentration to logarithm for X-coordinate, combination rate (OD450/ adding the hole of dihydroxyphenyl propane does not add OD450 × 100% in the hole of dihydroxyphenyl propane) is ordinate zou, sets up indirect competition typical curve.Result display typical curve is S-type, and linear dependence better (Fig. 1).As Fig. 1, the indirect competitive ELISA typical curve set up with dihydroxyphenyl propane antigenic epitope.Dihydroxyphenyl propane antigenic epitope Ph-1(YPPHNWDYSGAA) be respectively 30.3pg/ml with the IC50 value of anti-bisphenol A antibody.
(4) detection of sample
Take out the lath handled well through step (2), every hole is dropped into 50 μ L respectively and is shown the phage (1.0 × 10 having dihydroxyphenyl propane antigenic epitope
11pfu) and testing sample extracting solution, 1 hour is hatched for 37 DEG C.The anti-M13 phage two adding 1:5000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD450 is read, calculations incorporated rate, and according to typical curve, the content of sample dihydroxyphenyl propane of retrodicting out.
Embodiment 4. dihydroxyphenyl propane antigenic epitope is as the application of solid phase antigen in ELISA
Sample extraction
Take 5g sample (cereal and relevant food thereof), add the methyl alcohol-PBS solution of 25 milliliter 60%, 200rpm shakes 5 minutes; After extracting solution whatman1 filter paper is filtered, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mixing after, be sample extracting solution, stand-by.
(2) wrap by and close
With 10mMPBS(pH7.4) dilute the phage (2.0 × 10 of showing and having dihydroxyphenyl propane antigenic epitope
11pfu), 100 microlitres are coated in enzyme plate, 4 DEG C of overnight incubation.Second day with PBST(10mMPBS, 0.05%Tween-20(v/v)) after washing 3 times, close with the PBS containing 3% skim-milk, 37 DEG C hatch 1 hour after, wash plate 6 times with PBST stand-by.
(3) foundation of typical curve
Take out the lath handled well through step (2), 50 μ L dihydroxyphenyl propane standard substance of 50 μ L anti-bisphenol A monoclonal antibodies (2ng/ml) and a series of different concns are dropped in every hole respectively, hatch 1 hour for 37 DEG C.The sheep anti-mouse igg two adding 1:2000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD450 is read.With bisphenol A concentration logarithm for X-coordinate, combination rate (OD450/ adding the hole of the dihydroxyphenyl propane in the hole of dihydroxyphenyl propane does not add OD450 × 100% in the hole of dihydroxyphenyl propane) is ordinate zou, sets up indirect competition typical curve.
(4) detection of sample
Take out the lath handled well through step (2), 50 μ L dihydroxyphenyl propane standard substance of 50 μ L anti-bisphenol A monoclonal antibodies (2ng/ml) and a series of different concns are dropped in every hole respectively, hatch 1 hour for 37 DEG C.The sheep anti-mouse igg two adding 1:2000 dilution HRP mark resists, and hatches 1 hour for 37 DEG C.Then with tmb substrate colour developing, OD450 is read.With bisphenol A concentration logarithm for X-coordinate, combination rate (OD450/ adding the hole of the dihydroxyphenyl propane in the hole of dihydroxyphenyl propane does not add OD450 × 100% in the hole of dihydroxyphenyl propane) is ordinate zou, sets up indirect competition typical curve.
Embodiment 5. dihydroxyphenyl propane antigenic epitope is as the application of solid phase antigen in colloid gold immune series of strata are analyzed
(1) sample extraction
Take 5g sample (cereal and relevant food thereof), add the methyl alcohol-PBS solution of 25 milliliter 60%, 200rpm shakes 5 minutes; After extracting solution whatman1 filter paper is filtered, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mixing after, be sample extracting solution, stand-by.
