CN108387740A - A kind of epitope peptide, preparation method and the application of simulation Enrofloxacin - Google Patents
A kind of epitope peptide, preparation method and the application of simulation Enrofloxacin Download PDFInfo
- Publication number
- CN108387740A CN108387740A CN201810086387.5A CN201810086387A CN108387740A CN 108387740 A CN108387740 A CN 108387740A CN 201810086387 A CN201810086387 A CN 201810086387A CN 108387740 A CN108387740 A CN 108387740A
- Authority
- CN
- China
- Prior art keywords
- enr
- added
- supernatant
- solution
- epitope
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plasma & Fusion (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides a kind of epitope peptide, preparation method and the applications of simulation Enrofloxacin.The technical solution is primarily based on phage display peptide library technology, using anti-ENR monoclonal antibodies as target, shows that elutriation obtains a kind of ENR antigenic epitopes that sequence is GKPYITW in heptapeptide library from phage random.The present invention is set forth through Phage amplification means, the method for preparing the antigenic epitope by genetic recombination means.The present invention surrounds the Immunological binding properties of the antigenic epitope, and specific detection method is devised based on enzyme linked immunosorbent assay, colloidal gold immunity chromatography, fluorescent micro-ball immune chromatography method.The antigenic epitope has immune response characteristic similar with natural ENR molecules, can substitute that drug resistance is strong and expensive ENR standard items are used for the immunology detection of ENR, and testing result is accurate, high sensitivity.
Description
Technical field
The present invention relates to phage display peptide library technical fields, and in particular to a kind of epitope of simulation Enrofloxacin
Peptide, preparation method and application.
Background technology
Enrofloxacin (Enrofloxacin, ENR), belongs to the representative drugs of fluoroquinolones, due to the use of it is convenient, at
This is cheap, significant in efficacy, is widely used in the treatment and control of animal-breeding field bacterium, viral infection Animal diseases.It is supporting
It grows in industry, some culturists do not follow the animal off-drug period, the economic interests of bigger are obtained by abusing ENR, to cause ENR
Become a universal phenomenon in animal derived food.Numerous studies show that long-term consumption can make containing the remaining food of ENR
The drug resistance of adult causes the adverse reaction and allergic reaction of the systems such as digestive system, nervous system and urogenital system.
China's animal products happens occasionally by export restrictions repeatly since such medicament residue is exceeded in recent years.Therefore, reinforce ENR antibiotic
Residual high-sensitivity rapid detection research is particularly important.
Currently, the detection method of ENR mainly has high performance liquid chromatography, gas-chromatography, high performance liquid chromatography series connection in food
The methods of mass spectrum, gas-chromatography tandem mass spectrum and immunoassay, immunoassay method is simple and convenient with its, high sensitivity, cost
More low characteristic is widely used in the detection of ENR.But during implementing immunoassay detection, it is necessary to
Competition antigen or solid-phase coating antigen are prepared using ENR standard items are basic raw material, it is easy that ENR does not only result in humans and animals
Drug resistance phenomenon is generated, and expensive, the health and ecological environment of testing staff are caused great harm.In recent years
Carry out researcher and successfully substitute small molecule antigens using antigenic epitope to have carried out immunology detection, in this case, such as
Fruit can obtain a kind of alternative innocuous substance to natural ENR with similar immune response characteristic, then be expected to for ENR's
It avoids using a large amount of ENR standard items in immunologic detection method, to reduce testing cost while promoting safety.
Invention content
The present invention is directed to the technological deficiencies for the prior art, provide a kind of epitope peptide of simulation Enrofloxacin, with
Solving to lack in the prior art a kind of having similar immune response characteristic with Enrofloxacin, can substitute it and make the immune inspection of responsive type and examine
The technical issues of surveying element.
Invention also provides the preparation methods of the epitope peptide of above-mentioned simulation Enrofloxacin, to solve its preparation side
The indefinite technical problem of method.
Invention also provides epitope peptide the answering in specific immunologic detection method of above-mentioned simulation Enrofloxacin
With to solve the immunological properties progress adaptability that common detection methods in the prior art are not directed to the epitope peptide
The technical issues of matching, thus being difficult to obtain optimum detection effect.
To realize that the above technical purpose, the present invention use following technical scheme：
A kind of epitope peptide of simulation Enrofloxacin, amino acid sequence are：GKPYITW.
A kind of gene of the above-mentioned epitope peptide of coding, nucleotides sequence are classified as： GGTAAGCCTTATTTAACTTGG.
Invention also provides a kind of preparation methods of above-mentioned epitope peptide, include the following steps：There to be ENR
The bacteriophage of antigenic epitope is added to 20ml in the culture solution for being inoculated with 2738 Escherichia coli of ER, 37 DEG C of 150rpm oscillations
Cultivate 4.5h；Culture is transferred in another centrifuge tube, 4 DEG C of 12000g centrifuge 10min, and the top of supernatant 80% is transferred to one
In fresh tube, the PEG/NaCl of 1/6 volume is added, 4 DEG C stand overnight；4 DEG C of 12000g centrifuge 15min, and precipitation is resuspended in 1ml
In TBS, 4 DEG C of 14000rpm centrifuge 5min；Supernatant is transferred in another centrifuge tube, and the PEG/NaCl of 1/6 volume is added, is incubated on ice
1h, 4 DEG C of 14000rpm centrifuge 10min；Supernatant is abandoned, precipitation is resuspended in 200 μ l TBS.It is described to have in the preparation method
The bacteriophage of ENR antigenic epitopes can be obtained by following Panning methods：
The affine elutriation of ENR antigenic epitopes：Specific method is：With 0.1M NaHCO3(pH 8.6) dilutes anti-ENR
Monoclonal antibody, and be added in 96 hole enzyme mark single holes with 80 μ g/ml of final concentration, 4 DEG C of coatings are overnight.Secondary daily TBST [50mM
Tris-HCl (pH7.5), 150mM NaCl, 0.1%Tween-20 (v/v)] after quick wash 6 times, 350 μ l 1%OVA are added
Confining liquid, 4 DEG C of closing 2h.Confining liquid is abandoned, is washed 6 times with TBST, 120 μ l phage peptide library (phage display heptapeptides are added
Library is purchased from NEB companies, dilutes bacteriophage with TBST, addition is 2.0 × 1011Pfu), 25 DEG C of reaction 50min.It abandons in hole
Bacteriophage is patted dry with TBST quick wash 10 times, is eluted with 0.2M Glycine-HCl (pH 2.2), then with 15 μ l 1M
Tris-HCl (pH 9.1) neutralizes eluent.5 μ l wash-out bacteriophages are taken to survey titre, it is remaining to be used for E.coli ER2738 bacterial strains
It is expanded.Secondary daily PEG/NaCl purified phages, and measure the titre of bacteriophage after amplification.In washing in a pan for second, third wheel
During choosing, coated anti-ENR MAb concentrations are respectively 40 μ g/ml and 20 μ g/ml, and confining liquid is followed successively by 1%BSA
And 1%OVA, TBST used a concentration of 0.3% and 0.5%.In type of elution, the second wheel still uses 0.2M Glycine-
HCl (pH 2.2) is eluted, and third round is ENR standard items (10ng/ml) competitive elution, remaining step is same as above.
Invention also provides another preparation methods of above-mentioned epitope peptide, include the following steps：
1) PCR amplification sequence is the DNA fragmentation of GGTAAGCCTTATTTAACTTGG, ACC65I and Eag I enzymes are respectively adopted
Double digestion is carried out to the DNA fragmentation and pMAl-pIII expression vectors；By plasmid pMal-PIII and the DNA fragmentation with 1: 10
Molar ratio mixing connects 12h in 16 DEG C of water-baths, 10 μ l connection products is taken to add in 100 μ l competent cells TB1, fully mixed
It is even；After ice bath 30min, 42 DEG C of water-bath heat shock 90s add 600 μ l LB liquid mediums immediately after ice bath 5min, 37 DEG C
200rpm cultivates 1h, and 10000rpm centrifuges 1min, sucks supernatant and leave and take about 200 μ l, be coated in LB-A solid mediums, 37
It DEG C is incubated overnight, obtains positive colony.
2) by the positive clone molecule of above-mentioned acquisition, a single bacterium colony is chosen from tablet and is inoculated in 5ml LB-A, 0.2% sucrose
In, 37 DEG C of 220rpm shaken cultivations are stayed overnight, by overnight culture by the inoculum concentration of 1% (v/v) be inoculated in 50ml LB-A,
In 0.2% sucrose culture medium, 37 DEG C of 220rpm shaken cultivations, when culture bacterial concentration reaches OD600nmWhen value is 0.6, Xiang Pei
It supports and IPTG to final concentration of 0.2mM is added in object, PEG solution is centrifuged 20min in 4 DEG C of 4000g, received by 220rpm shaken cultivations
Collect bacterial sediment, abandons supernatant；Cell is resuspended in the solution that 400ml contains that 30mM Tris-HCl, 20% sucrose and pH are 8.0,
EDTA to 1mM is added, shakes 10min at room temperature, 4 DEG C of 8000g centrifuge 20min, abandon supernatant, and precipitation is resuspended in 400ml precoolings
5mM MgSO4, shake 10min on ice, 4 DEG C of 8000g centrifuge 20min, retain supernatant, be added into supernatant 8ml pH be 7.4,
The Tris-HCl of a concentration of 1M obtains ENR antigenic epitope-MBP fusion proteins.
It is obtained by chemiluminescent polypeptide synthetic method based on its amino acid sequence in addition, above-mentioned epitope peptide can also be
's.
The present invention also provides above-mentioned epitope peptides to be used to detect food as the competition antigen of enzyme linked immunosorbent assay
The application of middle ENR.
The present invention also provides above-mentioned epitope peptides to be used to detect food as the solid phase antigen of enzyme linked immunosorbent assay
The application of middle ENR.
The present invention also provides above-mentioned epitope peptides to be used to detect ENR in food as the detection line of colloid gold test paper
Application.
Preferably, the application includes the following steps：
With bacteriophage of the 10mM PBS buffer solution dilution with ENR antigenic epitopes to 2.0 × 1011Pfu takes 0.5mg/
The sheep anti-mouse igg secondary antibody of ml, with XYZ three-dimensional points spray instrument difference specking on nitrocellulose filter, the detection line as test strips
And nature controlling line, line-to-line are spare every about 7mm, 37 DEG C of dry 12h.Use K2CO3It is 8.2 to adjust 1ml colloidal gold solutions to pH value, is used
Distilled water dilutes anti-ENR monoclonal antibodies to 0.04mg/ml, takes and is slowly added in colloidal gold solution in right amount, stirs, stirs in drop
It after mixing reaction 1h, is added in 100 μ l 1%PEG to solution, continues to stir 30min；100 μ l 10%BSA solution are added, stir
30min, 4 DEG C of 8000rpm centrifuge 30min, abandon supernatant, and precipitation is resuspended in 100 μ l re-suspension liquids, and 4 DEG C save backup.By colloid gold label
Antibody complex dilutes a certain concentration, the compound after dilution is sprayed on bonding pad with XYZ three-dimensional points spray instrument, 4 DEG C of dryings
2h, it is spare.Nitrocellulose filter, gold conjugation pad, sample pad and blotting paper are assembled in successively on PVC bottom plates, cutter is used
The test strips for cutting into 4mm wide are fitted into detection card, spare.80 μ l sample extracting solutions are added in test strips well, 10min
After observe testing result.
The present invention also provides above-mentioned epitope peptides to be used to detect ENR in food as the detection line of fluorescent microsphere test paper
Application.
Preferably, the application includes the following steps：
With 10mM bacteriophages of the PBS dilutions with ENR antigenic epitopes to 2.0 × 1011Pfu takes 0.5 mg/ml's
Sheep anti-mouse igg secondary antibody, with XYZ three-dimensional points spray instrument difference specking on nitrocellulose filter, detection line and matter as test strips
Line is controlled, line-to-line is spare every about 7mm, 37 DEG C of dry 12h；The fluorescent microsphere of 25 μ l is added in 4.5ml PB solution, is added
Enter EDC activation 15min, takes the anti-ENR monoclonal antibodies of 0.9 μ g to be slowly added in PB solution, be stirred to react 2h；500 μ l 10% are added
BSA solution is stirred to react 30min, and 4 DEG C of 8000rpm centrifuge 10min, abandons supernatant, and precipitation, 4 DEG C of preservations are resuspended in 500 μ l re-suspension liquids
It is spare.Fluorescent microsphere labelled antibody compound is diluted, the compound after dilution is sprayed at bonding pad with XYZ three-dimensional points spray instrument
On, 30 DEG C of dry 2h are spare.Nitrocellulose filter, fluorescent microsphere bonding pad, sample pad and blotting paper are assembled in PVC successively
On bottom plate, the test strips that 4mm wide is cut into cutter are fitted into detection card, spare；Test strips are added in 80 μ l sample extracting solutions
In well, testing result is observed under ultraviolet lighting shot-light after 15min.
In the technical solution of the present invention, the epitope peptide of the simulation Enrofloxacin, also referred to as ENR antigens mould
Quasi- epitope or En Ruosha star antigenic epitopes.
In the amino acid sequence of above-mentioned epitope, capitalization English letter respectively represents known natural L-form amino acid residue
Or one kind of its D- type isomers, wherein G represent glycine, I represents isoleucine residues, and K represents lysine residue, and P is represented
Proline residue, T represent threonine residues, and W represents tryptophan, and Y represents tyrosine residue.
Mimic epitope of synthesis itself in use, immunology detection can be used for by ENR antigenic epitopes of the present invention
Analysis, can also have the displaying obtained by Phage amplification the bacteriophage particles of ENR antigenic epitopes (polypeptide) directly to use
It detects in analysis, is carried out instead of ENR standard items it is of course also possible to be separated from bacteriophage ENR antigenic epitopes
Immunology detection is analyzed.
The present invention provides a kind of epitope peptide, preparation method and the applications of simulation ENR.Technical solution base first
In phage display peptide library technology, using anti-ENR monoclonal antibodies as target, target low temperature is coated in enzyme mark hole, addition is bitten
Thalline shows that heptapeptide library carries out affine elutriation at random, obtains a kind of ENR antigenic epitopes that sequence is GKPYITW.
On this basis, the present invention is set forth through Phage amplification means, is prepared and be somebody's turn to do by genetic recombination means
The method of antigenic epitope.At the same time, the present invention is based on the Immunological binding properties of the antigenic epitope, are exempted from based on enzyme-linked
Epidemic disease absorption method, colloidal gold immunity chromatography, fluorescent micro-ball immune chromatography method devise specific detection method.
The antigenic epitope has immune response characteristic similar with natural ENR molecules, can it is expensive with fictitious hosts and
With the immunology detection that drug resistance is strong, teratogenesis, carcinogenesis ENR standard items are used for ENR, testing result is accurate, sensitivity
It is high.The present invention effectively reduces the harm to health and ecological environment in ENR detection process, while having saved cost, tool
There is application value outstanding.
The sequence table of mimic epitope peptide of the present invention is as follows：
Description of the drawings
Fig. 1 is the indirect competitive ELISA standard song established with ENR antigenic epitopes in the specific embodiment of the invention 3
Line；The IC of ENR antigenic epitopes (GKPYITW) and anti-ENR antibody50Value is 89.5pg/ml.
Specific implementation mode
The specific implementation mode of the present invention will be described in detail below.In order to avoid excessive unnecessary details,
It will not be described in detail in following embodiment to belonging to well known structure or function.
Approximating language used in following embodiment can be used for quantitative expression, show in the feelings for not changing basic function
Quantity is allowed to have certain variation under condition.Therefore, it is not limited to this accurately with the modified numerical value of the language such as " about ", " left and right " institute
Numerical value itself.In some embodiments, the range for allowing its modified numerical value in positive and negative 10 (10%) " about " is indicated
Interior variation, for example, what " about 100 " indicated can be any numerical value between 90 to 110.In addition, in " the about first numerical value
To second value " statement in, at about correct the first and second numerical value two values.In some cases, approximation language
Speech may be related with the precision of measuring instrument.
In addition to being defined, technical and scientific term used in following embodiment has and fields technology people of the present invention
The identical meanings that member is commonly understood by.
Test reagent consumptive material used in following embodiment is unless otherwise specified conventional biochemical reagent；The experiment
Method is unless otherwise specified conventional method；Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result
It is averaged；% in following embodiment is unless otherwise instructed mass percentage.
The elutriation and its identification of embodiment 1, ENR antigenic epitopes
(1) the affine elutriation of ENR antigenic epitopes：Specific method is：With 0.1M NaHCO3(pH 8.6) dilution is anti-
ENR monoclonal antibodies, and be added in 96 hole enzyme mark single holes with 80 μ g/ml of final concentration, 4 DEG C of coatings are overnight.Secondary daily TBST [50mM
Tris-HCl (pH7.5), 150mM NaCl, 0.1%Tween-20 (v/v)] after quick wash 6 times, 350 μ l 1%OVA are added
Confining liquid, 4 DEG C of closing 2h.Confining liquid is abandoned, is washed 6 times with TBST, 120 μ l phage peptide library (phage display heptapeptides are added
Library is purchased from NEB companies, dilutes bacteriophage with TBST, addition is 2.0 × 1011Pfu), 25 DEG C of reaction 50min.It abandons in hole
Bacteriophage is patted dry with TBST quick wash 10 times, 8min is eluted with 0.2M Glycine-HCl (pH 2.2), then with 15 μ l
1M Tris-HCl (pH 9.1) neutralize eluent.5 μ l wash-out bacteriophages are taken to survey titre, it is remaining to be used for E.coli ER2738
Bacterial strain is expanded.Secondary daily PEG/NaCl purified phages, and measure the titre of bacteriophage after amplification.In second, third wheel
Panning process in, coated anti-ENR MAb concentrations are respectively 40 μ g/ml and 20 μ g/ml, and confining liquid is followed successively by 1%
BSA and 1%OVA, TBST used a concentration of 0.3% and 0.5%.In type of elution, the second wheel still uses 0.2M
Glycine-HCl (pH 2.2) is eluted, and third round is ENR standard items (10ng/ml) competitive elution, remaining step is same as above.
(2) identification of positive phage clones：The random picking from the tablet for measuring phage titre after third round elutriation
24 bacteriophage spots carry out the amplification of bacteriophage and are purified, and sun is carried out to purified product using indirect enzyme-linked immunosorbent assay
Property identification, concrete operations are as follows：With 0.1M NaHCO3(pH 8.6) dilutes anti-ENR monoclonal antibodies, and 1 μ g/ml are coated with 96 holes
ELISA Plate, 4 DEG C of overnight incubations.After secondary daily PBST [10mM PBS, pH7.4,0.05%Tween-20 (v/v)] is washed 3 times, use
1%BSA is closed, 4 DEG C of closing 2h；Confining liquid is abandoned, PBST is washed 3 times；The 100 plaque-purified liquid of μ l (about 1.0 are added
×1010Pfu), using naive phage peptide library as negative control, 37 DEG C are incubated 45min, and PBST is washed 6 times；It is added 1:5000
Diluted HRP marks 100 μ l of anti-M13 bacteriophages secondary antibody again, and 37 DEG C are incubated 45min, and PBST is washed 6 times；100 μ l TMB are added
Substrate solution, is protected from light colour developing 10min, and microplate reader reads the absorption value at 450nm.Choose OD450nmPhagocytosis of 2 times more than negative control
Body clone is positive colony.
(3) identification of ENR antigenic epitopes：Using enzyme linked immuno sorbent assay to all positive bacteriophages gram
Grand progress epitope determination, concrete operations are as follows：With 0.1M NaHCO3(pH 8.6) dilutes anti-ENR monoclonal antibodies, 1 μ g/ml
It is coated with 96 hole elisa Plates, 4 DEG C of overnight incubations.Secondary daily PBST [10mM PBS, pH7.4,0.05%Tween-20 (v/v)] washing
It after 3 times, is closed with 1%BSA, 4 DEG C of closing 2h；Confining liquid is abandoned, PBST is washed 3 times, and the bacteriophage gram of the 50 μ l positives is added
Grand (about 1.0 × 1010Pfu) and 50 μ l ENR standard items (10ng/ml), 37 DEG C of incubation 45min, PBST are washed 6 times；It is added
1:The 100 μ l of anti-M13 bacteriophages secondary antibody of 5000 dilution HRP labels, 37 DEG C are incubated 45min, and PBST is washed 6 times；100 μ l are added
Tmb substrate liquid, be protected from light colour developing 10min, microplate reader read 450nm at absorption value, the bacteriophage that can be inhibited by ENR standard items,
It is accredited as the antigenic epitope of ENR.
Embodiment 2, the sequencing of ENR antigenic epitope encoding genes and its determination of amino acid sequence
The bacteriophage for being accredited as ENR antigenic epitopes by enzyme linked immuno sorbent assay is expanded, is carried
Take the DNA of bacteriophage.Operating process is as follows：Purpose bacteriophage is expanded, after amplified production centrifugation, takes 500 μ l bacteriophages
Supernatant is transferred to a new centrifuge tube；200 μ l PEG/NaCl precipitating phages are added, stand 20min, 14000rpm centrifuges 10min.
Supernatant is abandoned, precipitation is resuspended in 100 μ l iodide buffer solutions (10mM Tris-HCl (pH 8.0), 1mM EDTA, 4M NaI), adds
Enter 250 μ l absolute ethyl alcohols precipitation, stand 15min, 14000rpm centrifuges 10min.It abandons after supernatant and washs precipitation with 70% ethyl alcohol again
(DNA sequencing template), 14000rpm centrifuge 10min, abandon supernatant, of short duration vacuum drying.Precipitation is resuspended in 30 μ l TE buffer solutions
(10mM Tris-HCl (pH 8.0), 1mM EDTA) takes 4 μ l to be analyzed into row agarose gel electrophoresis；Take 10 μ L bacteriophage templates
DNA sequencing is carried out, -96gIII sequencing primers are：5’-HOCCC TCA TAG TTA GCG TAA CG-3’.It is surveyed according to DNA
Sequence result and password sublist can get the amino acid sequence of ENR antigenic epitopes.The amino acid sequence of all plaques is
GKPYITW。
The application of embodiment 3, ENR antigenic epitopes as competition antigen in enzyme-linked immune analytic method
(1) sample extraction
By fat and the connective tissue removal of pork, is smashed with blender, weigh 2g in the centrifuge tube of 15ml, add
Methanol-the PBS solution for entering 4ml 50%, vibrates 3min on the oscillator；4000rpm centrifuges 10min.Precipitation repeats above-mentioned oscillation
And centrifugation step, merge supernatant twice, again 10000rpm, 4 DEG C of centrifugation 10min collect supernatant, with miillpore filter (hole
0.22 μm of diameter) filtering, with PBS by filtrate to dilute in equal volume, mixing is spare.Take 50 μ l filtered fluids be directly loaded onto in micropore into
Row ELISA measures.
(2) antibody is coated with
With 0.1M NaHCO3(pH 8.6) dilutes anti-ENR monoclonal antibodies, and 1 μ g/ml coated elisa plates, 4 DEG C were incubated
Night.It after secondary daily PBST [10mM PBS, 0.05%Tween-20 (v/v)] is washed 3 times, is closed with 1%BSA, 4 DEG C of envelopes
Close after educating 2h, PBST board-washings pat dry for 3 times, place 4 DEG C it is spare.
(3) foundation of standard curve
The lath handled well through step (2) is taken out, the bacteriophage of 50 μ l ENR antigenic epitopes is separately added into (about per hole
1.0×1010Pfu) and a series of 50 μ l ENR standard items of various concentrations, 37 DEG C of incubation 45 min, PBST are washed 6 times；It is added
100μl 1:The anti-M13 bacteriophages secondary antibody of 5000 dilution HRP labels, 37 DEG C are incubated 45min, and PBST is washed 6 times.100 μ l are added
Tmb substrate develops the color, and microplate reader reads OD450nmLight absorption value.Using ENR log concentrations as abscissa, (hole of ENR is added in Percentage bound
OD450nm/ be not added ENR hole OD450nm× 100%) it is ordinate, establishes ENR indirect competitive ELISA standard curves, ties
Fruit shows that linear dependence is good (Fig. 1).Such as Fig. 1, the indirect competitive enzyme-linked immunosorbent analysis side established with ENR antigenic epitopes
Method standard curve.The IC of ENR antigenic epitopes (GKPYITW) and anti-ENR antibody50Value is 89.5pg/ml.
(4) detection of sample
The lath handled well through step (2) is taken out, the bacteriophage of 50 μ l ENR antigenic epitopes is separately added into (about per hole
1.0×1010Pfu) and sample to be tested extracting solution, 37 DEG C of incubation 45min.Reaction solution is abandoned, PBST is washed 6 times；It is added 1:5000 is dilute
The anti-M13 bacteriophages secondary antibody of HRP labels is released, 37 DEG C of incubation 45min abandon reaction solution, and PBST is washed 6 times；Then aobvious with tmb substrate
Color reads OD450nmValue, calculations incorporated rate, and according to standard curve, calculate the content of ENR in sample.
The application of embodiment 4, ENR antigenic epitopes as solid phase antigen in enzyme-linked immune analytic method
(1) sample extraction
By fat and the connective tissue removal of pork, is smashed with blender, weigh 2g in the centrifuge tube of 15ml, add
Methanol-the PBS solution for entering 4ml 50%, vibrates 3min on the oscillator；4000rpm centrifuges 10min.Precipitation repeats above-mentioned oscillation
And centrifugation step, merge supernatant twice, again 10000rpm, 4 DEG C of centrifugation 10min collect supernatant, with miillpore filter (hole
0.22 μm of diameter) filtering, with PBS by filtrate to dilute in equal volume, mixing is spare.Take 50 μ l filtered fluids be directly loaded onto in micropore into
Row ELISA measures.
(2) it is coated with and closes
The bacteriophage (about 2.0 × 10 of ENR antigenic epitopes is diluted with 10mM PBS (pH 7.4)11Pfu), 100 μ l packets
By in ELISA Plate, 4 DEG C of overnight incubations.After secondary daily PBST [10mM PBS, 0.05%Tween-20 (v/v)] is washed 3 times, use
1%BSA is closed, spare with PBST board-washings 3 times after 4 DEG C of closing 2h.
(3) foundation of standard curve
The lath handled well through step (2) is taken out, the anti-ENR monoclonal antibodies of 50 μ l (0.3 ng/ml) are put into respectively per hole
With a series of 50 μ l ENR standard items of various concentrations, 37 DEG C of incubation 45min abandon reaction solution, and PBST is washed 6 times；It is added 1:
The sheep anti-mouse igg secondary antibody of 5000 dilution HRP labels, 37 DEG C of incubation 45min abandon reaction solution, and PBST is washed 6 times；Then the bottoms TMB are used
Object develops the color, and reads OD450nmValue.Using ENR log concentrations as abscissa, (OD in the hole of ENR is added in Percentage bound450nm/ be not added
The OD in the hole of ENR450nm× 100%) it is ordinate, establishes ENR indirect competitive ELISA standard curves.
(4) detection of sample
The lath handled well through step (2) is taken out, the anti-ENR monoclonal antibodies of 50 μ l (0.3 ng/ml) are put into respectively per hole
With sample to be tested extracting solution, 37 DEG C of incubation 45min abandon reaction solution, and PBST is washed 6 times；It is added 1:The sheep of 5000 dilution HRP labels
Anti- mouse IgG secondary antibodies, 37 DEG C of incubation 45min, abandon reaction solution, and PBST is washed 6 times；Then it is developed the color with tmb substrate, reads OD450nm
Value.Using ENR log concentrations as abscissa, (OD in the hole of ENR is added in Percentage bound450nm/ be not added ENR hole OD450nm×
100%) it is ordinate, establishes ENR indirect competitive ELISA standard curves.According to standard curve, the dense of the ENR in sample is calculated
Degree.
The application of embodiment 5, ENR antigenic epitopes as solid phase antigen in colloidal gold immunochromatographimethod method
(1) sample extraction
By fat and the connective tissue removal of pork, is smashed with blender, weigh 2g in the centrifuge tube of 15ml, add
Methanol-the PBS solution for entering 4ml 50%, vibrates 3min on the oscillator；4000rpm centrifuges 10min.Precipitation repeats above-mentioned oscillation
And centrifugation step, merge supernatant twice, again 10000rpm, 4 DEG C of centrifugation 10min collect supernatant, with miillpore filter (hole
0.22 μm of diameter) filtering, with PBS by filtrate to dilute in equal volume, mixing is spare.
(2) point of detection line and control line sprays
The bacteriophage (2.0 × 10 of ENR antigenic epitopes is diluted with 10mM PBS (pH 7.4)11pfu)、 0.5mg/ml
Sheep anti-mouse igg secondary antibody, with XYZ three-dimensional points spray instrument difference specking on nitrocellulose filter, as test strips detection line and
Nature controlling line, line-to-line are spare every about 7mm, 37 DEG C of dry 12h.
(3) the anti-ENR monoclonal antibodies of colloid gold label
Use K2CO3It is 8.2 to adjust 1ml colloidal gold solutions (40nm) to pH value, dilutes anti-ENR monoclonal antibodies extremely with distilled water
0.04mg/ml takes and is slowly added in colloidal gold solution in right amount, is stirred in drop, and after being stirred to react 1h, 100 μ l 1%PEG are added
Into solution, continue to stir 30min；100 μ l 10%BSA solution are added, stir 30min, 4 DEG C of 8000rpm centrifuge 30min,
Supernatant is abandoned, precipitation is resuspended in 100 μ l re-suspension liquids, and 4 DEG C of preservations are spare.
(4) colloidal gold labeled monoclonal antibody compound sprays bonding pad
Colloidal gold labeled monoclonal antibody compound is diluted into a certain concentration, is sprayed the compound after dilution with XYZ three-dimensional points spray instrument
It is applied on bonding pad, 30 DEG C of dry 2h are spare.
(5) assembling of colloidal gold strip
Nitrocellulose filter, gold conjugation pad, sample pad and blotting paper are assembled in successively on PVC bottom plates, cutter is used
The test strips for cutting into 4mm wide are fitted into detection card, spare.
(5) detection of sample
80 μ l sample extracting solutions are added in test strips well, testing result are observed after 10min, if containing in sample
ENR and detection threshold value more than colloidal gold strip, then the not aobvious red of detection line, and nature controlling line develops the color；If not contained in sample
ENR and the detection threshold value for being less than colloidal gold strip, then the aobvious red of detection line, nature controlling line are aobvious red.If the not aobvious red of nature controlling line,
Show that test strips fail.
In addition, the light absorption value that instrument reads detection line and nature controlling line in test strips is read by portable colloidal gold, with ENR
Log concentration is abscissa, using the ratio of detection line/nature controlling line as ordinate, establishes standard curve and is built in reading instrument,
By being scanned to detection line and nature controlling line that extracting solution test strips are added, the content of ENR in sample can quickly be calculated by reading instrument.
The application of embodiment 6, ENR antigenic epitopes as solid phase antigen in fluorescence immune chromatography method
(1) sample extraction
By fat and the connective tissue removal of pork, is smashed with blender, weigh 2g in the centrifuge tube of 15ml, add
Methanol-the PBS solution for entering 4ml 50%, vibrates 3min on the oscillator；4000rpm centrifuges 10min.Precipitation repeats above-mentioned oscillation
And centrifugation step, merge supernatant twice, again 10000rpm, 4 DEG C of centrifugation 10min collect supernatant, with miillpore filter (hole
0.22 μm of diameter) filtering, with PBS by filtrate to dilute in equal volume, mixing is spare.
(2) point of detection line and control line sprays
The bacteriophage (2.0 × 10 of ENR antigenic epitopes is diluted with 10mM PBS (pH 7.4)11Pfu), 0.5mg/ml
Sheep anti-mouse igg secondary antibody, with XYZ three-dimensional points spray instrument difference specking on nitrocellulose filter, detection line and matter as test strips
Line is controlled, line-to-line is spare every about 7mm, 37 DEG C of dry 12h.
(3) fluorescent microsphere marks anti-ENR monoclonal antibodies
The fluorescent microsphere of 25 μ l is added in 4.5ml PB solution (pH6.0), EDC is added and activates 15min, takes appropriate 0.9 μ
The anti-ENR monoclonal antibodies of g are slowly added in PB solution, are stirred to react 2h；500 μ l 10%BSA solution are added, are stirred to react 30min, 4
DEG C 8000rpm centrifuges 10min, abandons supernatant, and precipitation is resuspended in 500 μ l re-suspension liquids, and 4 DEG C of preservations are spare.
(4) fluorescent microsphere labelled antibody compound sprays bonding pad
Fluorescent microsphere labelled antibody compound is diluted into a certain concentration, sprays instrument by the compound after dilution with XYZ three-dimensional points
It is sprayed on bonding pad, 30 DEG C of dry 2h are spare.
(5) assembling of fluorescent microsphere test strips
Nitrocellulose filter, fluorescent microsphere bonding pad, sample pad and blotting paper are assembled in successively on PVC bottom plates, with cutting
The test strips that knife cuts into 4mm wide are fitted into detection card, spare.
(5) detection of sample
80 μ l sample extracting solutions are added in test strips well, testing result is observed under ultraviolet irradiation lamp after 15min,
If the detection threshold value in sample containing ENR and more than test strips, detection line does not show fluorescence, and nature controlling line shows fluorescence；If sample
In detection threshold value without containing ENR and less than test strips, then detection line show fluorescence, nature controlling line shows fluorescence.If nature controlling line does not show glimmering
Light shows that test strips fail.
In addition, the fluorescent value that instrument reads detection line and nature controlling line in test strips is read by Portable fluorescence, it is dense with ENR
Degree logarithm is abscissa, using the ratio of detection line/nature controlling line as ordinate, establishes standard curve and is built in reading instrument, lead to
The detection line to extracting solution test strips are added and nature controlling line scanning are crossed, the content of ENR in sample can quickly be calculated by reading instrument.
The preparation of embodiment 7, ENR antigenic epitopes
(1) in a manner of Phage amplification
The bacteriophage of ENR antigenic epitopes is added to 20ml in the Escherichia coli for being inoculated with ER 2738,37 DEG C
150rpm shaken cultivations 4.5h.Culture is transferred in another centrifuge tube, 4 DEG C of 12000g centrifuge 10min, by the top of supernatant
80% is transferred in a fresh tube, the PEG/NaCl of 1/6 volume is added, 4 DEG C stand overnight.4 DEG C of 12000g centrifuge 15min, precipitation
It is resuspended in 1ml TBS, 4 DEG C of 14000rpm centrifuge 5min；Supernatant is transferred in another centrifuge tube, and the PEG/ of 1/6 volume is added
NaCl, is incubated 1h on ice, and 4 DEG C of 14000rpm centrifuge 10min；Supernatant is abandoned, presents and is resuspended in 200 μ l TBS, this is bacteriophage
Liquid is expanded, 4 DEG C of preservations or glycerol adding freeze.
(2) it is prepared in a manner of ENR antigenic epitopes-fusion protein
A.PCR expands the external source encoding gene of ENR antigenic epitopes
PCR reaction systems：(50μl)
10×Pyrobest Buffer(Mg2+plus)5μl
dNTP Mixture(each for 2.5mM)4μl
M13KE insert extension primer(10mM)1μl
-96gIII sequencing primer(10mM)1μl
1 μ l of phage DNA template
Pyrobest DNA Polymerase 0.5μl
Sterilize 37.5 μ l of ddH2O
PCR reaction conditions：95 DEG C of 5min, then 95 DEG C of 30sec, 55 DEG C of 30sec, 72 DEG C of 40sec, 72 DEG C of 10min are total
30cycles。
Using PCR product QIAquick Gel Extraction Kit purified pcr product, trace dna quantitative instrument is quantitative.ENR antigens simulation of the present invention
The coding gene sequence of epitope corresponds to respectively： GGTAAGCCTTATTTAACTTGG
B. the double digestion of external source encoding gene and expression vector
The external source code gene of ACC65I and Eag I enzymes and expression vector is respectively adopted, and (pMAl-pIII, NEB company, can
Express MBP fusion proteins) carry out double digestion.
C. after digestion product connection and conversion
By plasmid pMal-PIII and target fragment with 1: 10 (molar ratio) mixing, 12 h are connected in 16 DEG C of water-baths, take 10 μ l
Connection product adds in 100 μ l competent cells TB1, mixes well.After ice bath 30min, 42 DEG C of water-bath heat shock 90s, ice immediately
600 μ l LB liquid mediums are added after bath 5min, 37 DEG C of 200rpm cultivate 1h, and 10000rpm centrifuges 1min, sucks supernatant and stay
About 200 μ l are taken, are coated in LB-A solids (Ampr) culture medium, 37 DEG C are incubated overnight, and obtain positive colony.
The expression of D.ENR antigenic epitope-MBP fusion proteins
By the positive clone molecule of above-mentioned acquisition, it is inoculated in 5ml LB-A, 0.2% sucrose from a single bacterium colony is chosen on tablet,
37 DEG C of 220rpm shaken cultivations are stayed overnight, and overnight culture is inoculated in the LB-A of 50ml, 0.2% sugarcane by 1% inoculum concentration (v/v)
In sugar culture-medium, 37 DEG C of 220rpm shaken cultivations, when culture bacterial concentration reaches 0.6 (OD600nm) when, it is added into culture
PEG solution is collected bacterial sediment by IPTG to final concentration of 0.2mM, 220rpm shaken cultivations in 4 DEG C of 4000g centrifugations 20min,
Abandon supernatant.Cell is resuspended in 400ml [30mM Tris-HCl, 20% sucrose, pH 8.0 (80ml/g wet cell weights)], is added
EDTA to 1mM shakes 10min at room temperature, and 4 DEG C of 8000g centrifuge 20min, abandon supernatant, and precipitation is resuspended in the 5mM of 400ml precoolings
MgSO4, 10min is shaken on ice, and 4 DEG C of 8000g centrifuge 20min, retain supernatant, and 8ml 1M Tris-HCl are added into supernatant
(pH 7.4) obtains ENR antigenic epitope-MBP fusion proteins.
The embodiments of the present invention have been described in detail above, but content is only the preferred embodiment of the present invention,
It is not intended to limit the invention.All all any modification, equivalent and improvement etc. done in the application range of the present invention, should all
It is included within protection scope of the present invention.
Claims (10)
1. a kind of epitope peptide of simulation ENR, amino acid sequence are：GKPYITW.
2. the gene of epitope peptide, nucleotides sequence described in a kind of coding claim 1 are classified as：GGTAAGCCTTATTTAACT
TGG。
3. the preparation method of epitope peptide described in claim 1, it is characterised in that include the following steps：There to be ENR antigens
The bacteriophage of mimic epitope is added to 20ml in the culture solution for being inoculated with 2738 Escherichia coli of ER, 37 DEG C of 150rpm shaken cultivations
4.5h；Culture is transferred in another centrifuge tube, 4 DEG C of 12000g centrifuge 10min, and the part of 80% volume of supernatant top is transferred to
In another centrifuge tube, the PEG/NaCl of 1/6 volume is added, 4 DEG C stand overnight；4 DEG C of 12000g centrifuge 15min, and precipitation is resuspended in
In 1ml TBS, 4 DEG C of 14000rpm centrifuge 5min；Supernatant is transferred in another centrifuge tube, the PEG/NaCl of 1/6 volume is added, on ice
It is incubated 1h, 4 DEG C of 14000rpm centrifuge 10min；Supernatant is abandoned, precipitation is resuspended in 200 μ l TBS.
4. the preparation method of epitope peptide described in claim 1, it is characterised in that include the following steps：
1) PCR amplification sequence is the DNA fragmentation of GGTAAGCCTTATTTAACTTGG, ACC65I and Eag I enzymes are respectively adopted to this
DNA fragmentation and pMAl-pIII expression vectors carry out double digestion；By plasmid pMal-PIII and the DNA fragmentation with 1:10 molar ratio
Mixing connects 12h in 16 DEG C of water-baths, takes 10 μ l connection products to add in 100 μ l competent cells TB1, mix well；Ice bath
After 30min, 42 DEG C of water-bath heat shock 90s add 600 μ l LB liquid mediums, 37 DEG C of 200rpm cultures immediately after ice bath 5min
1h, 10000rpm centrifuge 1min, suck supernatant and leave and take about 200 μ l, are coated in LB-A solid mediums, and 37 DEG C are incubated overnight,
Obtain positive colony.
2) it by the positive clone molecule of above-mentioned acquisition, is inoculated in 5ml LB-A, 0.2% sucrose from a single bacterium colony is chosen on tablet, 37
DEG C 220rpm shaken cultivations are stayed overnight, and overnight culture is inoculated in the LB-A of 50ml, 0.2% sucrose by the inoculum concentration of 1% (v/v)
In culture medium, 37 DEG C of 220rpm shaken cultivations, when culture bacterial concentration reaches OD600nmWhen value is 0.6, it is added into culture
PEG solution is collected bacterial sediment by IPTG to final concentration of 0.2mM, 220rpm shaken cultivations in 4 DEG C of 4000g centrifugations 20min,
Abandon supernatant；Cell is resuspended in the solution that 400ml contains that 30mM Tris-HCl, 20% sucrose and pH are 8.0, EDTA is added extremely
1mM, shakes 10min at room temperature, and 4 DEG C of centrifugation 20min of 8000g abandon supernatant, precipitation is resuspended in the 5mM MgSO of 400ml precoolings4,
10min is shaken on ice, and 4 DEG C of 8000g centrifuge 20min, retain supernatant, and it is 7.4, a concentration of 1M's that 8ml pH are added into supernatant
Tris-HCl obtains ENR antigenic epitope-MBP fusion proteins.
5. epitope peptide described in claim 1 is used to detect ENR in food as the competition antigen of enzyme linked immunosorbent assay
Using.
6. epitope peptide described in claim 1 is used to detect ENR in food as the solid phase antigen of enzyme linked immunosorbent assay
Using.
7. epitope peptide described in claim 1 is used to detect the application of ENR in food as the detection line of colloid gold test paper.
8. application according to claim 7, it is characterised in that include the following steps：
With bacteriophage of the 10mM PBS buffer solution dilution with ENR antigenic epitopes to 2.0 × 1011Pfu takes 0.5mg/ml's
Sheep anti-mouse igg secondary antibody, with XYZ three-dimensional points spray instrument difference specking on nitrocellulose filter, detection line and matter as test strips
Line is controlled, line-to-line is spare every about 7mm, 37 DEG C of dry 12h.Use K2CO3It is 8.2 to adjust 1ml colloidal gold solutions to pH value, with distillation
Water dilutes anti-ENR monoclonal antibodies to 0.04mg/ml, is then slowly added into colloidal gold solution, stirs, is stirred to react in drop
It after 1h, is added in 100 μ l 1%PEG to solution, continues to stir 30min；It is added 100 μ l 10%BSA solution, stirs 30min, 4
DEG C 8000rpm centrifuges 30min, abandons supernatant, and precipitation is resuspended in 100 μ l re-suspension liquids, and 4 DEG C save backup；Colloidal gold labeled monoclonal antibody is answered
Object dilution is closed, the compound after dilution is sprayed on bonding pad with XYZ three-dimensional points spray instrument, 30 DEG C of dry 2h are spare；By nitric acid
Cellulose membrane, gold conjugation pad, sample pad and blotting paper are assembled in successively on PVC bottom plates, and the examination of 4mm wide is cut into cutter
Paper slip is fitted into detection card, spare；80 μ l sample extracting solutions are added in test strips well, testing result is observed after 10min.
9. epitope peptide described in claim 1 is used to detect the application of ENR in food as the detection line of fluorescent microsphere test paper.
10. application according to claim 9, it is characterised in that include the following steps：
With 10mM bacteriophages of the PBS dilutions with ENR antigenic epitopes to 2.0 × 1011Pfu takes the sheep anti mouse of 0.5mg/ml
IgG secondary antibodies, with XYZ three-dimensional points spray instrument difference specking on nitrocellulose filter, as the detection line and nature controlling line of test strips, two
Line interval is about 7mm, 37 DEG C of dry 12h, spare.The fluorescent microsphere of 25 μ l is added in 4.5ml PB solution, EDC activation is added
15min takes the anti-ENR monoclonal antibodies of 0.9 μ g to be slowly added in PB solution, is stirred to react 2h；500 μ l 10%BSA solution are added, stir
It mixes reaction 30min, 4 DEG C of 8000rpm and centrifuges 10min, abandon supernatant, precipitation is resuspended in 500 μ l re-suspension liquids, and 4 DEG C save backup.By fluorescence
Microballoon labelled antibody compound dilutes, and the compound after dilution is sprayed on bonding pad with XYZ three-dimensional points spray instrument, 30 DEG C of dryings
2h, it is spare；Nitrocellulose filter, fluorescent microsphere bonding pad, sample pad and blotting paper are assembled in successively on PVC bottom plates, with cutting
The test strips that knife cuts into 4mm wide are fitted into detection card, spare；80 μ l sample extracting solutions are added in test strips well,
After 15min testing result is observed under ultraviolet irradiation lamp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810086387.5A CN108387740B (en) | 2018-01-29 | 2018-01-29 | Epitope peptide for simulating enrofloxacin, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810086387.5A CN108387740B (en) | 2018-01-29 | 2018-01-29 | Epitope peptide for simulating enrofloxacin, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108387740A true CN108387740A (en) | 2018-08-10 |
| CN108387740B CN108387740B (en) | 2020-04-24 |
Family
ID=63074411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810086387.5A Active CN108387740B (en) | 2018-01-29 | 2018-01-29 | Epitope peptide for simulating enrofloxacin, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108387740B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112067515A (en) * | 2020-09-03 | 2020-12-11 | 南昌大学 | Dynamic light scattering immunization method for homogeneous detection of macromolecular antigen |
| CN112067815A (en) * | 2020-09-03 | 2020-12-11 | 南昌大学 | Homogeneous immunization method for detecting small molecule hapten |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1724560A (en) * | 2005-06-20 | 2006-01-25 | 北京市农林科学院 | Antigen mimic epitope peptide of C-type haemophilus paragallinarum and application thereof |
| CN101186644A (en) * | 2007-12-05 | 2008-05-28 | 中国药科大学 | H3 type flu virus hemagglutinin space conformation simulation antigen epitope and application thereof |
| CN101565454A (en) * | 2009-06-04 | 2009-10-28 | 上海市肺科医院 | Mimic epitope peptide of mycobacterium tuberculosis MPT64 antigen and the application thereof |
| CN101597327A (en) * | 2008-10-28 | 2009-12-09 | 中国人民解放军第二军医大学 | Molecular mimic peptide of a kind of O type foot and mouth disease virus antigen epitope and uses thereof |
| CN103848895A (en) * | 2012-12-21 | 2014-06-11 | 南昌大学 | Mimic epitope of linear dodecapeptide antigen of aflatoxin B1 and application thereof |
| CN103848896A (en) * | 2014-02-17 | 2014-06-11 | 南昌大学 | Antigenic mimic epitope Ph5 of bisphenol A and application thereof |
-
2018
- 2018-01-29 CN CN201810086387.5A patent/CN108387740B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1724560A (en) * | 2005-06-20 | 2006-01-25 | 北京市农林科学院 | Antigen mimic epitope peptide of C-type haemophilus paragallinarum and application thereof |
| CN101186644A (en) * | 2007-12-05 | 2008-05-28 | 中国药科大学 | H3 type flu virus hemagglutinin space conformation simulation antigen epitope and application thereof |
| CN101597327A (en) * | 2008-10-28 | 2009-12-09 | 中国人民解放军第二军医大学 | Molecular mimic peptide of a kind of O type foot and mouth disease virus antigen epitope and uses thereof |
| CN101565454A (en) * | 2009-06-04 | 2009-10-28 | 上海市肺科医院 | Mimic epitope peptide of mycobacterium tuberculosis MPT64 antigen and the application thereof |
| CN103848895A (en) * | 2012-12-21 | 2014-06-11 | 南昌大学 | Mimic epitope of linear dodecapeptide antigen of aflatoxin B1 and application thereof |
| CN103848896A (en) * | 2014-02-17 | 2014-06-11 | 南昌大学 | Antigenic mimic epitope Ph5 of bisphenol A and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| NAM-GUN KIM ET AL.: "Magnetic nanoparticle based purification and enzyme-linked immunosorbent assay using monoclonal antibody against enrofloxacin", 《J VET SCI》 * |
| 邓省亮等: "采用噬菌体展示技术筛选黄曲霉毒素B1 模拟抗原表位", 《卫生研究》 * |
| 黄丽群等: "从噬菌体肽库中筛选抗原模拟表位的研究进展", 《国外医学皮肤性病学分册》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112067515A (en) * | 2020-09-03 | 2020-12-11 | 南昌大学 | Dynamic light scattering immunization method for homogeneous detection of macromolecular antigen |
| CN112067815A (en) * | 2020-09-03 | 2020-12-11 | 南昌大学 | Homogeneous immunization method for detecting small molecule hapten |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108387740B (en) | 2020-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108387740A (en) | A kind of epitope peptide, preparation method and the application of simulation Enrofloxacin | |
| CN104530194B (en) | Antigenic epitope for ochratoxin A and its application | |
| CN103848895B (en) | The linear dodecapeptide antigenic epitope of aflatoxin B1 and its application | |
| CN104327166B (en) | The dodecapeptide antigenic epitope of ochratoxin A and its application | |
| CN108373495A (en) | A kind of epitope peptide, preparation method and the application of simulation dienestrol | |
| CN108358996A (en) | A kind of epitope peptide, preparation method and the application of simulation diethylstilbestrol | |
| CN105315346B (en) | Peptide molecule and its application of deoxynivalenol can be specifically bound | |
| CN104530195B (en) | Simulate antigenic epitope and its application of ochratoxin A | |
| CN103145808B (en) | Antigen mimic epitope of ochratoxin A and application thereof | |
| CN104311634B (en) | Aflatoxin B1Antigenic epitope AM 1 and its application | |
| CN104311637B (en) | Simulation fumonisins B1Antigenic epitope and its application | |
| CN103848896B (en) | The antigenic epitope Ph5 of bisphenol-A and application thereof | |
| CN104356207B (en) | Fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN104788543B (en) | A kind of zearalenone antibody analog and its application based on polypeptide | |
| CN103848898B (en) | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof | |
| CN104311636B (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN104356208B (en) | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN103848897B (en) | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof | |
| CN104311635B (en) | For fumonisins B1Antigenic epitope and its application | |
| CN109293779A (en) | A kind of multimeric complexes and preparation method thereof | |
| CN104311638B (en) | Fumonisins B can be simulated1Antigenic epitope and its application | |
| Karbanowicz et al. | Extracellular expression of the HT1 neurotoxin from the Australian paralysis tick in two Saccharomyces cerevisiae strains | |
| CN104119425B (en) | The antigenic epitope of simulation norfloxacin and application thereof | |
| CN103342739B (en) | Antigenic mimic epitope of fumonisin B1 and application thereof | |
| CN103848899B (en) | The antigenic epitope Ph15 of bisphenol-A and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |