CN104356208B - It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application - Google Patents
It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application Download PDFInfo
- Publication number
- CN104356208B CN104356208B CN201410529689.7A CN201410529689A CN104356208B CN 104356208 B CN104356208 B CN 104356208B CN 201410529689 A CN201410529689 A CN 201410529689A CN 104356208 B CN104356208 B CN 104356208B
- Authority
- CN
- China
- Prior art keywords
- antigenic epitope
- phage
- fumonisins
- detection
- add
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to biological technical field, is related to for fumonisins B1Dodecapeptide antigenic epitope, its aminoacid sequence be SMLNDYRDYTTH.FB of the present invention1Antigenic epitope can replace the FB of expensive and strong toxicity1Standard substance, and FB is applied to as competition antigen or solid-phase coating antigen1Immunology detection, the antigenic epitope with natural FB1The immunoreation characteristic of molecular mimicry, effect are very good.Reduce FB1Harm to health, has saved cost, with very high using value.
Description
Technical field
The invention belongs to biological technical field, and in particular to fumonisins B1Antigenic epitope and its application.
Background technology
Fumonisins B1(Fumonisins B1, FB1) it is a kind of common mycotoxin, mainly by fusarium moniliforme
(Fusarium moniliforme) produces research and shows, FB1There is stronger toxic action, including god to the mankind and animal
Jing toxicity, genotoxicity, fetal toxicity and teratogenesis are carcinogenic etc., and IARC is FB12B groups are divided into, i.e., to people
The possible carcinogen of class.At present, majority state is to FB in corn, grain and food1Residual content set limitation mark
Standard, such as FAO (Food and Agriculture Organization of the United Nation)（FAO）The daily maximum allowable intake FB of regulation1, FB2, FB3 Total amount is 2 g/kg body weight；
FB in Switzerland's regulation grain1 And FB2Total residual limitation is 1000 g/L.
At present, detect FB in food1Method mainly have high performance liquid chromatography, gas chromatogram, thin layer chromatography and immunology
The methods such as detection, immunological detection method is with the advantage such as its sensitivity is high, easy to detect, with low cost in FB1Detection in
To being widely applied.However, during immunological detection method is set up, it is necessary to use FB1Standard substance are made for raw material
Standby competition antigen or solid-phase coating antigen, FB1It is not only expensive but also with extremely strong carcinogenecity, testing staff is good for
Health and environment cause greatly threat, so as to constrain the application and popularization of immunological detection method to a certain extent.There is mirror
In this, people start using anti-idiotype antibody and antigenic epitope technology to realize replacing for harmful small-molecule substance standard substance
Generation, and make some progress.Being mainly characterized by of phage display peptide library technology effectively can filter out and target target body
The phage-displayed polypeptides of specific bond, the technology are being explored interphase interaction binding site of the receptor with part, are seeking high parent
The aspect applications such as ligand molecular, exploration agnoprotein matter space structure epi-position, the development of new generation vaccine with power biological activity are wide
It is general.
The present invention filters out energy and target molecule from peptide storehouse by using phage display peptide library technology（Anti- FB1Monoclonal anti
Body）The polypeptide of specific binding（Antigenic epitope）, the antigenic epitope with natural FB1The immunity of molecular mimicry is anti-
Characteristic is answered, by the FB for obtaining1Antigenic epitope, to replace the FB of expensive and strong toxicity1Standard substance, and as competition
Antigen or solid-phase coating antigen are applied to FB1Immunology detection.
The content of the invention
The present invention is with anti-FB1Monoclonal antibody is target molecule, by target molecule solid-phase coating in ELISA Plate, puts into phage
It is random to show dodecapeptide storehouse, affine elutriation is carried out, seven kinds of FB are obtained1Antigenic epitope.Their aminoacid sequence is such as
Under：
NNAAMYSEMATD、FYTSPGRTSHYM、IHQELRYTKDSP、GDGVHKSHDIRG、TTLQMRSEMADD、
SMLNDYRDYTTH、TRDKSSMLERWP。
The invention further relates to encode the nucleotide sequence of above-mentioned antigenic epitope aminoacid sequence, correspond to respectively：
AATAATGCGGCGATGTATTCGGAGATGGCTACTGA、
TTTTATACTAGTCCGGGTCGGACGAGTCATTATATG 、ATTCATCAGGAGTTGCGTTATACTAAGGATTCTCCG、
GGGGATGGGGTGCATAAGTCGCATGATATCCGTGGG、ACTACGCTTCAGATGCGTAGTGAGATGGCTGATGAT、
TCGATGCTTAATGATTATCGTGATTATACTACTCAT、ACTCGGGATAAGTCGTCGATGTTGGAGCGTTGGCCG
Above-mentioned antigenic epitope（Polypeptide）In structure, capitalization English letter represents a kind of 20 known natural L-forms respectively
One kind of amino acid residue or its D- type isomer, C represent cysteine residues, and D represents asparagicacid residue, and P represents dried meat ammonia
Sour residue, R represent arginine residues, and K represents lysine residue, and H represents histidine residues, and I represents isoleucine residues, V generations
Table valine residue, Y represent tyrosine residue, and S represents serine residue, and F represents phenylalanine residue, and E represents residue glutamic acid
Base, M represent methionine residues, and G represents glycine residue, and L represents leucine residue, and Q represents glutamine residue, and W is represented
Trp residue, N represent asparagine residue, and A represents alanine residue, and T represents threonine residues.
The FB1 antigenic epitopes that the present invention is referred to（Polypeptide）Phage amplification, chemosynthesis or genetic engineering can be passed through
Recombinant expressed mode is prepared in a large number.Phage amplification is referred to has FB1 antigenic epitopes by displaying（Polypeptide）Phagocytosis
Body, by way of biological amplification, amount reproduction production displaying has FB1 antigenic epitopes（Polypeptide）Bacteriophage particles.Change
The aminoacid sequence that synthesis refers to the FB1 antigenic epitopes according to announcement is learned, is carried out by way of chemically synthesized polypeptide many
Peptide symthesis.The recombinant expressed mode of genetic engineering is referred to the gene of coding FB1 antigenic epitopes, is carried by being cloned into expression
Body, carries out a large amount of preparations of FB1 antigenic epitopes in the form of polypeptide-fusion protein.
The invention further relates to the fumonisins B1Application of the antigenic epitope in immunology detection analysis.Immunology
The type of detection includes that MBP enzyme linked immuno-adsorbent assay, colloidal gold immunochromatographimethod, immunodotting hybridization etc. are special based on Ag-Ab
Property reaction immune analysis detection type.
Fumonisins B of the present invention1Antigenic epitope（NNAAMYSEMATD、FYTSPGRTSHYM、IHQELRYTKDSP、
GDGVHKSHDIRG、TTLQMRSEMADD、SMLNDYRDYTTH、TRDKSSMLERWP）In use, can be the simulation of synthesis
Epi-position is analyzed for immunology detection, and the displaying obtained by Phage amplification is had FB1Antigenic epitope（Polypeptide）Bite
Phage particle is directly used in analysis detection, it is of course also possible to by FB1Antigenic epitope scales off replacement FB from phage1Mark
Quasi- product are carrying out immunology detection analysis.
Further relate to fumonisins B1Antigenic epitope is with solid phase antigen or competition antigen in immunology detection analysis
Using.
Further relate to fumonisins B1Antigenic epitope is as solid phase antigen in colloidal gold immunochromatographimethod detection and analysis
Using.
Aforementioned fumonisins B1Antigenic epitope can replace the FB of expensive and strong toxicity1Standard substance, and as competing
Strive antigen or solid-phase coating antigen is applied to FB1Immunology detection, the antigenic epitope with natural FB1Molecular mimicry
Immunoreation characteristic, effect is very good.
The invention has the beneficial effects as follows：Fumonisins B of the present invention1Antigenic epitope can replace expensive and toxicity
Strong FB1Standard substance, and FB is applied to as competition antigen or solid-phase coating antigen1Immunology detection, the antigenic epitope
With with natural FB1The immunoreation characteristic of molecular mimicry, effect are very good.Reduce FB1Harm to health, saves
Cost, with very high using value.
Description of the drawings
Fig. 1 is the indirect competitive ELISA standard curve set up with FB1 antigenic epitopes.The linear regression of standard curve
Equation be y=- 144.5ln (x)+196.18, R=0.9609, IC50It is worth for 0.562ng/mL, linear detection range is
0.171 ~ 2.420 ng/mL, lowest detection are limited to 0.121 ng/mL.
Specific embodiment
Embodiment 1.FB1The affine elutriation of antigenic epitope and its identification
1）FB1The affine elutriation of antigenic epitope：Concrete grammar is：Anti- FB is diluted with 10 mM PBS (pH 7.4)1
Monoclonal antibody, and 96 hole elisa Plates, 4 DEG C of overnight incubations are coated with 100 μ g/mL of final concentration.Second day with TBST (50 mM
NaCl, pH 7.5 include 0.1% Tween-20 (v/v)) washing 10 times after, add 300 μ l confining liquids（3% BSA-PBS）
4 DEG C are incubated 2 hours.Confining liquid is abandoned after 2 hours, is washed with TBST 5 times, 100 μ l phage peptide libraries are added per hole（Phage display technology
Show dodecapeptide storehouse, purchased from NEB companies, with 10 times of dilution phage stock solutions of TBS, about 1.0 × 1011pfu）, 22-26 DEG C of vibration is instead
Answer 1 hour.Unconjugated phage is discarded, is washed with TBST 10 times, with reference to upper phage with 0.2 M Glycine-HCl
(pH 2.2) eluting, and neutralized with 15 μ l, 1 M Tris-HCl (pH 9.1) immediately.Take 10 μ l wash-out bacteriophages and survey drop
Degree, remaining is used for 20 mL of infection and grows to logarithm early stageE. coliER2738 bacterial strains are expanded.Use PEG/ within 3rd day
NaCl deposition and purification phagies, and determine the titre of phage after amplification.
In second, third panning process taken turns, coated anti-FB1MAb concentration is respectively 75 μ g/mL and 50
μ g/mL, TBST concentration used is 0.25% and 0.5%, and remaining step is ibid.
2）The identification of positive phage clones：Random picking in the flat board of phage titre is determined from after third round elutriation
20 phage speckles, carry out the amplification of phage, using Immunofluorescent antibody detection method（Indirect Enzyme
Linked immunoasorbent assay, I-ELISA）The identification of positive phage clones is carried out, concrete grammar is：It is first
First, anti-FB is diluted with 10 mM PBS (pH 7.4)1Monoclonal antibody, 10 g/mL are coated with 96 hole elisa Plates, and 4 DEG C were incubated
Night.Washed after 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)) within second day, with containing 3% defatted milk powder
PBS closed, 37 DEG C be incubated 1 hour；Put into 100 l phagies speckles amplification liquid（1.0×1011pfu）, with original phagocytosis
Used as negative control, 37 DEG C are incubated 1 hour in body peptide storehouse；Add 1:The anti-M13 phagies two of HRP labellings of 5000 times of dilutions anti-100
L, 37 DEG C are incubated 1 hour；Add 100 l tmb substrate liquid, lucifuge colour developing 5min, microplate reader（Thermo Scientific
Multiskan FC）Read the absorption value at 450 nm.Choose OD450It it is positive gram more than 2 times of phage clone of negative control
It is grand.
3) FB1The identification of antigenic epitope：FB is carried out using the method for indirect competitive ELISA1Antigenic epitope
Identify, concrete grammar is：Anti- FB is diluted with 10 mM PBS (pH 7.4)1Monoclonal antibody, 10 g/mL coated elisa plates, 4
DEG C overnight incubation；Washed after 3 times, with containing 3% with PBST (10 mM PBS, 0.05% Tween-20 (v/v)) within second day
The PBS of defatted milk powder is closed, and 37 DEG C are incubated 1 hour；Put into the phage gram that 50 l Jing indirect ELISAs are accredited as the positive
It is grand（1.0×1011pfu）With 50 l FB1Standard substance（Concentration range is 0-20 ng/ml）, 37 DEG C are incubated 1 hour；Add 1:
Anti- 100 l of anti-M13 phagies two of 5000 dilution HRP labellings, 37 DEG C are incubated 1 hour；Add 100 l tmb substrate liquid, lucifuge
Colour developing 5min, reads OD450, can be with reference to anti-FB1Monoclonal antibody, and can be by FB1The phage blocked by standard substance, is accredited as
FB1Antigenic epitope.
Embodiment 2.FB1The sequencing of antigenic epitope encoding gene and its determination of aminoacid sequence
Show that the phage for there are FB1 antigenic epitopes is expanded by identifying through indirect competitive ELISA, extract phagocytosis
The DNA sequencing template of body.Simplified process is as follows：Phage amplification is carried out, after first step centrifugation, by 800 l containing in phage
Proceed to clearly a new centrifuge tube.Add 200 l PEG/NaCl precipitating phages.Precipitation is resuspended in into 100 l iodide after centrifugation
Buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 4 M NaI), adds 250 l dehydrated alcohol precipitation
DNA, is precipitated with 70% washing with alcohol after centrifugation again（DNA sequencing template）.Precipitation is finally resuspended in 20 l aquesterilisa, takes 2 l and enters
Row agarose gel electrophoresis are analyzed；Taking 5 L phagies templates carries out DNA sequencing, and its -96 gIII sequencing primer is：5’-HOCCC TCA TAG TTA GCG TAA CG-3’.FB can be obtained according to DNA sequencing result and password sublist1Antigenic epitope
Aminoacid sequence.Their aminoacid sequence is as follows：
NNAAMYSEMATD、FYTSPGRTSHYM、IHQELRYTKDSP、GDGVHKSHDIRG、TTLQMRSEMADD、
SMLNDYRDYTTH、TRDKSSMLERWP。
Embodiment 3.FB1Antigenic epitope is used as competition application of the antigen in ELISA
(1) sample extraction
Weigh 5g samples（Corn and its relevant food）, add the methanol-PBS solution of 25 milliliter of 60 %, 200 rpm
Vibration 5 minutes；After extracting solution is filtered with No. 1 filter paper of whatman, take 1 milliliter of filtrate and add 4 milliliters of PBS（Phosphate
Buffer, pH=7.2）After mixing, as sample extracting solution is stand-by.
（2）Coating and closing
Anti- FB is diluted with 10 mM PBS (pH 7.4)1Monoclonal antibody, 10 g/mL coated elisa plates, 4 DEG C were incubated
Night.Washed after 3 times with PBST (10 mM PBS, 0.05% Tween-20 (v/v)) within second day, with containing 3% defatted milk powder
PBS closed, it is after 37 DEG C of incubations 1 hour, stand-by with PBST board-washings 6 times.
（3）The foundation of standard curve
Take out Jing steps（2）The lath handled well, puts into 50 l respectively and shows there is FB per hole1Antigenic epitope is bitten
Thalline（1.0×1011pfu）With a series of 50 l FB of variable concentrations1Standard substance, 37 DEG C are incubated 1 hour.Add 1:5000
The anti-M13 phagies two of dilution HRP labellings resist, and 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450.With FB1It is dense
Degree logarithm be abscissa, combination rate（Add FB1Hole OD450/ do not add FB1Hole OD450×100%）For vertical coordinate, build
Vertical indirect competition standard curve.As a result show that standard curve is S-type, linear dependence is preferable（Fig. 1）.Such as Fig. 1, with FB1 antigens
Mimic epitope（Aminoacid sequence is NNAAMYSEMATD）The indirect competitive ELISA standard curve of foundation.Standard curve it is linear
Regression equation be y=- 144.5ln (x)+196.18, R=0.9609, IC50 values be 0.562ng/mL, linearity test model
Enclose for 0.171 ~ 2.420 ng/mL, lowest detection is limited to 0.121 ng/mL.
（4）The detection of sample
Take out Jing steps（2）The lath handled well, puts into 50 l respectively and shows there is FB per hole1Antigenic epitope is bitten
Thalline（1.0×1011pfu）With testing sample extracting solution, 37 DEG C are incubated 1 hour.Add 1:The anti-M13 of 5000 dilution HRP labellings
Phage two resists, and 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450, calculations incorporated rate, and it is bent according to standard
Line, FB in sample of retrodicting out1Content.
Embodiment 4.FB1Application of the antigenic epitope as solid phase antigen in ELISA
(1) sample extraction
Weigh 5g samples（Corn and its relevant food）, add the methanol-PBS solution of 25 milliliter of 60 %, 200 rpm
Vibration 5 minutes；After extracting solution is filtered with No. 1 filter paper of whatman, take 1 milliliter of filtrate and add 4 milliliters of PBS（Phosphate
Buffer, pH=7.2）After mixing, as sample extracting solution is stand-by.
（2）Coating and closing
There is FB with 10 mM PBS (pH 7.4) dilution displayings1The phage of antigenic epitope（2.0×1011pfu）,
100 microlitres are coated in ELISA Plate, 4 DEG C of overnight incubations.Second day with PBST (10 mM PBS, 0.05% Tween-20 (v/
V) after) washing 3 times, closed with the PBS containing 3% defatted milk powder, after 37 DEG C of incubations 1 hour, treated for 6 times with PBST board-washings
With.
（3）The foundation of standard curve
Take out Jing steps（2）The lath handled well, puts into the anti-FB of 50 l respectively per hole1Monoclonal antibody（0.5 ng/
ml）With a series of 50 l FB of variable concentrations1Standard substance, 37 DEG C are incubated 1 hour.Add 1:The sheep of 2000 dilution HRP labellings
Anti- Mus IgG bis- resists, and 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450.With FB1Log concentration is abscissa, knot
Conjunction rate（Add FB1Hole OD450/ do not add FB1Hole OD450×100%）For vertical coordinate, indirect competition standard is set up bent
Line.
（4）The detection of sample
Take out Jing steps（2）The lath handled well, puts into the anti-FB of 50 l respectively per hole1Monoclonal antibody（0.5 ng/
ml）With a series of 50 l FB of variable concentrations1Standard substance, 37 DEG C are incubated 1 hour.Add 1:The sheep of 2000 dilution HRP labellings
Anti- Mus IgG bis- resists, and 37 DEG C are incubated 1 hour.Then developed the color with tmb substrate, read OD450.With FB1Log concentration is abscissa, knot
Conjunction rate（Add FB1Hole OD450/ do not add FB1Hole OD450×100%）For vertical coordinate, indirect competition standard is set up bent
Line.
Embodiment 5.FB1Application of the antigenic epitope as solid phase antigen in highly-pathogenic avian influenza
(1) sample extraction
Weigh 5g samples（Corn and its relevant food）, add the methanol-PBS solution of 25 milliliter of 60 %, 200 rpm
Vibration 5 minutes；After extracting solution is filtered with No. 1 filter paper of whatman, take 1 milliliter of filtrate and add 4 milliliters of PBS（Phosphate
Buffer, pH=7.2）After mixing, as sample extracting solution is stand-by.
（2）The dot matrix of phage and control line
There is FB of the present invention with 10 mM PBS (pH 7.4) dilution displayings1The phage of antigenic epitope（2.0×1011
pfu）, phage is lined on nitrocellulose filter with dot matrix instrument or micropipettor（Aperture 0.2-0.45 microns）, as
Detection line；The sheep anti-mouse igg two of the HRP labellings of 0.5 mg/ml is resisted, and same nitric acid is lined with dot matrix instrument or micropipette
On cellulose membrane（Positioned at the top of detection line, distance is more than 5 millimeters）, as control line.
（3）Colloid gold label FB1Antibody
By FB1Antibody is added dropwise over colloidal gold solution（pH=8.2）In, stir in drop, after 30 minutes, take 1% PEG and add
Enter in above-mentioned solution, after continuing stirring 15 minutes, add 10% BSA solution of 1/10th volumes, after stirring 15 minutes, stand
30 minutes, supernatant after centrifugation, is removed, obtain the FB of colloid gold label1Antibody-solutions.
（4）The assembling of colloidal-gold detecting-card
By the FB of colloid gold label1Antibody point is sprayed in glue gold pad（1.0 mcg/ml）, by sample pad, glue gold pad, point
The nitrocellulose filter and absorption paper of battle array detection line and control line is assembled, and is cut into test strips, loads stand-by in detection card.
（5）The detection of sample
Sample extracting solution is added in sample pad, 10 minutes is stood, if containing FB in sample1And exceed gold colloidal detection examination
The detection threshold value of paper, then detection line region do not develop the color, and control line region colour developing；If FB is not contained in sample1And it is less than colloid
The detection threshold value of golden Test paper, then detection line region colour developing, control line region is also developed the color.If control line region is not developed the color, table
Bright test strips failure.
5 FB of embodiment1A large amount of preparations of antigenic epitope
（1）In the way of Phage amplification
To show that the phage for there are FB1 antigenic epitopes is added to 20 ml to be inoculated with the culture of ER 2738,37
Spend 220 rpm shaken cultivation, 4.5 h.Culture is proceeded in another centrifuge tube, 4 DEG C of 10000 rpm is centrifuged 10 min, will be upper
Clear 80 % of top is proceeded in a fresh tube, adds the PEG/NaCl of 1/6 volume, 120 min are stood at 4 DEG C.4℃ 10000
Rpm centrifugation PEG/NaCL stand 15 min of solution.Supernatant is abandoned, residual supernatant after of short duration centrifugation, is sucked.1mL TBS are added to enter
Row is resuspended, as Phage amplification liquid.
（2）With FB1The mode of antigenic epitope-fusion protein is prepared
A.PCR expands the external source encoding gene of FB1 antigenic epitopes
PCR reaction systems： (50 µL)
10 × Pyrobest Buffer (Mg2+ plus) 5 µL
dNTP Mixture (each for 2.5 mM) 4µL
M13KE insert extension primer (10 mM） 1µL
-96 gIII sequencing primer (10 mM) 1µL
1 L of phage DNA template
Pyrobest DNA Polymerase 0.5µL
Sterilizing 37.5 L of ddH2O
PCR reaction conditions：95 DEG C of 5 min, then 95 DEG C of 30 sec, 55 DEG C of 30 sec, 72 DEG C of 40sec,
72 DEG C of 10 min totally 30 cycles.
Using PCR product QIAquick Gel Extraction Kit purification PCR products, trace dna quantitative instrument is quantitative.FB1 antigen mimicking tables
The coding gene sequence of position is corresponded to respectively：
AATAATGCGGCGATGTATTCGGAGATGGCTACTGA、
TTTTATACTAGTCCGGGTCGGACGAGTCATTATATG 、ATTCATCAGGAGTTGCGTTATACTAAGGATTCTCCG、
GGGGATGGGGTGCATAAGTCGCATGATATCCGTGGG、ACTACGCTTCAGATGCGTAGTGAGATGGCTGATGAT、
TCGATGCTTAATGATTATCGTGATTATACTACTCAT、ACTCGGGATAAGTCGTCGATGTTGGAGCGTTGGCCG
B. the double digestion of external source encoding gene and expression vector
The external source code gene of ACC65I and Eag I enzymes and expression vector is respectively adopted（PMAl-pIII, NEB company,
MBP fusion protein can be expressed）Carry out double digestion.
C. after enzyme action product connection and conversion
By plasmid pMal-PIII and purpose fragment with 1: 10（Mol ratio）Mix, connect 12 h in 16 DEG C of water-baths,
Take 10 μ L connection products to add in 100 μ L competent cell TB1, fully mix.After 30 min of ice bath, 42 DEG C of water-bath heat shocks
90 s, add 600 μ L LB liquid mediums immediately after 5 min of ice bath, 37 DEG C, and 200 rpm cultivate 1 h, 10000 rpm from
2 min of the heart, sucks supernatant and leaves and takes about 200 μ L, coat LB-A solids（Ampr）In culture medium, 37 DEG C of incubated overnight are obtained
Positive colony.
D.FB1The expression of antigenic epitope-MBP fusion protein
By positive colony of above-mentioned acquisition, a single bacterium colony is chosen from flat board and is inoculated in 5 mL LB-A, in 0.2% sucrose,
37 DEG C, overnight culture overnight, is pressed 1 % inoculum concentrations by 220 r/min, shaken cultivation（v/v）It is inoculated in the LB-A of 50 mL, 0.2
In % sucrose medium, 3 bottles are inoculated with respectively, 37 DEG C, 220 r/min shaken cultivation, when culture bacterial concentration OD600 reaches 0.6
When, IPTG to final concentration of 0.2 mmol/L, 220 r/min shaken cultivation, by inducer are added in three bottles of cultures（PEG
Solution）In 4 DEG C, 4000 g, centrifugation 20 min collects thallines precipitation abandon supernatant.Re-suspended cell is in 400 mL, 30 mM Tris-
HCl, 20% sucrose, pH 8.0 (80 mL/g wet cell weights) add the mM of EDTA to 1, concussion 5-10 min under room temperature, and 8000
G, is centrifuged 20 min, abandons supernatant by 4 DEG C, and precipitation is resuspended in 5 mM MgSO4 of 400 ml pre-coolings, shakes 10 min on ice, and 8000
G, 4 DEG C, is centrifuged 20 min, retains supernatant, 8 mL 1 M Tris-HCl, pH 7.4 are added in supernatant, obtain FB1 antigens
Mimic epitope-MBP fusion protein.
SEQUENCE LISTING
<110>University Of Nanchang
<120>It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application
<130> 1
<160> 14
<170> PatentIn version 3.3
<210> 1
<211> 12
<212> PRT
<213>Artificial sequence
<400> 1
Asn Asn Ala Ala Met Tyr Ser Glu Met Ala Thr Asp
1 5 10
<210> 2
<211> 12
<212> PRT
<213>Artificial sequence
<400> 2
Phe Tyr Thr Ser Pro Gly Arg Thr Ser His Tyr Met
1 5 10
<210> 3
<211> 12
<212> PRT
<213>Artificial sequence
<400> 3
Ile His Gln Glu Leu Arg Tyr Thr Lys Asp Ser Pro
1 5 10
<210> 4
<211> 12
<212> PRT
<213>Artificial sequence
<400> 4
Gly Asp Gly Val His Lys Ser His Asp Ile Arg Gly
1 5 10
<210> 5
<211> 12
<212> PRT
<213>Artificial sequence
<400> 5
Thr Thr Leu Gln Met Arg Ser Glu Met Ala Asp Asp
1 5 10
<210> 6
<211> 12
<212> PRT
<213>Artificial sequence
<400> 6
Ser Met Leu Asn Asp Tyr Arg Asp Tyr Thr Thr His
1 5 10
<210> 7
<211> 12
<212> PRT
<213>Artificial sequence
<400> 7
Thr Arg Asp Lys Ser Ser Met Leu Glu Arg Trp Pro
1 5 10
<210> 8
<211> 35
<212> DNA
<213>Artificial sequence
<400> 8
aataatgcgg cgatgtattc ggagatggct actgat 36
<210> 9
<211> 36
<212> DNA
<213>Artificial sequence
<400> 9
ttttatacta gtccgggtcg gacgagtcat tatatg 36
<210> 10
<211> 36
<212> DNA
<213>Artificial sequence
<400> 10
attcatcagg agttgcgtta tactaaggat tctccg 36
<210> 11
<211> 36
<212> DNA
<213>Artificial sequence
<400> 11
ggggatgggg tgcataagtc gcatgatatc cgtggg 36
<210> 12
<211> 36
<212> DNA
<213>Artificial sequence
<400> 12
actacgcttc agatgcgtag tgagatggct gatgat 36
<210> 13
<211> 36
<212> DNA
<213>Artificial sequence
<400> 13
tcgatgctta atgattatcg tgattatact actcat 36
<210> 14
<211> 36
<212> DNA
<213>Artificial sequence
<400> 14
actcgggata agtcgtcgat gttggagcgt tggccg 36
Claims (3)
1. it is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope, it is characterised in that aminoacid sequence is：
SMLNDYRDYTTH。
2. encode and described in claim 1, be directed to fumonisins B1Dodecapeptide antigenic epitope aminoacid sequence nucleotide.
3. nucleotide as claimed in claim 2, sequence is：
TCGATGCTTAATGATTATCGTGATTATACTACTCAT。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410529689.7A CN104356208B (en) | 2013-03-06 | 2013-03-06 | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410529689.7A CN104356208B (en) | 2013-03-06 | 2013-03-06 | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application |
| CN201310070886.2A CN103342739B (en) | 2013-03-06 | 2013-03-06 | Antigenic mimic epitope of fumonisin B1 and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310070886.2A Division CN103342739B (en) | 2013-03-06 | 2013-03-06 | Antigenic mimic epitope of fumonisin B1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104356208A CN104356208A (en) | 2015-02-18 |
| CN104356208B true CN104356208B (en) | 2017-04-05 |
Family
ID=52523538
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410529689.7A Expired - Fee Related CN104356208B (en) | 2013-03-06 | 2013-03-06 | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104356208B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH06321998A (en) * | 1993-05-10 | 1994-11-22 | Kikkoman Corp | Anti-fumonisin monoclonal antibody, hybridoma, hapten antigen and their production |
| CN101231291A (en) * | 2007-01-25 | 2008-07-30 | 天津科技大学 | Kit and method for quantitative determination of Fumonisin B1 content in food by ELISA detection technique |
-
2013
- 2013-03-06 CN CN201410529689.7A patent/CN104356208B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH06321998A (en) * | 1993-05-10 | 1994-11-22 | Kikkoman Corp | Anti-fumonisin monoclonal antibody, hybridoma, hapten antigen and their production |
| CN101231291A (en) * | 2007-01-25 | 2008-07-30 | 天津科技大学 | Kit and method for quantitative determination of Fumonisin B1 content in food by ELISA detection technique |
Non-Patent Citations (2)
| Title |
|---|
| Development of an improved monoclonal antibody-based ELISA for fumonisin B-1-3 and the use of molecular modeling to explain observed detection limits;Elissalde, MH et al.;《FOOD AND AGRICULTURAL IMMUNOLOGY》;19951231;第7卷(第2期);第109-122页 * |
| 利用噬菌体肽库淘选玉米赤霉烯酮的模拟表位;何庆华等;《食品科学》;20070815;第28卷(第8期);第241-243页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104356208A (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103848895B (en) | The linear dodecapeptide antigenic epitope of aflatoxin B1 and its application | |
| CN104530194B (en) | Antigenic epitope for ochratoxin A and its application | |
| CN104327166B (en) | The dodecapeptide antigenic epitope of ochratoxin A and its application | |
| CN104311637B (en) | Simulation fumonisins B1Antigenic epitope and its application | |
| CN103044527B (en) | Antigenic mimic epitope of gentamycin and application thereof | |
| CN104356208B (en) | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN104311635B (en) | For fumonisins B1Antigenic epitope and its application | |
| CN104311638B (en) | Fumonisins B can be simulated1Antigenic epitope and its application | |
| CN103145808B (en) | Antigen mimic epitope of ochratoxin A and application thereof | |
| CN104530195B (en) | Simulate antigenic epitope and its application of ochratoxin A | |
| CN103044526B (en) | Antigenic mimic epitope of vardenafil and application thereof | |
| CN104356207B (en) | Fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN104311634B (en) | Aflatoxin B1Antigenic epitope AM 1 and its application | |
| CN103848896B (en) | The antigenic epitope Ph5 of bisphenol-A and application thereof | |
| CN103848898B (en) | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof | |
| CN103848897B (en) | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof | |
| CN104311636B (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN104119425B (en) | The antigenic epitope of simulation norfloxacin and application thereof | |
| CN103965290B (en) | The heptapeptide antigenic epitope of norfloxacin and application thereof | |
| CN103342739B (en) | Antigenic mimic epitope of fumonisin B1 and application thereof | |
| CN103848899B (en) | The antigenic epitope Ph15 of bisphenol-A and application thereof | |
| CN103059101B (en) | Antigenic mimic epitope of aflatoxin (AF) B1 and application thereof | |
| CN103102391B (en) | Antigenic mimic epitope of norfloxacin and application thereof | |
| CN104844692B (en) | A kind of dodecapeptide and its application with reference to zearalenone | |
| CN104788543A (en) | Polypeptide-based zearalenone antibody mimics and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170405 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |