CN104356207B - Fumonisins B1Dodecapeptide antigenic epitope and its application - Google Patents

Abstract

The invention belongs to biological technical field, it is related to fumonisins B₁Dodecapeptide antigenic epitope, its amino acid sequence be FYTSPGRTSHYM.FB of the present invention₁Antigenic epitope can replace expensive and strong toxicity FB₁Standard items, and it is applied to FB as competition antigen or solid-phase coating antigen₁Immunology detection, the antigenic epitope have and natural FB₁The similar immune response characteristic of molecule, effect is very good.Reduce FB₁Harm to health, has saved cost, with very high application value.

Description

Fumonisins B1Dodecapeptide antigenic epitope and its application

Technical field

The invention belongs to biological technical field, and in particular to fumonisins B₁Antigenic epitope and its application.

Background technology

Fumonisins B₁(Fumonisins B₁, FB₁) it is a kind of common mycotoxin, mainly by fusarium moniliforme (Fusarium moniliforme) produces research and shown, FB₁There is stronger toxic action, including god to the mankind and animal Carcinogenic etc. through toxicity, genotoxicity, embryotoxicity and teratogenesis, IARC is FB₁2B groups are divided into, i.e., to people The possible carcinogenic substance of class.At present, majority state is to FB in cereal, grain and food₁Residual content set limitation mark Standard, such as FAO (Food and Agriculture Organization of the United Nation)（FAO）The daily maximum allowable intake FB of regulation₁, FB₂, FB₃ Total amount is 2 μ g/kg body weight； FB in Switzerland's regulation grain₁ And FB₂Total residual limitation is 1000 μ g/L.

At present, FB in detection food₁Method mainly have high performance liquid chromatography, gas-chromatography, thin-layer chromatography and immunology The methods such as detection, immunological detection method is with the advantage such as its sensitivity is high, easy to detect, with low cost in FB₁Detection in To being widely applied.However, during immunological detection method is set up, it is necessary to use FB₁Standard items are raw material to make Standby competition antigen or solid-phase coating antigen, FB₁It is not only expensive but also with extremely strong carcinogenicity, testing staff is good for Health and environment cause great threat, so as to constrain the application and popularization of immunological detection method to a certain extent.There is mirror In this, people start to realize replacing for harmful small-molecule substance standard items using anti-idiotype and antigenic epitope technology Generation, and make some progress.Being mainly characterized by of phage display peptide library technology can effectively filter out and target target body The phage-displayed polypeptides of specific bond, the technology is exploring the interphase interaction binding site of acceptor and part, is seeking high parent Using wide in terms of ligand molecular, exploration agnoprotein matter space structure epitope, the development of new generation vaccine with power bioactivity It is general.

The present invention filters out energy and target molecule by using phage display peptide library technology from peptide storehouse（Anti- FB₁Monoclonal resists Body）The polypeptide of specific binding（Antigenic epitope）, the antigenic epitope have and natural FB₁Similar immune anti-of molecule Characteristic is answered, passes through the FB of acquisition₁Antigenic epitope, to replace expensive and strong toxicity FB₁Standard items, and it is used as competition Antigen or solid-phase coating antigen are applied to FB₁Immunology detection.

The content of the invention

The present invention is with anti-FB₁Monoclonal antibody is target molecule, by target molecule solid-phase coating on ELISA Plate, puts into bacteriophage Random displaying dodecapeptide storehouse, carries out affine elutriation, obtains seven kinds of FB₁Antigenic epitope.Their amino acid sequence is such as Under：

NNAAMYSEMATD、FYTSPGRTSHYM、IHQELRYTKDSP、GDGVHKSHDIRG、TTLQMRSEMADD、 SMLNDYRDYTTH、TRDKSSMLERWP。

The invention further relates to encode the nucleotide sequence of above-mentioned antigenic epitope amino acid sequence, correspond to respectively：

AATAATGCGGCGATGTATTCGGAGATGGCTACTGA、 TTTTATACTAGTCCGGGTCGGACGAGTCATTATATG 、ATTCATCAGGAGTTGCGTTATACTAAGGATTCTCCG、 GGGGATGGGGTGCATAAGTCGCATGATATCCGTGGG、ACTACGCTTCAGATGCGTAGTGAGATGGCTGATGAT、 TCGATGCTTAATGATTATCGTGATTATACTACTCAT、ACTCGGGATAAGTCGTCGATGTTGGAGCGTTGGCCG

Above-mentioned antigenic epitope（Polypeptide）In structure, capitalization English letter represents a kind of 20 known natural L-forms respectively One kind of amino acid residue or its D- type isomers, C represents cysteine residues, and D represents asparagicacid residue, and P represents dried meat ammonia Sour residue, R represents arginine residues, and K represents lysine residue, and H represents histidine residues, and I represents isoleucine residues, V generations Table valine residue, Y represents tyrosine residue, and S represents serine residue, and F represents phenylalanine residue, and E represents residue glutamic acid Base, M represents methionine residues, and G represents glycine residue, and L represents leucine residue, and Q represents glutamine residue, and W is represented Trp residue, N represents asparagine residue, and A represents alanine residue, and T represents threonine residues.

The FB1 antigenic epitopes that the present invention is referred to（Polypeptide）Phage amplification, chemical synthesis or genetic engineering can be passed through The mode of recombination expression is largely prepared.Phage amplification refers to displaying having FB1 antigenic epitopes（Polypeptide）Phagocytosis Body, by way of biology amplification, amount reproduction production displaying has FB1 antigenic epitopes（Polypeptide）Bacteriophage particles.Change The amino acid sequence that synthesis refers to the FB1 antigenic epitopes according to announcement is learned, is carried out by way of chemically synthesized polypeptide many Peptide symthesis.The mode of genetic engineering recombination expression refers to the gene by FB1 antigenic epitopes are encoded, and is carried by being cloned into expression Body, carries out a large amount of preparations of FB1 antigenic epitopes in the form of polypeptide-fusion protein.

The invention further relates to the fumonisins B₁Application of the antigenic epitope in immunology detection analysis.Immunology It is special based on Ag-Ab that the type of detection includes MBP enzyme linked immuno-adsorbent assay, colloidal gold immunochromatographimethod, immunodotting hybridization etc. Property reaction immune analysis detection type.

Fumonisins B of the present invention₁Antigenic epitope（NNAAMYSEMATD、FYTSPGRTSHYM、IHQELRYTKDSP、 GDGVHKSHDIRG、TTLQMRSEMADD、SMLNDYRDYTTH、TRDKSSMLERWP）In use, can be the simulation of synthesis Epitope is analyzed for immunology detection, and the displaying obtained by Phage amplification is had into FB₁Antigenic epitope（Polypeptide）Bite Phage particle is directly used in analysis detection, it is of course also possible to by FB₁Antigenic epitope scales off from bacteriophage and replaces FB₁Mark Quasi- product carry out immunology detection analysis.

Further relate to fumonisins B₁Antigenic epitope is with solid phase antigen or competition antigen in immunology detection analysis Using.

Further relate to fumonisins B₁Antigenic epitope is as solid phase antigen in colloidal gold immunochromatographimethod detection and analysis Using.

Foregoing fumonisins B₁Antigenic epitope can replace expensive and strong toxicity FB₁Standard items, and as competing Strive antigen or solid-phase coating antigen is applied to FB₁Immunology detection, the antigenic epitope have and natural FB₁Molecule is similar Immune response characteristic, effect is very good.

The beneficial effects of the invention are as follows：Fumonisins B of the present invention₁Antigenic epitope can replace expensive and toxicity Strong FB₁Standard items, and it is applied to FB as competition antigen or solid-phase coating antigen₁Immunology detection, the antigenic epitope With with natural FB₁The similar immune response characteristic of molecule, effect is very good.Reduce FB₁Harm to health, is saved Cost, with very high application value.

Brief description of the drawings

Fig. 1 is the indirect competitive ELISA standard curve set up with FB1 antigenic epitopes.The linear regression of standard curve Equation is y=- 144.5ln (x)+196.18, R2=0.9609, IC₅₀It is worth for 0.562ng/mL, linear detection range is 0.171 ~ 2.420 ng/mL, lowest detection is limited to 0.121 ng/mL.

Embodiment

The FB of embodiment 1.₁The affine elutriation and its identification of antigenic epitope

1）FB₁The affine elutriation of antigenic epitope：Specific method is：Anti- FB is diluted with 10 mM PBS (pH 7.4)₁ Monoclonal antibody, and 96 hole elisa Plates, 4 DEG C of overnight incubations are coated with the μ g/mL of final concentration 100.Second day with TBST (50 mM NaCl, pH 7.5 include 0.1% Tween-20 (v/v)) washing 10 times after, add 300 μ l confining liquids（3% BSA-PBS） 4 DEG C are incubated 2 hours.Confining liquid is abandoned after 2 hours, is washed with TBST 5 times, 100 μ l phage peptide libraries are added per hole（Phage display technology Show dodecapeptide storehouse, purchased from NEB companies, with 10 times of dilution bacteriophage stostes of TBS, about 1.0 × 10¹¹pfu）, 22-26 DEG C of vibration is instead Answer 1 hour.Uncombined bacteriophage is discarded, is washed with TBST 10 times, with reference to upper bacteriophage with 0.2 M Glycine-HCl (pH 2.2) is eluted, and is neutralized immediately with the M Tris-HCl (pH 9.1) of 15 μ l 1.10 μ l wash-out bacteriophages are taken to survey drop Degree, remaining is used for 20 mL of infection and grows to logarithm early stageE. coliER2738 bacterial strains are expanded.Use PEG/ within 3rd day NaCl deposition and purification bacteriophages, and determine the titre of bacteriophage after amplification.

In the panning process of second, third wheel, coated anti-FB₁MAb concentration is respectively 75 μ g/mL and 50 μ g/mL, TBST concentration used is 0.25% and 0.5%, and remaining step is ibid.

2）The identification of positive phage clones：The random picking from the flat board that phage titre is determined after third round elutriation 20 bacteriophage spots, carry out the amplification of bacteriophage, using Immunofluorescent antibody detection method（Indirect Enzyme Linked immunoasorbent assay, I-ELISA）The identification of positive phage clones is carried out, specific method is：It is first First, anti-FB is diluted with 10 mM PBS (pH 7.4)₁Monoclonal antibody, 10 μ g/mL are coated with 96 hole elisa Plates, and 4 DEG C were incubated Night.After second day is washed 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)), with containing 3% skimmed milk power PBS closed, 37 DEG C be incubated 1 hour；Put into 100 μ l bacteriophages spots amplification liquid（1.0×10¹¹pfu）, with original phagocytosis Body peptide storehouse is as negative control, and 37 DEG C are incubated 1 hour；Add 1:The HRP of 5000 times of dilutions marks anti-M13 bacteriophages secondary antibody 100 μ l, 37 DEG C are incubated 1 hour；Add 100 μ l tmb substrate liquid, lucifuge colour developing 5min, ELIASA（Thermo Scientific Multiskan FC）Read the absorption value at 450 nm.Choose OD₄₅₀Phage clone of 2 times more than negative control is positive gram It is grand.

3) FB₁The identification of antigenic epitope：FB is carried out using the method for indirect competitive ELISA₁Antigenic epitope Identify, specific method is：Anti- FB is diluted with 10 mM PBS (pH 7.4)₁Monoclonal antibody, 10 μ g/mL coated elisa plates, 4 DEG C be incubated overnight；After second day is washed 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)), with containing 3% The PBS of skimmed milk power is closed, and 37 DEG C are incubated 1 hour；Put into the bacteriophage gram that 50 μ l are accredited as the positive through indirect ELISA It is grand（1.0×10¹¹pfu）With 50 μ l FB₁Standard items（Concentration range is 0-20 ng/ml）, 37 DEG C are incubated 1 hour；Add 1: The μ l of anti-M13 bacteriophages secondary antibody 100 of 5000 dilution HRP marks, 37 DEG C are incubated 1 hour；Add 100 μ l tmb substrate liquid, lucifuge Develop the color 5min, reads OD₄₅₀, anti-FB can be combined₁Monoclonal antibody, and can be by FB₁The bacteriophage that standard items are blocked, is accredited as FB₁Antigenic epitope.

The FB of embodiment 2.₁The sequencing of antigenic epitope encoding gene and its determination of amino acid sequence

Show that the bacteriophage for there are FB1 antigenic epitopes is expanded by being identified by indirect competitive ELISA, extract phagocytosis The DNA sequencing template of body.Simplified process is as follows：Phage amplification is carried out, after first step centrifugation, by 800 μ l containing on bacteriophage It is transferred to a new centrifuge tube clearly.Add 200 μ l PEG/NaCl precipitating phages.Precipitation is resuspended in 100 μ l iodide after centrifugation Buffer solution (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI), adds 250 μ l absolute ethyl alcohols precipitation DNA, precipitation is washed after centrifugation with 70% ethanol again（DNA sequencing template）.Precipitation is finally resuspended in 20 μ l aqua sterilisas, takes 2 μ l to enter Row agarose gel electrophoresis are analyzed；5 μ L bacteriophages templates are taken to carry out DNA sequencing, its -96 gIII sequencing primer is：5’-^HOCCC TCA TAG TTA GCG TAA CG-3’.FB can be obtained according to DNA sequencing result and password sublist₁Antigenic epitope Amino acid sequence.Their amino acid sequence is as follows：

NNAAMYSEMATD、FYTSPGRTSHYM、IHQELRYTKDSP、GDGVHKSHDIRG、TTLQMRSEMADD、 SMLNDYRDYTTH、TRDKSSMLERWP。

The FB of embodiment 3.₁Application of the antigenic epitope as competition antigen in ELISA

(1) sample extraction

Weigh 5g samples（Cereal and its relevant food）, add 25 milliliter of 60 % methanol-PBS solution, 200 rpm Vibration 5 minutes；After extract solution is filtered with No. 1 filter paper of whatman, 1 milliliter of filtrate is taken to add 4 milliliters of PBS（Phosphate Buffer solution, pH=7.2）After mixing, as sample extracting solution is stand-by.

（2）Coating and closing

Anti- FB is diluted with 10 mM PBS (pH 7.4)₁Monoclonal antibody, 10 μ g/mL coated elisa plates, 4 DEG C were incubated Night.After second day is washed 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)), with containing 3% skimmed milk power PBS closed, it is stand-by with PBST board-washings 6 times after 37 DEG C are incubated 1 hour.

（3）The foundation of standard curve

Take out through step（2）The lath handled well, putting into 50 μ l displayings respectively per hole has FB₁Antigenic epitope is bitten Thalline（1.0×10¹¹pfu）With a series of 50 μ l FB of various concentrations₁Standard items, 37 DEG C are incubated 1 hour.Add 1:5000 The anti-M13 bacteriophages secondary antibody of HRP marks is diluted, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD₄₅₀.With FB₁It is dense Degree logarithm is abscissa, Percentage bound（Add FB₁Hole OD₄₅₀/ FB is not added₁Hole OD₄₅₀×100%）For ordinate, build Vertical indirect competition standard curve.As a result show that standard curve is S-type, linear dependence is preferable（Fig. 1）.Such as Fig. 1, with FB1 antigens Mimic epitope（Amino acid sequence is NNAAMYSEMATD）The indirect competitive ELISA standard curve of foundation.Standard curve it is linear Regression equation is y=- 144.5ln (x)+196.18, and R2=0.9609, IC50 values are 0.562ng/mL, linearity test model Enclose for 0.171 ~ 2.420 ng/mL, lowest detection is limited to 0.121 ng/mL.

（4）The detection of sample

Take out through step（2）The lath handled well, putting into 50 μ l displayings respectively per hole has FB₁Antigenic epitope is bitten Thalline（1.0×10¹¹pfu）With testing sample extract solution, 37 DEG C are incubated 1 hour.Add 1:The anti-M13 of 5000 dilution HRP marks Bacteriophage secondary antibody, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD₄₅₀, calculations incorporated rate, and it is bent according to standard Line, retrodicts out FB in sample₁Content.

The FB of embodiment 4.₁Application of the antigenic epitope as solid phase antigen in ELISA

(1) sample extraction

Weigh 5g samples（Cereal and its relevant food）, add 25 milliliter of 60 % methanol-PBS solution, 200 rpm Vibration 5 minutes；After extract solution is filtered with No. 1 filter paper of whatman, 1 milliliter of filtrate is taken to add 4 milliliters of PBS（Phosphate Buffer solution, pH=7.2）After mixing, as sample extracting solution is stand-by.

（2）Coating and closing

There is FB with 10 mM PBS (pH 7.4) dilution displayings₁The bacteriophage of antigenic epitope（2.0×10¹¹pfu）, 100 microlitres are coated in ELISA Plate, 4 DEG C of overnight incubations.Second day with PBST (10 mM PBS, 0.05% Tween-20 (v/ V) after) washing 3 times, closed, after 37 DEG C of incubations 1 hour, treated for 6 times with PBST board-washings with the PBS containing 3% skimmed milk power With.

（3）The foundation of standard curve

Take out through step（2）The lath handled well, the 50 anti-FB of μ l are put into per hole respectively₁Monoclonal antibody（0.5 ng/ ml）With a series of 50 μ l FB of various concentrations₁Standard items, 37 DEG C are incubated 1 hour.Add 1:The sheep of 2000 dilution HRP marks Anti- mouse IgG secondary antibodies, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD₄₅₀.With FB₁Log concentration is abscissa, knot Conjunction rate（Add FB₁Hole OD₄₅₀/ FB is not added₁Hole OD₄₅₀×100%）For ordinate, indirect competition standard is set up bent Line.

（4）The detection of sample

Take out through step（2）The lath handled well, the 50 anti-FB of μ l are put into per hole respectively₁Monoclonal antibody（0.5 ng/ ml）With a series of 50 μ l FB of various concentrations₁Standard items, 37 DEG C are incubated 1 hour.Add 1:The sheep of 2000 dilution HRP marks Anti- mouse IgG secondary antibodies, 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD₄₅₀.With FB₁Log concentration is abscissa, knot Conjunction rate（Add FB₁Hole OD₄₅₀/ FB is not added₁Hole OD₄₅₀×100%）For ordinate, indirect competition standard is set up bent Line.

The FB of embodiment 5.₁Application of the antigenic epitope as solid phase antigen in highly-pathogenic avian influenza

(1) sample extraction

Weigh 5g samples（Cereal and its relevant food）, add 25 milliliter of 60 % methanol-PBS solution, 200 rpm Vibration 5 minutes；After extract solution is filtered with No. 1 filter paper of whatman, 1 milliliter of filtrate is taken to add 4 milliliters of PBS（Phosphate Buffer solution, pH=7.2）After mixing, as sample extracting solution is stand-by.

（2）Bacteriophage and the dot matrix of control line

There is FB of the present invention with 10 mM PBS (pH 7.4) dilution displayings₁The bacteriophage of antigenic epitope（2.0×10¹¹ pfu）, bacteriophage is lined on nitrocellulose filter with dot matrix instrument or micropipettor（Aperture 0.2-0.45 microns）, as Detection line；The sheep anti-mouse igg secondary antibody that 0.5 mg/ml HRP is marked, same nitric acid is lined with dot matrix instrument or micropipette On cellulose membrane（Positioned at the top of detection line, distance is more than 5 millimeters）, it is used as control line.

（3）Colloid gold label FB₁Antibody

By FB₁Colloidal gold solution is added dropwise in antibody（pH=8.2）In, stirred in drop, after 30 minutes, take 1% PEG to add Enter in above-mentioned solution, continue to add 10% BSA solution of 1/10th volumes after stirring 15 minutes, after stirring 15 minutes, stand 30 minutes, supernatant is removed after centrifugation, the FB of colloid gold label is obtained₁Antibody-solutions.

（4）The assembling of colloidal-gold detecting-card

By the FB of colloid gold label₁Antibody point is sprayed in glue gold pad（1.0 mcg/ml）, by sample pad, glue gold pad, point The nitrocellulose filter and absorption paper of battle array detection line and control line are assembled, and are cut into test strips, is fitted into detect block in it is stand-by.

（5）The detection of sample

Sample extracting solution is added in sample pad, 10 minutes are stood, if containing FB in sample₁And detect examination more than collaurum The detection threshold value of paper, then detection line region is not developed the color, and control line region is developed the color；If not containing FB in sample₁And less than colloid The detection threshold value of golden Test paper, then detection line region colour developing, control line region is also developed the color.If control line region is not developed the color, table Bright test strips failure.

The FB of embodiment 5₁A large amount of preparations of antigenic epitope

（1）In the way of Phage amplification

It will show that the bacteriophage for having FB1 antigenic epitopes is added to 20 ml to be inoculated with ER 2738 culture, 37 Spend the h of 220 rpm shaken cultivations 4.5.Culture is transferred in another centrifuge tube, 4 DEG C of 10000 rpm centrifuges 10 min, will be upper The clear % of top 80 is transferred in a fresh tube, is added at the PEG/NaCl of 1/6 volume, 4 DEG C and is stood 120 min.4℃ 10000 Rpm centrifugations PEG/NaCL stands the min of solution 15.Supernatant is abandoned, residual supernatant is sucked after of short duration centrifugation.1mL TBS are added to enter Row is resuspended, as Phage amplification liquid.

（2）With FB₁It is prepared by the mode of antigenic epitope-fusion protein

A.PCR expands the external source encoding gene of FB1 antigenic epitopes

PCR reaction systems：(50 µL)

10 × Pyrobest Buffer (Mg2+ plus) 5 µL

dNTP Mixture (each for 2.5 mM) 4 µL

M13KE insert extension primer (10 mM） 1 µL

-96 gIII sequencing primer (10 mM) 1 µL

The μ L of phage DNA template 1

Pyrobest DNA Polymerase 0.5 µL

Sterilize the μ L of ddH2O 37.5

PCR reaction conditions：95 DEG C of 5 min, then 95 DEG C of 30 sec, 55 DEG C of 30 sec, 72 DEG C of 40sec, 72 DEG C of 10 min totally 30 cycles.

PCR products are purified using PCR products QIAquick Gel Extraction Kit, trace dna quantitative instrument is quantified.FB1 antigens simulate table The coding gene sequence of position is corresponded to respectively：

AATAATGCGGCGATGTATTCGGAGATGGCTACTGA、TTTTATACTAGTCCGGGTCGGACGAGTCATTAT ATG 、ATTCATCAGGAGTTGCGTTATACTAAGGATTCTCCG、GGGGATGGGGTGCATAAGTCGCATGATATCCGTGG G、ACTACGCTTCAGATGCGTAGTGAGATGGCTGATGAT、TCGATGCTTAATGATTATCGTGATTATACTACTCAT、 ACTCGGGATAAGTCGTCGATGTTGGAGCGTTGGCCG

B. the double digestion of external source encoding gene and expression vector

The external source code gene of ACC65I and Eag I enzymes and expression vector is respectively adopted（PMAl-pIII, NEB company, MBP fusion proteins can be expressed）Carry out double digestion.

C. after digestion product connection and conversion

By plasmid pMal-PIII and purpose fragment with 1: 10（Mol ratio）Mix, 12 h connected in 16 DEG C of water-baths, Take 10 μ L connection products to add in 100 μ L competent cells TB1, fully mix.After the min of ice bath 30,42 DEG C of water-bath heat shocks 90 s, add 600 μ L LB liquid mediums immediately after the min of ice bath 5,37 DEG C, and 200 rpm cultivate 1 h, 10000 rpm from The min of the heart 2, sucks supernatant and leaves and takes about 200 μ L, be coated on LB-A solids（Ampr）In culture medium, 37 DEG C of incubated overnights are obtained Positive colony.

D.FB₁The expression of antigenic epitope-MBP fusion proteins

By the positive clone molecule of above-mentioned acquisition, a single bacterium colony is chosen from flat board and is inoculated in 5 mL LB-A, 0.2% sucrose, 37 DEG C, 220 r/min, shaken cultivation is stayed overnight, and overnight culture is pressed into 1 % inoculum concentrations（v/v）It is inoculated in 50 mL LB-A, 0.2 In % sucrose culture mediums, 3 bottles, 37 DEG C, 220 r/min shaken cultivations, when culture bacterial concentration OD600 reaches 0.6 are inoculated with respectively When, IPTG to final concentration of 0.2 mmol/L, 220 r/min shaken cultivations, by inducer are added into three bottles of cultures（PEG Solution）In 4 DEG C, 4000 g, 20 min of centrifugation collect bacterial sediment, abandon supernatant.Cell is resuspended in the mM Tris- of 400 mL 30 HCl, 20% sucrose, pH 8.0 (80 mL/g wet cell weights) adds EDTA to 1 mM, and 5-10 min, 8000 are shaken at room temperature G, centrifuges 20 min by 4 DEG C, abandons supernatant, and precipitation is resuspended in 5 mM MgSO4 of 400 ml precoolings, 10 min, 8000 are shaken on ice G, 4 DEG C, centrifuges 20 min, retains supernatant, the M Tris-HCl, pH 7.4 of 8 mL 1 is added into supernatant, obtain FB1 antigens Mimic epitope-MBP fusion proteins.

SEQUENCE LISTING

<110>University Of Nanchang

<120>Fumonisins B₁Dodecapeptide antigenic epitope and its application

<130> 1

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 12

<212> PRT

<213>Artificial sequence

<400> 1

Asn Asn Ala Ala Met Tyr Ser Glu Met Ala Thr Asp

1 5 10

<210> 2

<211> 12

<212> PRT

<213>Artificial sequence

<400> 2

Phe Tyr Thr Ser Pro Gly Arg Thr Ser His Tyr Met

1 5 10

<210> 3

<211> 12

<212> PRT

<213>Artificial sequence

<400> 3

Ile His Gln Glu Leu Arg Tyr Thr Lys Asp Ser Pro

1 5 10

<210> 4

<211> 12

<212> PRT

<213>Artificial sequence

<400> 4

Gly Asp Gly Val His Lys Ser His Asp Ile Arg Gly

1 5 10

<210> 5

<211> 12

<212> PRT

<213>Artificial sequence

<400> 5

Thr Thr Leu Gln Met Arg Ser Glu Met Ala Asp Asp

1 5 10

<210> 6

<211> 12

<212> PRT

<213>Artificial sequence

<400> 6

Ser Met Leu Asn Asp Tyr Arg Asp Tyr Thr Thr His

1 5 10

<210> 7

<211> 12

<212> PRT

<213>Artificial sequence

<400> 7

Thr Arg Asp Lys Ser Ser Met Leu Glu Arg Trp Pro

1 5 10

<210> 8

<211> 35

<212> DNA

<213>Artificial sequence

<400> 8

aataatgcgg cgatgtattc ggagatggct actgat 36

<210> 9

<211> 36

<212> DNA

<213>Artificial sequence

<400> 9

ttttatacta gtccgggtcg gacgagtcat tatatg 36

<210> 10

<211> 36

<212> DNA

<213>Artificial sequence

<400> 10

attcatcagg agttgcgtta tactaaggat tctccg 36

<210> 11

<211> 36

<212> DNA

<213>Artificial sequence

<400> 11

ggggatgggg tgcataagtc gcatgatatc cgtggg 36

<210> 12

<211> 36

<212> DNA

<213>Artificial sequence

<400> 12

actacgcttc agatgcgtag tgagatggct gatgat 36

<210> 13

<211> 36

<212> DNA

<213>Artificial sequence

<400> 13

tcgatgctta atgattatcg tgattatact actcat 36

<210> 14

<211> 36

<212> DNA

<213>Artificial sequence

<400> 14

actcgggata agtcgtcgat gttggagcgt tggccg 36

Claims (2)

1. fumonisins B₁Dodecapeptide antigenic epitope, it is characterised in that amino acid sequence is：FYTSPGRTSHYM、 IHQELRYTKDSP。

2. encode the nucleotides of dodecapeptide antigenic epitope amino acid sequence described in claim 1.