(2) dot matrix of phage and control line
With 10mMPBS(pH7.4) dilute the phage (2.0 × 10 of showing and having dihydroxyphenyl propane antigenic epitope
11pfu), phage is lined (aperture 0.2-0.45 micron) on nitrocellulose filter, as detection line with dot matrix instrument or micropipet; The sheep anti-mouse igg two marked by the HRP of 0.5mg/ml resists, and lines (be positioned at the top of detection line, distance is greater than 5 millimeters) on same nitrocellulose filter, as control line with dot matrix instrument or micropipette.
(3) colloid gold label dihydroxyphenyl propane antibody
Dihydroxyphenyl propane antibody is dropwise added in colloidal gold solution (pH=8.2), drip while stir, after 30 minutes, getting 1%PEG adds in above-mentioned solution, continue stirring adds 1/10th volumes 10%BSA solution after 15 minutes, stir after 15 minutes, leave standstill 30 minutes, remove supernatant after centrifugal, obtain the dihydroxyphenyl propane antibody-solutions of colloid gold label.
(4) assembling of colloidal-gold detecting-card
The dihydroxyphenyl propane antibody point of colloid gold label is sprayed on glue gold pad upper (1.0 mcg/ml), by sample pad, glue gold pad, nitrocellulose filter and the blotter of dot matrix detection line and control line are assembled, and are cut into test strip, load in test card stand-by.
(5) detection of sample
Added by sample extracting solution in sample pad, leave standstill 10 minutes, if exceed the detection threshold of colloidal gold test containing dihydroxyphenyl propane in sample, then do not develop the color in detection line region, and the colour developing of control line region; If not containing dihydroxyphenyl propane and lower than the detection threshold of colloidal gold test in sample, then detection line region colour developing, also develops the color in control line region.If do not develop the color in control line region, show that test strip lost efficacy.
A large amount of preparations of embodiment 5 dihydroxyphenyl propane antigenic epitope
(1) in the mode of Phage amplification
Displaying being had the phage of dihydroxyphenyl propane antigenic epitope to be added to 20ml inoculation has in the culture of ER2738, and 37 DEG C of 220rpm shake cultivation 4.5 hours.Proceeded to by culture in another centrifuge tube, 4 DEG C of centrifugal 10min of 1000rpm, proceed to the top of supernatant 80% in a fresh tube, add the PEG/NaCl of 1/6 volume, leave standstill 120min at 4 DEG C.4 DEG C of centrifugal PEG/NaCl of 10000rpm leave standstill solution 15min.Abandon supernatant, of short duration centrifugal after suck residual supernatant liquor.Adding 1mLTBS carries out resuspended, is Phage amplification liquid.
(2) be prepared in the mode of dihydroxyphenyl propane antigenic epitope-fusion rotein
A. the external source encoding gene of pcr amplification dihydroxyphenyl propane antigenic epitope is used
PCR reaction system: (50 μ L)
10×PyrobestBuffer(Mg2+plus)5μL
dNTPMixture(eachfor2.5mM)4μL
M13KEinsertextensionprimer(10mM）1μL
-96gIIIsequencingprimer(10mM)1μL
Phage DNA template 1 μ L
PyrobestDNAPolymerase0.5μL
Sterilizing ddH2O37.5 μ L
PCR reaction conditions:
（1）95℃5min；（2）30cycles：95℃30sec，55℃30sec，72℃40sec（3）72℃10min。
Adopt PCR primer to reclaim kits PCR primer, trace dna quantitative instrument is quantitative.The coding gene sequence of dihydroxyphenyl propane antigenic epitope of the present invention corresponds to respectively:
TATCCTCCTCATAATTGGGATTATTCGGGTGCGGCT。
B. the double digestion of external source encoding gene and expression vector
The external source code gene of ACC65I and EagI enzyme and expression vector (MBP fusion rotein can be expressed by pMAl-pIII, NEB company) is adopted to carry out double digestion respectively.
C. enzyme cuts connection and the conversion of after product
By plasmid pMal-PIII and object fragment with 1: 10(mol ratio) mixing, connect 12h in 16 DEG C of water-baths, get 10 μ L and connect products and add in 100 μ L competent cell TB1, fully mix.After ice bath 30min, 42 DEG C of water-bath heat shock 90s, add 600 μ LLB liquid mediums, 37 DEG C immediately after ice bath 5min, 200rpm cultivates the centrifugal 2min of 1h, 10000rpm, sucks supernatant and leaves and takes about 200 μ L, coat in LB-A solid (Ampr) substratum, 37 DEG C of incubated overnight, obtain positive colony.
D. the expression of dihydroxyphenyl propane antigenic epitope-MBP fusion rotein
By the positive colony of above-mentioned acquisition, a single colony inoculation is chosen in 5mLLB-A from flat board, in 0.2% sucrose, 37 DEG C, 220r/min, shaking culture is spent the night, overnight culture is inoculated in the LB-A of 50mL by 1% inoculum size (v/v), in 0.2% sucrose medium, inoculate 3 bottles respectively, 37 DEG C, 220r/min shaking culture, when culture bacterial concentration OD600 reaches 0.6, in three bottles of cultures, add IPTG to final concentration is 0.2mmol/L, 220r/min shaking culture, by inductor (PEG solution) in 4 DEG C, 4000g, centrifugal 20min collects bacterial sediment, abandon supernatant.Re-suspended cell in 400mL30mMTris-HCl, 20% sucrose, pH8.0 (80mL/g wet cell weight), add EDTA to 1mM, shake 5-10min under room temperature, 8000g, 4 DEG C, centrifugal 20min, abandons supernatant, precipitation is resuspended in the 5mMMgSO4 of 400ml precooling, shakes 10min on ice, 8000g, 4 DEG C, centrifugal 20min, retains supernatant, in supernatant liquor, add 8mL1MTris-HCl, pH7.4, obtain dihydroxyphenyl propane mimic epitopes-MBP fusion rotein.
SEQUENCELISTING
<110> University Of Nanchang
The antigenic epitope Ph1 of <120> dihydroxyphenyl propane and application thereof
<130>2014
<160>2
<170>PatentInversion3.3
<210>1
<211>12
<212>PRT
<213> artificial sequence
<400>1
TyrProProHisAsnTrpAspTyrSerGlyAlaAla
1510
<210>2
<211>36
<212>DNA
<213> artificial sequence
<400>2
tatcctcctcataattgggattattcgggtgcggct36
Claims (7)
1. the antigenic epitope Ph1 of dihydroxyphenyl propane, is characterized in that aminoacid sequence is: YPPHNWDYSGAA.
2. the nucleic acid molecule of antigenic epitope Ph1 described in coding claim 1.
3. nucleic acid molecule as claimed in claim 2, its sequence is: TATCCTCCTCATAATTGGGATTATTCGGGTGCGGCT.
4. the preparation method of antigenic epitope Ph1 as claimed in claim 1, is characterized in that the mode by Phage amplification, chemosynthesis or genetically engineered are recombinant expressed is prepared in a large number; Described Phage amplification refers to will show the phage having dihydroxyphenyl propane antigenic epitope, the mode increased by biology, and amount reproduction produces the bacteriophage particles shown and have dihydroxyphenyl propane antigenic epitope; Described chemosynthesis refers to, according to mimic epitopes aminoacid sequence, carry out Peptide systhesis by the mode of chemically synthesized polypeptide; The recombinant expressed mode of described genetically engineered refers to the gene of coding simulation epi-position, by being cloned into expression vector, carries out a large amount of preparations of dihydroxyphenyl propane antigenic epitope with the form of polypeptide-fusion rotein.
5. the application of antigenic epitope Ph1 according to claim 1 in non-diseases diagnoses and treatment object immunology detection is analyzed.
6. apply as claimed in claim 5, it is characterized in that the antigenic epitope Ph1 of dihydroxyphenyl propane application in non-diseases diagnoses and treatment object immunology detection is analyzed with solid phase antigen or competition antigen.
7. apply as claimed in claim 5, it is characterized in that the antigenic epitope Ph1 of dihydroxyphenyl propane detects the application in analyzing as solid phase antigen at non-diseases diagnoses and treatment object colloidal gold immunochromatographimethod.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410053094.9A CN103848897B (en) | 2014-02-17 | 2014-02-17 | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410053094.9A CN103848897B (en) | 2014-02-17 | 2014-02-17 | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103848897A CN103848897A (en) | 2014-06-11 |
| CN103848897B true CN103848897B (en) | 2016-04-13 |
Family
ID=50857048
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410053094.9A Expired - Fee Related CN103848897B (en) | 2014-02-17 | 2014-02-17 | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103848897B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108802381B (en) * | 2018-06-13 | 2021-03-12 | 河南中泽生物工程有限公司 | Bovine viral diarrhea virus identification and detection test strip and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101328215A (en) * | 2008-07-24 | 2008-12-24 | 江南大学 | Synthetic method of bisphenol A medicament universal artificial antigen |
-
2014
- 2014-02-17 CN CN201410053094.9A patent/CN103848897B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101328215A (en) * | 2008-07-24 | 2008-12-24 | 江南大学 | Synthetic method of bisphenol A medicament universal artificial antigen |
Non-Patent Citations (4)
| Title |
|---|
| Epitope mapping using phage-display random fragment libraries;Wang LF et.al;《Methods Mol Biol》;20091231;第524卷;315-332 * |
| 从噬菌体肽库中筛选抗原模拟表位的研究进展;黄丽群 等;《国外医学皮肤性病学分册》;20041130;第30卷(第6期);390-392 * |
| 利用噬菌体随机肽库筛选抗原模拟表位的研究进展;裴亚峰 等;《河南农业科学》;20121231;第41卷(第19期);14-18 * |
| 双酚A人工抗原合成及酶联免疫分析方法研究;郑劼;《广东工业大学硕士学位论文》;20080915;1-24 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103848897A (en) | 2014-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103848897B (en) | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof | |
| CN103044527B (en) | Antigenic mimic epitope of gentamycin and application thereof | |
| CN103848898B (en) | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof | |
| CN104530194B (en) | Antigenic epitope for ochratoxin A and its application | |
| CN103848895B (en) | The linear dodecapeptide antigenic epitope of aflatoxin B1 and its application | |
| CN103044526B (en) | Antigenic mimic epitope of vardenafil and application thereof | |
| CN103145808B (en) | Antigen mimic epitope of ochratoxin A and application thereof | |
| CN104327166B (en) | The dodecapeptide antigenic epitope of ochratoxin A and its application | |
| CN103848896B (en) | The antigenic epitope Ph5 of bisphenol-A and application thereof | |
| CN105315346B (en) | Peptide molecule and its application of deoxynivalenol can be specifically bound | |
| CN104311634B (en) | Aflatoxin B1Antigenic epitope AM 1 and its application | |
| CN104311637B (en) | Simulation fumonisins B1Antigenic epitope and its application | |
| CN103848899B (en) | The antigenic epitope Ph15 of bisphenol-A and application thereof | |
| CN104530195B (en) | Simulate antigenic epitope and its application of ochratoxin A | |
| CN104311635B (en) | For fumonisins B1Antigenic epitope and its application | |
| CN104311638B (en) | Fumonisins B can be simulated1Antigenic epitope and its application | |
| CN104356208B (en) | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN103342739B (en) | Antigenic mimic epitope of fumonisin B1 and application thereof | |
| CN103965290B (en) | The heptapeptide antigenic epitope of norfloxacin and application thereof | |
| CN104356207B (en) | Fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN103059101B (en) | Antigenic mimic epitope of aflatoxin (AF) B1 and application thereof | |
| CN104311636B (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN104119425B (en) | The antigenic epitope of simulation norfloxacin and application thereof | |
| CN103102391B (en) | Antigenic mimic epitope of norfloxacin and application thereof | |
| CN104788543A (en) | Polypeptide-based zearalenone antibody mimics and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160413 Termination date: 20200217 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |